ID: 1150240617

View in Genome Browser
Species Human (GRCh38)
Location 17:63629157-63629179
Sequence CTGAACTCCAGCATGGCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1114
Summary {0: 1, 1: 5, 2: 101, 3: 373, 4: 634}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150240617_1150240620 22 Left 1150240617 17:63629157-63629179 CCTGTCGCCATGCTGGAGTTCAG 0: 1
1: 5
2: 101
3: 373
4: 634
Right 1150240620 17:63629202-63629224 AACCTCCGCCTCCTGTGTTCAGG 0: 8
1: 568
2: 2480
3: 4493
4: 5450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150240617 Original CRISPR CTGAACTCCAGCATGGCGAC AGG (reversed) Intronic
900019152 1:175410-175432 CTGCACTCCAGCATGGGGGACGG + Intergenic
900049410 1:533997-534019 CTGCACTCCAGCATGGGGGATGG + Intergenic
900071642 1:775804-775826 CTGCACTCCAGCATGGGGGACGG + Intergenic
900193730 1:1363044-1363066 CTGCACTCCAGCCTGGTGATAGG + Intergenic
901489097 1:9587531-9587553 CTGCATTCCAGCCTGGTGACAGG - Intergenic
901564648 1:10103467-10103489 CTGCACTCCAGCCTGGTGATAGG - Intronic
901609626 1:10487519-10487541 CTGCACTCCAGCCTGGCGATAGG - Intronic
902198609 1:14817026-14817048 CTGAACTCCAGCTTGGCCAATGG - Intronic
903303063 1:22392670-22392692 CTGCACTCCAGCCTGGGCACAGG + Intergenic
903334363 1:22615036-22615058 CTGCTCTCCAGCATGGTGCCTGG + Intergenic
903417319 1:23192798-23192820 CTACACTCCAGCCTGGCGAGAGG + Exonic
903696556 1:25211710-25211732 CTGCACTCCAGCCTGGGCACTGG - Intergenic
903802548 1:25980357-25980379 TTGTACTCCAGCCTGGTGACAGG - Intronic
903882804 1:26523215-26523237 CTGCCCTCCAGCCTGGTGACAGG + Intergenic
904007597 1:27371794-27371816 CTGTACTCCAGCCTGGTAACAGG - Intronic
904104312 1:28065307-28065329 CTGCACTCCAGCCTGGTGACAGG - Intronic
904224768 1:29007126-29007148 CTGCACTCCAGCCTGACAACAGG - Intronic
904844861 1:33403161-33403183 CTGCACTTCAGCCTGGCGACAGG - Intronic
905133099 1:35776371-35776393 CTGCACTCCAGCCTGGCCAACGG + Intergenic
905385218 1:37598606-37598628 CTGCACTCCAGCCTGGTGAAAGG - Intergenic
905529440 1:38664922-38664944 CTGCACTCCAGCCTGGTGACAGG + Intergenic
905582578 1:39093520-39093542 CTGCACTCCAGCCTGGTGACAGG - Intronic
905650718 1:39654976-39654998 CTGCACTCCAGCCTGGCATCAGG - Intergenic
905748462 1:40439904-40439926 CTGCACTCCAGCCTGGCGACAGG + Intergenic
905980107 1:42217490-42217512 CTGCATTCCAGCCTGGCGACAGG + Intronic
906006654 1:42478720-42478742 CTGCACTCCAGCCTGGGGAACGG + Intronic
906220877 1:44078467-44078489 CTGCACTGCAGCCTGGCAACAGG - Intergenic
906354635 1:45094090-45094112 CTGCACTCCAGCCTGGCGACAGG - Intronic
906387780 1:45386688-45386710 CTGTACTCCAGCTTGGCAACAGG - Intronic
906454362 1:45981106-45981128 CTGCACTCCAGCCTGGGCACTGG - Intronic
906542199 1:46595786-46595808 CTGCACTCCAGCCTGGCTAATGG - Intronic
906731261 1:48083342-48083364 CTACACTCCAGCCTGGTGACAGG - Intergenic
907035725 1:51214329-51214351 CTGCACTCCAGCCTGGTGACAGG + Intergenic
907591440 1:55676182-55676204 CTGCACTCCAGCCTGGAGCCTGG - Intergenic
907851893 1:58262546-58262568 CTACACTCCAGCCTGGTGACAGG + Intronic
907904479 1:58771900-58771922 CTGCACTCCAGCCTGGCAGCAGG - Intergenic
908125115 1:61023019-61023041 CTGAACTCCAGCCTGGGCAAAGG + Intronic
909009671 1:70320368-70320390 CTGCACTCCAGCCTGGAGCCTGG - Intronic
909177959 1:72383596-72383618 CTGCACTCCAGCCTGGTGACAGG + Intergenic
909326358 1:74355565-74355587 TTGCACTCCAGCCTGGCAACAGG + Intronic
910224742 1:84924823-84924845 CTGCACTCTAGCCTGGCAACAGG + Intergenic
910671488 1:89777783-89777805 CTGCACCCCAGCCTGGTGACGGG - Intronic
910725473 1:90333782-90333804 CTGCACTCCAGCCTGGTAACAGG + Intergenic
910932136 1:92453183-92453205 CTGCACTCCAGCTTGGCGGCAGG - Intergenic
911117109 1:94257363-94257385 CTACACTCCAGCCTGGCAACAGG + Intronic
911387433 1:97194539-97194561 CTGCACTCCAGCCTGGTGACAGG - Intronic
911474647 1:98360442-98360464 CTCCACTCCAGCCTGGAGACAGG + Intergenic
911905412 1:103561852-103561874 CTGAACTCCAGTATTACAACAGG - Intronic
912445834 1:109735677-109735699 CTGCACTCCAGCCTGGCTACAGG - Exonic
912595940 1:110875738-110875760 CAGGACTCCAGCATGGCTGCTGG + Intronic
913359756 1:117967259-117967281 CTGCACTCCAGTCTGGTGACAGG + Intronic
914000752 1:143692348-143692370 CTGAACTCCCGCAGGACCACGGG + Intergenic
914217676 1:145647766-145647788 CTGCACTCCAGCCTGGGGAGAGG + Intronic
914470242 1:147970458-147970480 CTGCACTCCAGCCTGGGGAGAGG + Intronic
915123290 1:153646396-153646418 CTGCACTCCAGCCTGGTGACAGG - Intergenic
915126291 1:153667440-153667462 CTGCACTCCAGCCTGGCCAACGG + Intronic
915236512 1:154487233-154487255 CGGCACTCCACCCTGGCGACAGG + Intronic
915342592 1:155184599-155184621 CTGAACTACAGCCTTGGGACAGG + Exonic
915369892 1:155340218-155340240 CTGTACTCCAGCCTGGCAACAGG - Intronic
915394778 1:155574901-155574923 CTGCACTCCAACCTGGCAACAGG - Intergenic
916042998 1:160977499-160977521 CTGCACTCTAGCCTGGTGACAGG + Intergenic
917131832 1:171751104-171751126 CTGCACTCCAGCCTGGTGACAGG - Intergenic
918032078 1:180824542-180824564 TTGCACTCCAGCCTGGCAACAGG + Intronic
918181806 1:182090768-182090790 CAGAATCCCAGCATGGCAACCGG + Intergenic
918201370 1:182270024-182270046 CTGCACTCCAGCCTGGTGACAGG + Intergenic
918441700 1:184574166-184574188 CTGCACTCCAGCATGGGTAACGG + Intronic
918506698 1:185262821-185262843 CTGCACTCCAGCCTGGGCACAGG - Intronic
919016078 1:192038319-192038341 CTGCCCTCCAGCCTGGCGCCTGG + Intergenic
919363407 1:196624368-196624390 CTGCACTCCAGCCTGGTGATAGG + Intergenic
919461071 1:197878390-197878412 CTGCACTCCAGCCTGGGGAATGG - Intergenic
919518000 1:198550829-198550851 CTGCACTCCAGCCTGGTGACAGG + Intergenic
919628400 1:199935333-199935355 CTGCACTCCAGCCTGGCGACAGG - Intergenic
919673229 1:200356857-200356879 CTGCACTCCAGCCTGGTGACAGG - Intergenic
919687853 1:200500905-200500927 CTGAACTCCTCCATGGCTACTGG + Intergenic
919885064 1:201927527-201927549 CTGCACTCCAGCCTGGTGACAGG + Intronic
919901162 1:202045399-202045421 CTGCACTCCAGCCTGGCAACAGG - Intergenic
919964894 1:202513008-202513030 CTGCACTCCAGCCTGGGCACTGG - Intronic
920223734 1:204423409-204423431 CTACACTCCAGCCTGGCGACAGG + Exonic
920404375 1:205697891-205697913 CTGAACTCAGGCAGGGAGACTGG - Intergenic
920539466 1:206767207-206767229 TTGCACTCCAGCCTGGAGACAGG + Intergenic
920555996 1:206905053-206905075 CTGTCCTCCATCATGGCGGCAGG + Exonic
920893549 1:210019097-210019119 CTGCACTCCAGACTGGCAACAGG + Intronic
920938824 1:210461333-210461355 CTGCACTCCAGCCTGGTGACAGG - Intronic
921107473 1:211996985-211997007 CTGCACTCCAGCCTGGGCACTGG + Intronic
