ID: 1150238268 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:63610860-63610882 |
| Sequence | CAGGTGAAGCAGCAGCTGGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1150238268_1150238273 | 12 | Left | 1150238268 | 17:63610860-63610882 | CCGTCCAGCTGCTGCTTCACCTG | No data | ||
| Right | 1150238273 | 17:63610895-63610917 | CCCAGTATCCATTGAATCTTTGG | 0: 1 1: 0 2: 4 3: 13 4: 77 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1150238268 | Original CRISPR | CAGGTGAAGCAGCAGCTGGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||