ID: 1150238268

View in Genome Browser
Species Human (GRCh38)
Location 17:63610860-63610882
Sequence CAGGTGAAGCAGCAGCTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150238268_1150238273 12 Left 1150238268 17:63610860-63610882 CCGTCCAGCTGCTGCTTCACCTG No data
Right 1150238273 17:63610895-63610917 CCCAGTATCCATTGAATCTTTGG 0: 1
1: 0
2: 4
3: 13
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150238268 Original CRISPR CAGGTGAAGCAGCAGCTGGA CGG (reversed) Intergenic
No off target data available for this crispr