921861114 1:220042882-220042904 CTGCACTCCAGCCTGGTGACAGG + Intronic
922156344 1:223042367-223042389 CTGCACTCCAGCCTGGTGATAGG + Intergenic
922266570 1:223989763-223989785 CTGCACTCCAGCATGGGGGACGG + Intergenic
922333101 1:224595081-224595103 CTGCACTCCAGCCTGACAACAGG - Intronic
922627724 1:227066351-227066373 CCGCACTCCAGCCTGGTGACAGG + Intronic
922862058 1:228827457-228827479 CTGCACCCCACCCTGGCGACAGG - Intergenic
922991004 1:229911472-229911494 CTGTACTCCAGCCTGGCGACAGG - Intergenic
923151269 1:231235458-231235480 CTGCACTCCAGCCTGGTGACAGG + Intronic
923533682 1:234831624-234831646 CTGCACTCCAGCCTGGGGAACGG + Intergenic
923604217 1:235428678-235428700 CTGCACTCCAGCCTGGCGACAGG - Intronic
923742925 1:236672442-236672464 CTGCACTCCAGCCTGGCGACAGG + Intergenic
923889971 1:238202962-238202984 CTGCACTCCAGCATGGGCAACGG - Intergenic
923890644 1:238211626-238211648 CTGCACTCCAGCCTGGCGACAGG + Intergenic
924349197 1:243098900-243098922 CTGCACTCCAGCATGGGGGACGG + Intergenic
924349824 1:243104080-243104102 CTGCACTCCAGCCTGGCGACAGG + Intergenic
924381865 1:243472732-243472754 CTGAACTCCAGCAGGAGAACAGG + Intronic
924535739 1:244934225-244934247 CTGCACTCCAGCCTGGTGACAGG - Intergenic
924763083 1:247007457-247007479 CCGAACTCCAGCCTGGCGACAGG + Intronic
924774054 1:247103594-247103616 TTGCACTCCAGCCTGGCGACAGG + Intronic
1062785552 10:261694-261716 TTGCACTCCAGCCTGGCAACAGG + Intergenic
1062920411 10:1274873-1274895 CTGAACTCAAGGATGGCTGCAGG + Intronic
1063481080 10:6377142-6377164 CTGCACTCCAGCCTGGGCACAGG - Intergenic
1064034435 10:11903632-11903654 CTGTACTCCAGCCTGGTGACAGG + Intergenic
1064076634 10:12274028-12274050 CTTTACTCCAGCCTGGTGACAGG + Intergenic
1064080814 10:12306694-12306716 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1064080940 10:12307545-12307567 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1064151649 10:12870717-12870739 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1064260553 10:13782478-13782500 CTGCACTCCAGCCTGGTGACAGG - Intronic
1065164746 10:22963851-22963873 CTGCACTCCAGCCTGGCAACAGG + Intronic
1065449279 10:25839322-25839344 CTGCACTCTAGCCTGACGACAGG + Intergenic
1065514311 10:26510004-26510026 CTGCACTCCAGCATGGGGGGTGG - Intronic
1065523058 10:26590548-26590570 CTGCTCTCCAGCCTGGCGACAGG - Intergenic
1065557932 10:26935254-26935276 CTGCTCTCCAGCCTGGTGACAGG + Intergenic
1066127780 10:32358606-32358628 CTGCACTCCAGCCTGGGGAACGG + Intronic
1066358876 10:34711482-34711504 CTGCACTCCAGCCTGGGCACAGG + Intronic
1066468199 10:35671583-35671605 CTGCACTCCAGCCTGGCCACAGG + Intergenic
1066519842 10:36205156-36205178 CTGCACTCCAGCCTAGGGACAGG - Intergenic
1066727170 10:38406013-38406035 CTGCACTCCAGCATGGGGGACGG - Intergenic
1067063997 10:43093514-43093536 CTGCACACCAGCATAGAGACAGG + Intronic
1068961602 10:62872103-62872125 CTGCACTTCAGCTGGGCGACAGG + Intronic
1069034557 10:63632999-63633021 CTGCACTCCAGTCTGGTGACAGG - Intergenic
1069257100 10:66346313-66346335 CTCCACTCCAGCCTGGTGACAGG - Intronic
1069333117 10:67317460-67317482 CTGCACTGCAGCCTGGCGACAGG - Intronic
1069478948 10:68763185-68763207 CTGCACTCCAACCTGGCAACAGG - Intronic
1069837451 10:71318419-71318441 CTGCACTCCAGCCTGGAGCCTGG - Intergenic
1070047591 10:72854253-72854275 CTGAACTCCAGCCTGGGCAACGG + Intronic
1070848349 10:79542109-79542131 CTGATCTCCAGCCTGGGGAGGGG + Intergenic
1070905115 10:80065328-80065350 CTGCACTCCAGCCAGGCGACAGG + Intergenic
1070925436 10:80218060-80218082 CTGATCTCCAGCCTGGGGAGGGG - Intergenic
1070946351 10:80395220-80395242 CTGCACTCCAGCCTGGGGAACGG - Intergenic
1071096297 10:81979150-81979172 CTGCACTCCAGCCTGGCGACAGG + Intronic
1071148016 10:82597882-82597904 TTGCACTCCAGCCTGGTGACAGG + Intronic
1071974624 10:90942595-90942617 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1072111295 10:92322772-92322794 CTGCACTCCAGCCTGGCGACAGG - Intronic
1072497962 10:95981354-95981376 CCGCACTCCAGCCTGGCAACTGG + Intronic
1072884086 10:99258102-99258124 CTGCACTCCAGCCTGGTGACTGG + Intergenic
1073154687 10:101337128-101337150 CTGCACTCCAGCGTGGCAACAGG - Intergenic
1073244503 10:102080123-102080145 GTGCACTCCAGCCTGGTGACAGG - Intergenic
1073396427 10:103222022-103222044 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1073762066 10:106639979-106640001 ATGCACTCCAGCCTGGCAACAGG + Intronic
1073783234 10:106861850-106861872 CTGCACTCCAGCCTGGTGACAGG + Intronic
1073795679 10:106985570-106985592 CTGCACTCCAACCTGGTGACAGG - Intronic
1073814901 10:107195970-107195992 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1074195437 10:111180398-111180420 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1074351006 10:112737105-112737127 CTCCACTCCAGCCAGGCGACAGG - Intronic
1074534426 10:114318703-114318725 CTGCACTCCAGCCTGGCGGCAGG + Intronic
1074691581 10:116010095-116010117 CTGTACTCCAGCATGGGTAATGG + Intergenic
1074797752 10:116966041-116966063 CTGCACTCCAGACTGGCGACAGG - Intronic
1074946828 10:118288020-118288042 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1075110196 10:119573017-119573039 CTGCACTCCAGCCTGGCGACAGG + Exonic
1075183577 10:120234175-120234197 CTGCACTCCAGTCTGGCGACAGG + Intergenic
1075707982 10:124513499-124513521 CTGAACTCCAGCATGGGCGATGG - Intronic
1075757731 10:124828230-124828252 CTGTACTCCAGCCTGGTCACAGG - Intronic
1076263786 10:129093192-129093214 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1076709788 10:132326366-132326388 CTGCACTCCAGCCTGGTGGCAGG - Intronic
1076901591 10:133341451-133341473 CTGTACTCCAGCCTGGCCAGAGG - Intronic
1076975754 11:170597-170619 CTGCACTCCAGCATGGGGGACGG + Intronic
1077187607 11:1242419-1242441 CTGACCTGCAGCCTGGAGACGGG + Exonic
1077517095 11:3008580-3008602 CTGCACTCCAGCCTAGCGACAGG + Intronic
1078107817 11:8369758-8369780 CTGAGCTCCAGCAAGGCCCCAGG + Intergenic
1078130691 11:8611818-8611840 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1078311216 11:10245095-10245117 CTGTACTCCAGCATGGGCAACGG + Intronic
1079184952 11:18228219-18228241 CTGCACTCAAGCCTGGCAACAGG + Intronic
1080314652 11:30935588-30935610 TTGTACTCCAGCCTGGTGACAGG - Intronic
1080505501 11:32909121-32909143 CTGCACTCCAGCCGGGCAACAGG + Intronic
1080511773 11:32981927-32981949 CTGAACTCCAGCCTGGGCAATGG - Intronic
1080766190 11:35299300-35299322 TTGCACTCCAGCCTGGCAACAGG + Intronic
1080919506 11:36694731-36694753 CTGCACTCCAGCCTGGGGCCTGG + Intergenic
