ID: 1150238640

View in Genome Browser
Species Human (GRCh38)
Location 17:63613900-63613922
Sequence CAGCCAGGGCCTCTAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150238640_1150238645 -1 Left 1150238640 17:63613900-63613922 CCCTCTGCTAGAGGCCCTGGCTG No data
Right 1150238645 17:63613922-63613944 GAATCCAAGAGGAACAGCAAAGG No data
1150238640_1150238647 21 Left 1150238640 17:63613900-63613922 CCCTCTGCTAGAGGCCCTGGCTG No data
Right 1150238647 17:63613944-63613966 GCTGTGCCTCCAACCAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150238640 Original CRISPR CAGCCAGGGCCTCTAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr