ID: 1150239516

View in Genome Browser
Species Human (GRCh38)
Location 17:63621145-63621167
Sequence CTGTTCCAGTGTAATATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150239516_1150239521 9 Left 1150239516 17:63621145-63621167 CCTGACATATTACACTGGAACAG No data
Right 1150239521 17:63621177-63621199 AAAGGAGCCCACATTAATTGTGG No data
1150239516_1150239525 18 Left 1150239516 17:63621145-63621167 CCTGACATATTACACTGGAACAG No data
Right 1150239525 17:63621186-63621208 CACATTAATTGTGGTGGACTTGG No data
1150239516_1150239519 -9 Left 1150239516 17:63621145-63621167 CCTGACATATTACACTGGAACAG No data
Right 1150239519 17:63621159-63621181 CTGGAACAGAGGCCGGAGAAAGG No data
1150239516_1150239522 12 Left 1150239516 17:63621145-63621167 CCTGACATATTACACTGGAACAG No data
Right 1150239522 17:63621180-63621202 GGAGCCCACATTAATTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150239516 Original CRISPR CTGTTCCAGTGTAATATGTC AGG (reversed) Intergenic
No off target data available for this crispr