1081051154 11:38343191-38343213 TTGCACTCCAGCCTGGTGACAGG - Intergenic
1081130867 11:39378357-39378379 CTGAACTCCAGCCTGGGCAGTGG - Intergenic
1081139076 11:39475309-39475331 CTGCACTCCAGCCTGGGCACAGG - Intergenic
1082049447 11:47758820-47758842 CTGTATTCCAGCCTGGTGACAGG + Intronic
1082834853 11:57644352-57644374 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1082879630 11:58025208-58025230 CTGCACTCCAGCCTGGCGACAGG - Intronic
1083548696 11:63568640-63568662 CTGCACTCTAGCCTGGTGACAGG + Intergenic
1084047868 11:66580592-66580614 CTGCACTCCAGCCTGGGGCCTGG - Intergenic
1084329020 11:68419267-68419289 CTGCACTCCAGCCTGGGCACTGG - Intronic
1084344496 11:68536322-68536344 CTACACTCCAGCAGGGCAACAGG - Intronic
1084574624 11:69981013-69981035 TTGCACTCCAGCCTGGTGACAGG + Intergenic
1084895546 11:72265047-72265069 CTGCACTTCAGCCTGGTGACAGG - Intergenic
1085082187 11:73644305-73644327 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1085174648 11:74475244-74475266 CTGCACTCCAGCCTGGAGCCTGG - Intergenic
1085614071 11:77981121-77981143 CTGGACTCCAGCCTGGAGTCAGG + Intronic
1085625243 11:78066861-78066883 CTGCACTCCAGCCTGGCAATAGG - Intronic
1086105269 11:83140540-83140562 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1086124134 11:83332553-83332575 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1086408192 11:86517534-86517556 CAGAGCTCCAACATGTCGACAGG - Intronic
1086698906 11:89876683-89876705 CTGCACTCCAGCATGGGTAATGG + Intergenic
1086707264 11:89967816-89967838 CTGCACTCCAGCATGGGTAATGG - Intergenic
1086971498 11:93085963-93085985 CTGCACTCCAGCCTGGTGATAGG - Intergenic
1087510156 11:99082220-99082242 CTGCACTGCAGCCTGACGACAGG - Intronic
1087563242 11:99818290-99818312 CTGTACTCCAGACTGGCAACAGG - Intronic
1088308737 11:108437671-108437693 CTGCACTCCAGCCTGGTGACAGG + Intronic
1088695370 11:112361819-112361841 CTGCATTCCAGCCTGGCAACAGG - Intergenic
1088948934 11:114545723-114545745 CTGCACTCCAGCCTGGAGACAGG - Intronic
1089521161 11:119064664-119064686 CTGCACTCAAGCCTGACGACTGG + Intergenic
1089523519 11:119081558-119081580 CTGACCTCCAGCCTGGAGGCTGG + Exonic
1089558345 11:119328855-119328877 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1089598631 11:119598984-119599006 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1090194260 11:124800829-124800851 CTGACGTCCAGGATGGGGACCGG + Intergenic
1090336591 11:125972388-125972410 CTGCACTCCAGCCTGGGTACTGG + Intronic
1091421163 12:341861-341883 CTGTACTCCAGCCGGGCAACAGG + Intronic
1091541228 12:1464554-1464576 CTGAACTCCAGCCTGGGCAACGG - Intronic
1092258517 12:6940016-6940038 CTGCACTCCAGCTTGGTGACAGG - Intronic
1092836817 12:12497931-12497953 CTGCACTCCAGCCTGGTGACAGG + Intronic
1093202580 12:16207688-16207710 CTGCACTCCAGCCTGGAGCCTGG - Intronic
1093484495 12:19638760-19638782 CTGCACTCCTGCCTGGCGACAGG + Intronic
1093528305 12:20131146-20131168 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1093655038 12:21684871-21684893 CTGCACTCCAGCCTGGGCACTGG - Intronic
1093840487 12:23893407-23893429 CTGCTCTCCAGCCTGGTGACAGG + Intronic
1093856838 12:24114537-24114559 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1094651014 12:32376118-32376140 CTGTACTCCAGTTTGGCAACAGG - Intronic
1094654006 12:32403631-32403653 CTGCACTCCAGCCTGGCGACAGG - Intronic
1095454207 12:42365069-42365091 CTGAACTCAAGCAGGCAGACAGG + Intronic
1095588030 12:43870294-43870316 CTGCACTCCAGCCTGGCGACAGG - Intronic
1095682256 12:44991565-44991587 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1095707682 12:45255460-45255482 CTGCACTCCAGCCTAGCGACAGG + Intronic
1095900926 12:47327287-47327309 CTGCACTCCAGCCTGGGGAATGG + Intergenic
1096209849 12:49756478-49756500 CTGCACTCCAGCCTGGCCACAGG - Intronic
1096397055 12:51274147-51274169 CTGCACTCCAGTCTGGCAACAGG + Intergenic
1096418412 12:51433910-51433932 CTGAACTCCAGCATGGCCAACGG - Intronic
1096512457 12:52138675-52138697 CTGAACTCCAGCAGCTCCACGGG + Intergenic
1096831104 12:54315241-54315263 CTACACTCCAGCCTGGTGACGGG + Intronic
1097126644 12:56781764-56781786 CTGCACTCCAGCCTGGCGATAGG + Intronic
1097311436 12:58123134-58123156 CTGCACTCCAGCCTGGTGACGGG + Intergenic
1097640427 12:62174277-62174299 CTGCCCTCCAGCTGGGCGACAGG + Intronic
1097977711 12:65706471-65706493 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1098234732 12:68407554-68407576 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1098330798 12:69350822-69350844 CTGCACTACAGCCTGGGGACAGG - Intronic
1098772935 12:74577257-74577279 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1099182985 12:79488889-79488911 CTGCACTCCAGCTTGGGTACAGG - Intergenic
1099382372 12:81970696-81970718 CTGCACTCCAGCCTGGTGCCTGG + Intergenic
1100523590 12:95399616-95399638 CTGCACTCCAGCATGGGTGCAGG + Intergenic
1100547557 12:95617628-95617650 CTACACTCCAGCCTGGCGAAAGG + Intergenic
1101181720 12:102226314-102226336 CTGCACTCCAGCCTGGAGTCTGG - Intergenic
1101384663 12:104246074-104246096 CTGCACTCCAGCCTGGAGCCTGG + Intronic
1101449563 12:104763877-104763899 CTGCACTCCAGCCTGATGACAGG - Intergenic
1101479997 12:105087214-105087236 CTGCACTCCAGCTGGGTGACAGG + Intergenic
1101933846 12:109039645-109039667 CTGAACTACAGCCTGGTGACAGG - Intronic
1102242911 12:111336482-111336504 CTGCACTCCAGCCTGGGGCCTGG - Intronic
1102784615 12:115594379-115594401 CTGCACTCCAGCTTGGTGACGGG - Intergenic
1102844139 12:116160610-116160632 CTGCACTCAAGCCTGGTGACAGG - Intronic
1102954388 12:117049988-117050010 CTGAACTCCAGCCTGGGCAATGG - Intronic
1103275404 12:119707536-119707558 CCGCACTCCAGCCTGGTGACAGG - Intronic
1103497078 12:121371236-121371258 CTGCACTCCAGCCTGGCAAAAGG - Intronic
1103635212 12:122298916-122298938 CTGCACTCCAGCCTGGCAACAGG + Intronic
1103745006 12:123116610-123116632 CTGCACTCTAGCCTGGTGACAGG + Intronic
1103880179 12:124159978-124160000 CTGACCTCCAGCCTGGGGCCTGG + Intronic
1103897414 12:124282299-124282321 CCGCACTCCAGCCTGGCGACAGG + Intronic
1103920523 12:124396958-124396980 CTCGACTCCAGCAGGGCCACGGG + Intronic
1104222037 12:126794567-126794589 CTGAACTCCAGCCTGGGAAATGG - Intergenic
1104412133 12:128567785-128567807 CAGAACTCTGGCATGGCCACAGG - Intronic
1104588562 12:130066622-130066644 TTGCACTCCAGCTGGGCGACAGG + Intergenic
1104599901 12:130145733-130145755 CTGAATTCCTGCATGGTGACAGG + Intergenic
1104601050 12:130153731-130153753 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1104901424 12:132191288-132191310 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1104994741 12:132646792-132646814 CTGGACTCCAGCCGGGCAACAGG + Intronic
1105331784 13:19424063-19424085 CTTAAGTCCAGCAAGGCAACAGG - Intronic
1105880004 13:24596461-24596483 CTTAAGTCCAGCAAGGCAACAGG + Intergenic
1105919830 13:24952392-24952414 CTTAAGTCCAGCAAGGCAACAGG - Intergenic
1105964995 13:25375607-25375629 CTGCACTCCAGCCTGACGACAGG - Intronic
1106499886 13:30317708-30317730 CTGCATTCCAGCCTGGTGACAGG + Intergenic
1106977451 13:35237216-35237238 CTGCACTCCAGCCTGGGCACCGG + Intronic
1109265761 13:60198421-60198443 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1109428332 13:62198055-62198077 CTGCACTCCAGCATGGCGACAGG + Intergenic
1110407539 13:75167769-75167791 TTGCACTCCAGCCTGGAGACTGG + Intergenic
1110815294 13:79854331-79854353 CTGCACTCCAGCCTGGAGCCTGG + Intergenic
1112013963 13:95316164-95316186 CTGCACTCCAGCCTAGTGACAGG - Intergenic
1112031929 13:95464690-95464712 CAGCACTGCAGCATGGCGTCTGG - Intronic
1112240809 13:97679392-97679414 CTGAAGACCAGCATGGCAGCAGG + Intergenic
1112306937 13:98282862-98282884 CTGCACTCCGGCCTGGCAACAGG + Intronic
1112552820 13:100437703-100437725 CTGAACTCCAGCCTGGGCAACGG - Intronic
1112591510 13:100767500-100767522 CTAAACAACAGCCTGGCGACAGG - Intergenic
1112843964 13:103614655-103614677 CTGTGCTCCAGCCTGGTGACAGG + Intergenic
1113183622 13:107660395-107660417 CTGCACTCCAGCCAGGTGACAGG + Intronic
1113556550 13:111240165-111240187 CTGCACAGCAGCATGGCGACAGG - Intronic
1113573252 13:111373614-111373636 CTGCACTCCAGAATGTTGACTGG - Intergenic
1114289545 14:21276591-21276613 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1114301751 14:21384818-21384840 ATGAACTGCAGCAAGGGGACTGG - Intergenic
1114476752 14:23000677-23000699 CTGCACTCCAGCCTGGCAACAGG + Intronic
1115144097 14:30206587-30206609 CTGCACTCCAGCCTGGCTACAGG - Intergenic
1115222463 14:31071455-31071477 TTGCACTCCAGCCTGGTGACAGG - Intronic
1115564801 14:34615990-34616012 CTGCACTCCAGCCTGGTGACAGG - Intronic
1115602037 14:34964386-34964408 CTGAACTCCAGCCTGGGCAACGG + Intergenic
1115853652 14:37606810-37606832 CTGTACTCCAAGATGGTGACAGG - Intronic
1115871635 14:37810626-37810648 CTGACCTCCAGCATGTGGACTGG + Intronic
1116047437 14:39761903-39761925 CTGCACTCCAACCTGGCAACAGG + Intergenic
1116108037 14:40536835-40536857 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1116275420 14:42826314-42826336 CTGCACTCAAGCCTGGCAACAGG - Intergenic
1116737347 14:48708838-48708860 CTGTACTCCAGCCTGGTGACAGG - Intergenic
1116843476 14:49842967-49842989 CTGCACTCCAGCCTGGCGACAGG + Intronic
1117230054 14:53707845-53707867 CTGCACTCCAGCCTGGTGACTGG + Intergenic
1117467707 14:56010025-56010047 TTGCACTCCAGCCTAGCGACAGG - Intergenic
1117835955 14:59806197-59806219 CTGCACTCCAGCCTGGTGACAGG + Intronic
1117975324 14:61291364-61291386 CTGCACTCCAGCCTGGTGACAGG - Intronic
1118234321 14:63987217-63987239 CCGCACTCCAGCCTGGCGACAGG + Intronic
1118606376 14:67506945-67506967 CTGCATTCCAGCCTGGCGACAGG + Intronic
1118871674 14:69748276-69748298 CTGCACTACAGCCTGGCAACAGG - Intronic
1119070400 14:71577411-71577433 CTGAACTCCAGCCTGGGCAACGG - Intronic
1119447893 14:74681731-74681753 CTACACTCCAGCCTGGCGACAGG + Intronic
1119606146 14:76020009-76020031 CTATACTCCAGCCTGGCAACAGG - Intronic
1119623233 14:76148931-76148953 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1119680699 14:76590434-76590456 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1120377625 14:83729847-83729869 CTGCACTCCATCCTGGTGACAGG - Intergenic
1121287052 14:92744115-92744137 CTGCACTCCAGCCTGGTGACAGG + Intronic
1121558981 14:94860465-94860487 CTATACTCCAGCCTGGTGACAGG - Intergenic
1121588814 14:95083415-95083437 CTGCACTCCAGCCTGACAACAGG + Intergenic
1121610427 14:95274941-95274963 CTGCACTCCAGCCTGACGACAGG + Intronic
1122117085 14:99533163-99533185 CTCCACTGCAGCATGGGGACAGG + Intronic
1122507310 14:102239829-102239851 CTGCACTCCAGCCTGGCGACAGG + Intronic
1122537763 14:102478081-102478103 CTGCACTCCAGCATGGGCAATGG - Intronic
1122557077 14:102586439-102586461 CTATACCCCAGCCTGGCGACAGG + Intergenic
1123826623 15:24088499-24088521 CTGCACTCCAGCCTGGCCAAAGG - Intergenic
1123909502 15:24953358-24953380 CTGCACTCCAGCCTGGTGACAGG - Intronic
1124456284 15:29845765-29845787 CTGCACTCCAGCCTGGTGACAGG + Intronic
1124932729 15:34137885-34137907 CTGCACTCCAGCCTGGTGATGGG - Intergenic
1125278717 15:38021844-38021866 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1125626384 15:41112749-41112771 CTGCATTCCAGCCTGGCGACAGG + Intronic
1125824163 15:42661479-42661501 CTGCACTCCAGCCTGGAGCCTGG - Intronic
1126011133 15:44303770-44303792 CTGCACTCCAGCCTGGTGACAGG - Intronic
1126060360 15:44775129-44775151 CTGCACTCCAGTCTGGCGACGGG - Intergenic
1126116781 15:45215308-45215330 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1126242824 15:46465363-46465385 CTGCACTCCACCTTGGCGACAGG + Intergenic
1126552432 15:49947393-49947415 CTGCACTCCAGCCTGGCGACTGG + Intronic
1126677469 15:51172912-51172934 CTGCACTCCAGCCTGGAGCCTGG + Intergenic
1126728458 15:51656621-51656643 CTGAATTCCAGCCTGGAGCCTGG + Intergenic
1126764622 15:51999973-51999995 CTGCACTCCAGCCTGGCAACAGG - Intronic
1127397942 15:58558107-58558129 CTGCACTCCAGCCTGGTGACAGG - Intronic
1127596487 15:60487664-60487686 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1127883594 15:63179457-63179479 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1127986929 15:64080349-64080371 CTGCACTCCAGCCTGGCGACAGG + Intronic
1128847208 15:70909800-70909822 CTGCACTCCAGCCTGGTGACAGG + Intronic
1129081442 15:73044731-73044753 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1129640095 15:77367095-77367117 CTGTACTCCAGCCTGGCGACCGG + Intronic
1130544712 15:84846647-84846669 CTGAACTCCAGCCTGGACAAAGG + Intronic
1130716471 15:86339927-86339949 CTGCCCTCCAGCCTGGCGACAGG + Intronic
1130789954 15:87143444-87143466 CTGCATTCCAGCCTGGCGACAGG + Intergenic
1130861687 15:87896432-87896454 CTGCACTCCAGCCTGGTGACAGG + Intronic
1130862579 15:87904185-87904207 CTGCACTCCAGCCTGGCAACAGG - Intronic
1131253804 15:90848124-90848146 CTGCACTCCAGCCTGGCGAAAGG + Intergenic
1131516314 15:93079781-93079803 CTGCACTCCAGCATGGGCAACGG + Intronic
1131601879 15:93857600-93857622 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1132048655 15:98588049-98588071 CTGCACTCCAGCATGGGCAATGG + Intergenic
1132131754 15:99288416-99288438 CTGCACTCCAGCCTGACGACAGG - Intronic
1132890408 16:2201333-2201355 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1132900252 16:2250220-2250242 CTGCACTCCAGTCTGGCGACTGG + Intronic
1132945613 16:2530125-2530147 CTGACCTCCAGGAGGGAGACTGG + Exonic
1132969842 16:2681775-2681797 CTGCACTCCAGCCTGGTGATAGG - Intergenic
1133014159 16:2931264-2931286 CTGTATTCCAGCCTGGTGACTGG + Intronic
1133218680 16:4308601-4308623 CTGAACTCCAGCCTGGGGGACGG - Intergenic
1133446936 16:5869436-5869458 CTGTACTCCAGCCTGGTGACTGG - Intergenic
1133614212 16:7461202-7461224 CTGCACTCCAGCCTGGGGACAGG - Intronic
1133710934 16:8400604-8400626 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1133936238 16:10271750-10271772 CTACACTCCAGCATGGGTACAGG - Intergenic
1133948463 16:10369542-10369564 CTGCACTCCAGCATGGGCAAAGG - Intronic
1134101785 16:11457554-11457576 CTGCACTCCAGCCTGGGCACAGG + Intronic
1134160259 16:11882210-11882232 CTGCACTCCAGCCTGGCGACAGG + Intronic
1134412522 16:14014830-14014852 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1134510241 16:14840696-14840718 CTGCACTCCAGCATGGGCAGCGG - Intronic
1134595815 16:15495246-15495268 CTGCACTCCAGCCTGGCAACAGG - Intronic
1134660990 16:15984477-15984499 CTGCACTCCAGCCTGTTGACAGG - Intronic
1134697883 16:16239185-16239207 CTGCACTCCAGCATGGGCAGCGG - Intronic
1134791937 16:16997055-16997077 CTGAAATCCAGCCTTGCGGCCGG + Intergenic
1134973951 16:18555496-18555518 CTGCACTCCAGCATGGGCAGCGG + Intronic
1135064948 16:19301598-19301620 CTGCACTCCAGCCTGGCAACAGG - Intronic
1135401818 16:22171275-22171297 CTGCACTCCAGCCTGGGGACAGG - Intronic
1135412107 16:22243024-22243046 CTGCACTCCGGCCTGGGGACAGG + Intronic
1135583540 16:23648892-23648914 CTGCACTCCAGCATGGGCAATGG - Intronic
1135594741 16:23733186-23733208 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1135699981 16:24623863-24623885 CTGCACTCCAGCATGGGTAAAGG + Intergenic
1135873134 16:26170536-26170558 TTGCACTCCAGCCTGGTGACAGG + Intergenic
1136024756 16:27462298-27462320 AGCAACTCCAGCACGGCGACGGG + Exonic
1136174513 16:28507761-28507783 CTCAACTCAAGCCTGGCCACAGG - Intronic
1136550049 16:30978235-30978257 CTGCACTCCCACCTGGCGACAGG + Intronic
1136667034 16:31820795-31820817 CTGCACTCCAGCCTGGCGAAAGG + Intergenic
1137750090 16:50854881-50854903 TTGAACTCCAGCCTGGTGACAGG - Intergenic
1137964332 16:52915832-52915854 CTGCACTCCAGCCTGGAGACAGG - Intergenic
1138030102 16:53553003-53553025 CTGACCACCAGCAAGGAGACGGG + Intergenic
1138356709 16:56387058-56387080 CCGCACTCCAGCCTGGCAACAGG + Intronic
1138754326 16:59465093-59465115 CTGCACTCCAGCCTGGCAATAGG - Intergenic
1138958885 16:62005697-62005719 CTGCATTCCAGCCTGGTGACAGG + Intronic
1138997575 16:62473806-62473828 CTGCACTCCATCATGGCAACAGG + Intergenic
1139081564 16:63528281-63528303 CTGCACTCTAGCCTGGCGATAGG + Intergenic
1139310679 16:66025477-66025499 CTGCACTCCAGTCTGCCGACAGG + Intergenic
1139427077 16:66888102-66888124 TTGCACTCCAGCCTGGCTACAGG - Exonic
1139539852 16:67606801-67606823 CTGCACTCCAGCCTGGAGCCTGG - Intronic
1139779470 16:69338955-69338977 CTGCACTCCAGCCTGGCGACAGG + Intronic
1139781779 16:69357883-69357905 CTGCACTCCAGCCTGGGGAACGG - Intronic
1139817436 16:69686484-69686506 CTGCACTCCAGCATGGGCAAAGG + Intronic
1140235334 16:73153684-73153706 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1140327853 16:74023130-74023152 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1140416770 16:74779568-74779590 CTGCACTCCAGCCTGGGGACAGG - Intergenic
1141095066 16:81157290-81157312 CTACACTCCAGCCTGGCAACAGG - Intergenic
1141587490 16:85044541-85044563 TTGCACTCCAGCCTGGCGACAGG - Intronic
1141819918 16:86438231-86438253 TTGCACTCCAGCCTGGCAACAGG + Intergenic
1142019587 16:87773043-87773065 CTGCACTCCAGCCTGGTGATAGG - Intergenic
1142317321 16:89356042-89356064 CTGCACTCCAGCCTGGGCACTGG + Intronic
1142444505 16:90127063-90127085 CTGCACTCCAGCATGGGGGACGG - Intergenic
1142459360 17:79342-79364 CTGAACTCCATCCTAGTGACAGG + Intergenic
1142463006 17:108409-108431 CTGCACTCCAGCATGGGGGACGG + Intergenic
1142630382 17:1222099-1222121 CTGCACTCCAGCTTGGTGACAGG - Intronic
1142702268 17:1670521-1670543 GTGCACTCCAGCCTGGCAACAGG - Intronic
1142855460 17:2726945-2726967 CTGCACTCCAGCCTGGCAAGAGG - Intergenic
1142866182 17:2792812-2792834 CTGAACGGCAGCCTGGAGACAGG - Intronic
1142900810 17:3010301-3010323 CTGCACTCCAGCCTGGAGACAGG + Intronic
1143118257 17:4592561-4592583 CTGAACCCCAGCAGGGAGAGAGG + Intronic
1143284556 17:5779572-5779594 CAGGCCTCCAGCATGGTGACAGG + Intronic
1143604899 17:7977421-7977443 CTGCACTCCATCCTGGCGACAGG - Intergenic
1143799057 17:9362783-9362805 CTGCACTCCAGCCTGGAGCCTGG + Intronic
1143814293 17:9499433-9499455 CTACACTCCAGCCTGGCGACAGG - Intronic
1143892270 17:10111645-10111667 CTGCACTCCAGCCTGGAGACAGG + Intronic
1143895723 17:10134867-10134889 CTGCACTCCAGCCTGGCGATAGG - Intronic
1143956344 17:10673038-10673060 CTGCACTCCAGCCTGGCAACAGG - Exonic
1144246576 17:13371984-13372006 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1144493646 17:15734165-15734187 CTCAAGTCCAGCATGGCAAAGGG - Intronic
1144608468 17:16688523-16688545 CTGTACTCCAGCCTGGCGACAGG - Intergenic
1144831518 17:18134024-18134046 CTGCACTCCAGCCTGGCGACAGG - Intronic
1144876939 17:18402738-18402760 CTGCACTCCAGTCTGGCAACAGG - Intergenic
1144906619 17:18642487-18642509 CTCAAGTCCAGCATGGCAAAGGG + Intronic
1145128233 17:20319445-20319467 CTGTACTCCAGCCTGGCGACAGG - Intergenic
1145155291 17:20541670-20541692 CTGCACTCCAGTCTGGCAACAGG + Intergenic
1145196374 17:20897764-20897786 CTGTACTCCAGCCTGGCGACAGG + Intergenic
1145215858 17:21051867-21051889 TTGCACTCCAGCCTGGCGACAGG + Intergenic
1145745634 17:27317717-27317739 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1145758037 17:27407196-27407218 CTGACCTCCAGCTTGGCTTCCGG + Intergenic
1145848807 17:28070389-28070411 CTGCACTCCAGCCTGGCAACAGG - Intronic
1145942730 17:28751494-28751516 TTGCACTCCGGCCTGGCGACAGG + Intergenic
1146189120 17:30749438-30749460 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1146235327 17:31154774-31154796 CTGCACTCCAGCCTGGCGATCGG - Intronic
1146330513 17:31923181-31923203 CTGCACTCCAGCCTGGCCACTGG - Intergenic
1146334008 17:31953748-31953770 CTGCACTCCAGCCTGGCAACAGG - Intronic
1146979950 17:37151013-37151035 CTGCACTCCAGCCTGGTGACAGG + Intronic
1147331944 17:39704534-39704556 CTGCACTCCAGCCTGGCGACAGG + Intronic
1147396068 17:40143791-40143813 CTGCACTCCAGCCTGGTGACAGG + Intronic
1148089960 17:45017585-45017607 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1148273579 17:46283080-46283102 CTGCACTCCAGCCTGGCAACAGG + Intronic
1148629884 17:49099267-49099289 CTGAACTCCAGCCTGGGCAATGG - Intergenic
1148937639 17:51176360-51176382 CTGCTCTCCAGCCTGGTGACAGG + Intergenic
1148998275 17:51731338-51731360 CTGCACTCCAGCCTGGCGACAGG + Intronic
1149864690 17:60144765-60144787 CTGCACTCCAGCCTGGGGCCTGG - Intergenic
1150049688 17:61949260-61949282 CTGCACTCCAGCTAGGTGACAGG - Intronic
1150066044 17:62110265-62110287 CTGCACTCCAGCCTGGCGACTGG - Intergenic
1150129313 17:62658474-62658496 CTGAAGTCCAGAAAGGGGACGGG - Intronic
1150234864 17:63584723-63584745 CTGCACTCCAGCCTGGTGACAGG + Intronic
1150240617 17:63629157-63629179 CTGAACTCCAGCATGGCGACAGG - Intronic
1150409483 17:64931497-64931519 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1150411346 17:64944254-64944276 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1150473027 17:65453247-65453269 TTGCACTCCAGCCTGGTGACAGG + Intergenic
1150673790 17:67226220-67226242 CTGCACTCCAGCCTAGCAACAGG + Intronic
1150720586 17:67610882-67610904 CTGCACTCCAGCCTGGCGACAGG + Intronic
1151357092 17:73565858-73565880 TTGCACTACAGCCTGGCGACAGG - Intronic
1151485468 17:74396491-74396513 CCGCACTCCAGCCTGGCAACAGG + Intergenic
1151637250 17:75358845-75358867 CTGCACTCCAGCATGGCGACAGG + Intronic
1151644425 17:75420379-75420401 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1151841610 17:76622399-76622421 CTGCACTCCAGCCTGGTAACAGG - Intergenic
1151864034 17:76788075-76788097 CTGCATTCCAGCCTGGTGACAGG - Intergenic
1152034396 17:77863333-77863355 CTGAACTGCAGCCTAGTGACTGG - Intergenic
1152041318 17:77905736-77905758 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1152201552 17:78949893-78949915 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1152410739 17:80121417-80121439 CTGCACTCCAGCCTGATGACAGG + Intergenic
1152867300 17:82732003-82732025 CTGCACTCCAACTTGGAGACAGG + Intergenic
1153044476 18:843151-843173 CTGCACTCCAGCGTGGCGACAGG + Intergenic
1153139647 18:1955968-1955990 CTGCTCTCCAGCCTGGCGACAGG - Intergenic
1153361021 18:4197134-4197156 TTGCACTCCAGCCTGGGGACAGG + Intronic
1153589626 18:6659595-6659617 CTGCACTCCAGCCTGGGGAATGG - Intergenic
1153595940 18:6725405-6725427 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1154043544 18:10882873-10882895 CTGCACTCCAGCCTGGTGACAGG - Intronic
1154950226 18:21202716-21202738 CTGCACTCCAGCCTGGCCAATGG - Intergenic
1154961384 18:21312588-21312610 CTGCACTCCAGCCTGGCGACAGG - Intronic
1155295814 18:24383715-24383737 CTGCACTCCAGCCTGGTGACAGG + Intronic
1155774702 18:29745838-29745860 CTGCACTCCTGCCTGGTGACAGG + Intergenic
1156132825 18:33999174-33999196 CTGCACTCCAGCATGGGCAATGG - Intronic
1156184522 18:34646742-34646764 CTGCACTCCAGTCTGGTGACAGG - Intronic
1156500687 18:37555418-37555440 TTGAACTCCTGCAAGGAGACCGG - Intronic
1156939991 18:42755668-42755690 CTGATCTCCAGCAAAGTGACTGG + Intronic
1157076467 18:44472733-44472755 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1158256675 18:55558173-55558195 CTGTACTCCAGTCTGGCAACAGG + Intronic
1158700821 18:59744565-59744587 CTACACTCCAGCCTGGCGACAGG - Intergenic
1159041511 18:63327110-63327132 CTACGCTCCAGCCTGGCGACAGG + Intergenic
1159267218 18:66097904-66097926 CTGTACTCCAGCATGGGTGCTGG + Intergenic
1159332867 18:67023697-67023719 CTGCACTCCAGCGTGGGCACCGG - Intergenic
1159675330 18:71277599-71277621 TTGTACTCCAGCCTGGCGACAGG - Intergenic
1159702320 18:71644062-71644084 CTGCACTCCAGCCTGGCGATAGG - Intergenic
1159927900 18:74284967-74284989 CTGAGTTCCAACATGGGGACCGG - Intronic
1160205734 18:76829905-76829927 CTGAACTCCAGCCTGGCAACAGG - Intronic
1160652721 19:240842-240864 CTGCACTCCAGCATGGGGGACGG + Intergenic
1160658982 19:289664-289686 CTGCACACCAGCCTGGCGACAGG + Intronic
1160881020 19:1320333-1320355 CTGAACTCCAGCTTGGGCAATGG - Intergenic
1161084290 19:2327294-2327316 CCGCACTCCAGCCTGGCGATAGG - Intronic
1161515967 19:4696710-4696732 CTGCACTCCAGCCTGGTGACAGG + Intronic
1161904249 19:7143363-7143385 CTGAAATCGAGCATGTCGAGGGG - Intronic
1162175439 19:8826746-8826768 CTGACCTCCAGCAAGGCAAGAGG + Intronic
1162229036 19:9249916-9249938 CTGCATTCCAGCCTGGTGACAGG + Intergenic
1162637117 19:11977819-11977841 CTGTACTCCAGGATGGTCACAGG + Intronic
1162714021 19:12617801-12617823 CTGCATTCCAGCCTGGTGACAGG - Intronic
1162763508 19:12903424-12903446 CTGCACTCCAGCCTGGTGACAGG - Intronic
1163140926 19:15348010-15348032 TTGCACTCCAGCCTGGCGACAGG + Intergenic
1163261829 19:16195580-16195602 GTGCACTCCAGCCTGGTGACAGG + Intergenic
1163590330 19:18190059-18190081 CTGCACTCCGGCCTGGCAACAGG - Intergenic
1163616889 19:18334588-18334610 CTGAACTCCAGCGTGGGCAACGG - Intergenic
1163686045 19:18712293-18712315 CTGAACTCCAGCCTGGGCAACGG - Intronic
1163892325 19:20027875-20027897 CTGCACTCCAGCCTGGGGCCTGG + Intronic
1163951312 19:20589822-20589844 CTGAACTCCAGCCTGGGGGATGG + Intronic
1163952600 19:20603804-20603826 CTGCACTCCAGCCTGGCGACAGG + Intronic
1163965308 19:20741270-20741292 CTGAACTCCAGCCTGGGGGATGG - Intronic
1165021152 19:32925523-32925545 CTGCACTCCAGCCTGGCGATGGG - Intronic
1165585879 19:36915632-36915654 CTGCACTCCAGCCTGGCGACAGG - Intronic
1165775985 19:38404565-38404587 CTGTACTCCAGCCTGGCAACAGG - Intronic
1165947251 19:39451566-39451588 CTGCACTCCAGCCTGGCCAATGG - Intronic
1166062372 19:40334709-40334731 CTACACTCCAGCCTGGCAACAGG + Intronic
1166892483 19:46001978-46002000 CTGCACTCCAGCCTGGCGACAGG - Intronic
1166922698 19:46241230-46241252 CTGAACTCCAGCCTGGGCAAGGG + Intergenic
1167058114 19:47125950-47125972 CTGCACTCCAGCCTGGCAACAGG - Intronic
1167064955 19:47178204-47178226 CTGCACTCCAGCCTGACGACAGG + Intronic
1167068095 19:47202322-47202344 CTACACTCCAGCCTGGTGACAGG - Intronic
1167086220 19:47311470-47311492 CTGCACTCCAGCCTGGCAACAGG + Intronic
1167141363 19:47653057-47653079 CTGCACTCCAGCCTGGCGGACGG - Intronic
1167866653 19:52334474-52334496 CTGCACTCCAGCATGGGTATTGG + Intergenic
1167910162 19:52695283-52695305 CAGCACTCCAGCCTGGCTACCGG + Intergenic
1168010412 19:53526587-53526609 CTGCACTCCAGCCTGGTGACAGG - Intronic
1168054665 19:53855887-53855909 CTGCACTCTAGCCTGGCAACAGG + Intergenic
1168502974 19:56909138-56909160 CTGCACTCCAGCATGGTCAACGG - Intergenic
1168555493 19:57335606-57335628 CTGCACTCCAGCCTGGCGGCAGG + Intergenic
925171590 2:1753454-1753476 CTGCACTCCAGCCTGGTGACAGG - Intergenic
925254865 2:2474847-2474869 CTGAACCTGAGCATGGGGACAGG - Intergenic
925341057 2:3136631-3136653 CTGCACTCCAGTCTGGCAACAGG - Intergenic
925673914 2:6340031-6340053 CTGCACTCCAGCCTGGCAACAGG - Intergenic
925709318 2:6722969-6722991 CTGCACTCCAGCATGGGCAATGG - Intergenic
926750898 2:16197693-16197715 CTCATCTCCAGCAGGGTGACTGG - Intergenic
926790594 2:16567365-16567387 CTGCACTCCAGCCTGGCAACAGG + Intronic
927410937 2:22825579-22825601 CTGCACTCCAGCCTGGCGACAGG - Intergenic
927753763 2:25692483-25692505 CTGCACTCCAGCCTGGTGACAGG - Intergenic
927816873 2:26225360-26225382 CACCACTCCAGCCTGGCGACAGG + Intronic
927824312 2:26297487-26297509 CTGCACTCCAGCCTGGTGACAGG - Intergenic
928116589 2:28549450-28549472 CTGCACTCCAGCCTGGCAACAGG - Intronic
928156116 2:28878489-28878511 CTGCACTCCAGCCCGGTGACAGG + Intergenic
928375879 2:30772853-30772875 CTGCACTCCAGCCTGGCAACAGG - Intronic
928738414 2:34320601-34320623 CTGCACTCCAGCCTGGCGACAGG - Intergenic
928965558 2:36971506-36971528 CTGCACTCCAGCCTGGTGACAGG + Intronic
928972983 2:37051317-37051339 CTGCACTCCAGCCTGGCAACAGG + Intronic
928994938 2:37278897-37278919 CTGCACTACAGCCTGGCGACAGG + Intronic
929042706 2:37761025-37761047 CTGCACTCTAGCCTGGTGACAGG + Intergenic
929167060 2:38893197-38893219 CTGCACTCCACCCTGGCAACAGG - Intronic
929519686 2:42636661-42636683 CTGCACTCCAGCCTGGTGACAGG - Intronic
929863073 2:45695732-45695754 CTGAACTCCAGCCTGGGCAATGG + Intronic
930077307 2:47417348-47417370 CTGAACTCCAGCCTGGGCAATGG + Intronic
930125575 2:47793568-47793590 CTGCACTCCAGCCTGGGGAACGG + Intronic
930720360 2:54632038-54632060 CTGCACTCCAGCCTGGTGGCAGG + Intronic
931347609 2:61460943-61460965 CTGCACTCCACCCTGGCAACAGG + Intronic
931706308 2:64949103-64949125 CTGCACTCCAGCATGGGCAATGG + Intergenic
931730090 2:65145544-65145566 CTGCACTCCAGCCTGGCGACAGG + Intergenic
932151997 2:69381592-69381614 CTGCACTCCAGCCTGGGTACTGG - Intronic
932258924 2:70310697-70310719 CTGCACTCCAGCCTGGTGACAGG + Intergenic
932519706 2:72397581-72397603 CTGCACTCCAGCCTGGTGACAGG + Intronic
932768128 2:74483905-74483927 CTGCACTCCAGCCTGGGGAACGG + Intronic
933153416 2:78943130-78943152 CTGAACTCCAGCTTGGGCAATGG - Intergenic
933493000 2:83012197-83012219 CTGGACTCCAGCCTGGCAACAGG + Intergenic
933516575 2:83311405-83311427 CTGCACTCCAGCCTGGTGACAGG - Intergenic
933780051 2:85795081-85795103 CTGAACCCCAGCATCGGGGCGGG - Intergenic
934082400 2:88480500-88480522 CTGAACTCCAGCCTGGGCATTGG - Intergenic
934868689 2:97839288-97839310 CTGCACTCCAGCCTGGTGTCTGG + Intronic
935274652 2:101465471-101465493 CTGCACTTCAGCCTGGCGACAGG + Intronic
936600890 2:113893328-113893350 CTGCACTCCAGCCCAGCGACAGG - Intronic
936833296 2:116676241-116676263 CTGCACTCCATCCTGGCGACAGG - Intergenic
937187098 2:120054538-120054560 CTGCACTCCAGCCTGGTGACTGG - Intronic
937351818 2:121170376-121170398 CTGCACTCCAGCCTGGCCAACGG - Intergenic
937466045 2:122133988-122134010 TTGTACTCCAGCCTGGCAACAGG - Intergenic
937706492 2:124926918-124926940 CTGCACTCCAGCCTGGGGAACGG - Intergenic
937732816 2:125255410-125255432 CTGCACTCCAGCCTGGTGACAGG - Intergenic
938107031 2:128539139-128539161 CTGCACTCCAGCCTGGCGACAGG + Intergenic
938606234 2:132895292-132895314 CTGCACTCCAGCCTGGAGACTGG + Intronic
938815895 2:134903924-134903946 CTGCATTCCAGCCTGGCGACAGG - Intergenic
939015477 2:136898677-136898699 CTGCACTCCAGCCTGGTGATGGG - Intronic
939394933 2:141616243-141616265 CTGCACTCCAGCCTGACCACAGG + Intronic
939607023 2:144265657-144265679 TTGCACTCCAGCCTGGCAACAGG + Intronic
940362226 2:152808431-152808453 CTGCACTCCAGCCTGGCAACTGG - Intergenic
940677542 2:156743268-156743290 CTGCACTCCAGCCTGGTGACAGG + Intergenic
940816468 2:158302745-158302767 CTGCACTCCAGCCTGGTGACAGG + Intronic
941259432 2:163278108-163278130 CTGAACACAAGCATGGCCCCTGG - Intergenic
941489022 2:166120648-166120670 CTGCACTCCGGCCTGGCGTCTGG - Intronic
941727780 2:168882563-168882585 CTGCACTCCAGCCTGGTGACAGG + Intronic
941966422 2:171305093-171305115 CTGCACTCCAGCCTGGCAACAGG + Intergenic
942050656 2:172137537-172137559 CTGCACTCCAGCCTGGCCAACGG - Intergenic
942076465 2:172360798-172360820 TTGCACTCCAGCCTGGCAACAGG - Intergenic
942290250 2:174462345-174462367 CTGAACTCCAGCCTGGGCAACGG - Intronic
942593062 2:177566829-177566851 CTGCACTCCAGCCTGGCAACAGG - Intergenic
943335896 2:186613296-186613318 CTGCACTCCAGCAGGACCACTGG + Intronic
943431596 2:187809504-187809526 ATGCACTCCAGCCTGGCAACAGG + Intergenic
943754097 2:191540409-191540431 CTGAACTCCAGCCTGGGCAATGG - Intergenic
943804244 2:192102704-192102726 CCTCACTCCAGCCTGGCGACAGG - Intronic
943843937 2:192616598-192616620 CTGTACTCCAGCCTGGCGACAGG + Intergenic
943860609 2:192857684-192857706 CTGCAGTCCAGCCTGGCGACAGG + Intergenic
944045921 2:195411747-195411769 CTGCACTCCAGCCTAGCAACAGG + Intergenic
944240975 2:197484647-197484669 CTGCACTCCAGCCTGGCAATAGG + Intergenic
944252763 2:197594050-197594072 CTGCACTGCAGCCTGGCAACAGG - Intronic
944481880 2:200165538-200165560 CTGCACTCCAACCTGGCAACAGG + Intergenic
944781811 2:203026549-203026571 CTGTACTCCAGCCTGGAGCCTGG - Intronic
944787203 2:203085132-203085154 CTGCACTCCAGCCTGGCAACAGG - Intronic
945593292 2:211761156-211761178 CTGTACTCCAGCCTGGCGACAGG + Intronic
946082170 2:217130462-217130484 CTGAACTCCTGGATGGCTCCAGG - Intergenic
946239400 2:218344711-218344733 CTGAACTCCAGGATGGGGCAGGG + Intronic
946424859 2:219588856-219588878 CTGCACTCCAGCCTGGTGACAGG - Intergenic
946627392 2:221628384-221628406 CTGCACTCCAGCCTGGTGACTGG + Intergenic
947675890 2:231979612-231979634 CTGCACTCCAGCCTGGCAATAGG - Intronic
1169063022 20:2675241-2675263 CTGCACTCCAGCCTGGCAGCCGG - Intergenic
1169253656 20:4080908-4080930 TTGCACTTCAGCCTGGCGACAGG + Intergenic
1169684296 20:8253165-8253187 CTGAATTCCAGCTTGGTGAGTGG - Intronic
1169723472 20:8703716-8703738 CTGAACTACAGCTGGGCCACTGG - Intronic
1169897508 20:10520086-10520108 CTGCACTCCAGCCTGGCCAACGG - Intronic
1170322705 20:15118227-15118249 CTGCACTCCAGCCTGGTAACAGG - Intronic
1170340374 20:15320165-15320187 CTGCACTCCAGCCTGGCAACAGG + Intronic
1170922170 20:20689603-20689625 CTGCACACCAGCCTGGTGACAGG + Intronic
1171476586 20:25414151-25414173 CTTCACTCCAGCCTGGCGATAGG + Intronic
1172480095 20:35266313-35266335 CTGCACTCCAGCATGGGGGACGG + Intronic
1172629683 20:36369542-36369564 CTGCACTCCAGCCTGGCCAATGG + Intronic
1172826197 20:37788617-37788639 CTGAAGCCCAGCATGGGCACAGG - Intronic
1172955437 20:38754680-38754702 CTGCACTCCAGCTAGGTGACAGG + Intronic
1172959323 20:38787416-38787438 CTGACCTCCAGCCTGGGGACAGG - Intergenic
1172969790 20:38865044-38865066 CTGAATTCCAGCCTGGCTAAGGG - Intronic
1172992252 20:39045195-39045217 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1173075999 20:39820109-39820131 TTGCACTCCAGCCTGGAGACAGG + Intergenic
1173084253 20:39900318-39900340 CTGAACTCCAGCCTGGGCAAAGG - Intergenic
1173442892 20:43094122-43094144 CTGCACTCCTGCTTAGCGACAGG - Intronic
1173610212 20:44361639-44361661 CTGCACTCTAGCCTGGCGACAGG + Intronic
1173635920 20:44557487-44557509 CTGCACTCCAGCTGGGTGACAGG + Intronic
1174222796 20:48970695-48970717 CTGAACTCCGGCATGGGCAGTGG + Intronic
1174373415 20:50109710-50109732 CTGCACTCCAGCCAGGTGACAGG + Intronic
1174451189 20:50621549-50621571 CTGAACTCCTGGCTGGCTACTGG - Intronic
1174455274 20:50644518-50644540 CTGCACTCCAGCCTGGTGATAGG - Intronic
1174473367 20:50777970-50777992 TTGCACTCCAGCCTGGTGACAGG - Intergenic
1174638239 20:52020320-52020342 CTGAACTCCAGCCTGGCTGATGG + Intergenic
1174780555 20:53385082-53385104 CTGCATTCCAGCCTGGGGACAGG + Intronic
1174811799 20:53651735-53651757 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1175152462 20:56945968-56945990 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1176015758 20:62930975-62930997 CTGCACTCCAGCCTGGCAACAGG - Intronic
1176187081 20:63786546-63786568 CTGCACTCCAGCCTGGAGACAGG - Intronic
1176741215 21:10604496-10604518 CTTAAGTCCAGCAAGGCAACAGG + Intronic
1177171100 21:17657071-17657093 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1177288911 21:19085066-19085088 CTGAACTCCAGCCTGGGCAATGG - Intergenic
1177584214 21:23069077-23069099 TTGGACTCCAGCCTGGTGACAGG + Intergenic
1177653355 21:23985645-23985667 CTGAACTCCAGCCTGGGCAAGGG + Intergenic
1177811962 21:25934470-25934492 CTGCATTCCAGCCTGGTGACTGG - Intronic
1178177408 21:30118938-30118960 CTGCACTCCAGCCTATCGACAGG - Intergenic
1178349488 21:31862385-31862407 CTGCACTGCAGTCTGGCGACAGG - Intergenic
1178607583 21:34053320-34053342 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1178705685 21:34870919-34870941 CTGCATTCCAGCCTGGTGACAGG + Intronic
1178804441 21:35826677-35826699 CTGCACTCCAGCCTGGGAACAGG + Intronic
1178829980 21:36047967-36047989 TTGCACTCCAGCCTGGCAACAGG + Intronic
1178861910 21:36296790-36296812 CTGCACTCCTGCCTGGCAACAGG + Intergenic
1178874612 21:36404132-36404154 CTGCACTCCAGCTGGGCAACAGG - Intronic
1179398536 21:41062867-41062889 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1179661066 21:42875516-42875538 CTGCACTCCAGCCTGGCAACAGG + Intronic
1179843272 21:44091474-44091496 CTGCACTCCAGCCTGGTGACAGG - Intronic
1180607945 22:17075402-17075424 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1180673141 22:17569043-17569065 CTGCCCTCCAGCCTGGCTACAGG - Intronic
1180837409 22:18936991-18937013 CTGAACTCCAGCCTGGGCAATGG + Intergenic
1181004595 22:20006666-20006688 CTGCACTCTAGCCTGGCGACAGG - Intronic
1181278215 22:21700346-21700368 CTGCACTCCAGCCTGGCAATAGG - Exonic
1181566536 22:23742209-23742231 CTGCATTCCAGCCTGGCAACAGG + Exonic
1182233199 22:28854754-28854776 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1182305282 22:29363609-29363631 CTGCACTCCAGCCTGGCGACAGG + Intronic
1182668518 22:31976252-31976274 CTGCACTCCAGCATGGCGACAGG + Intergenic
1182685386 22:32119119-32119141 CTGCACTCCAGCCTGGGCACAGG + Intergenic
1182740733 22:32565551-32565573 CTGAATTCCAGCCTGGGCACAGG - Intronic
1182768761 22:32778323-32778345 CTGCACTCCAGCCTGGTGACAGG - Intronic
1182794094 22:32977705-32977727 CTGCACTCCAGCCTGGCGACAGG + Intronic
1182946139 22:34324264-34324286 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1183515044 22:38260538-38260560 CTGACCTCCAGCTTTGCCACTGG + Intronic
1183930683 22:41234416-41234438 CTGCACCCCAGCCTGGCGACAGG - Intronic
1184055100 22:42041443-42041465 CTGCACTCTAGCCTGGCAACAGG + Intronic
1184704998 22:46205251-46205273 CTGAACTCCAGCCTGGGCTCAGG - Intronic
1185001502 22:48249204-48249226 CTGAGCCCTAGCCTGGCGACCGG + Intergenic
1185354466 22:50359034-50359056 CTGAACTCCAGCCTGGCAATAGG - Intronic
1203287502 22_KI270734v1_random:162290-162312 CTGAACTCCAGCCTGGGCAATGG + Intergenic
1203294891 22_KI270736v1_random:32521-32543 CTGCACTCTAGCCTGGTGACAGG + Intergenic
949479427 3:4479343-4479365 CTGAACTCAAGCCTGGGGTCAGG + Intergenic
949577296 3:5351223-5351245 CTGCACTCCAGCCGGGTGACAGG - Intergenic
950001001 3:9656156-9656178 CTGCATTCCAGCCTGGCGACAGG + Intronic
950734485 3:14994477-14994499 CTGCACTCCAGCCTGGCGACAGG - Intronic
951170980 3:19541264-19541286 CTGCACTCCAGCCTGGAGACAGG + Intergenic
952224955 3:31365959-31365981 CTGCACTCCAGACTGGGGACAGG - Intergenic
952305456 3:32142153-32142175 CTGCGCTCAAGCCTGGCGACAGG - Intronic
953032250 3:39186498-39186520 CTGGACCCCAGCATGGGGATGGG - Exonic
954009357 3:47621261-47621283 CTGCACTCCAGCCTGGCAACAGG + Intronic
954042370 3:47898463-47898485 CTGCACTCCAGCCTGCCAACAGG + Intronic
954116771 3:48470888-48470910 TTGCACTCCAGCCTGGGGACAGG + Intronic
954348965 3:50026414-50026436 CTGCACTCCAGTCTGGCAACTGG - Intronic
954566168 3:51601891-51601913 CTGCACTCCAGCCTGGCGACAGG - Intronic
954988796 3:54819806-54819828 CTGCACTCCAGCCTGGTGACAGG + Intronic
955250746 3:57279659-57279681 CTGCACTCCAGCCTGGCTGCAGG + Intronic
955271167 3:57500790-57500812 CTGTACTCCAGCTGGGCAACAGG - Intronic
955285641 3:57638619-57638641 CTGCACTCCAGCCAGGCAACAGG + Intronic
955365192 3:58304748-58304770 CTGCACTCTAGCCTGGCAACAGG - Intergenic
955385989 3:58480602-58480624 CTGCACTCCAGCCTGGGCACTGG - Intergenic
955432324 3:58860138-58860160 CTGCACTCCAGCCTGGCTACAGG + Intronic
955568108 3:60271364-60271386 CTGCACTCCAGCCTGGGGAAAGG + Intronic
955716460 3:61835368-61835390 CTGCACTCCAGCCTGGGGAAGGG - Intronic
956625456 3:71262227-71262249 CTGCACTCCAGCCTGGCAACAGG + Intronic
956636032 3:71365934-71365956 CTGCACTCCAGCCTGGCGACAGG + Intronic
957186501 3:76948740-76948762 CTGCACTCCAGCCTGGCAACAGG - Intronic
957566857 3:81895140-81895162 CTGTACACCAGCAGGGCTACTGG + Intergenic
957570566 3:81942971-81942993 TTGCACTCCAGCCTGGCAACAGG - Intergenic
957595428 3:82259297-82259319 CTGCACTCCAGCCTGGTTACAGG - Intergenic
958911409 3:99998597-99998619 CTGCACTCCAGCATGGGTGCTGG - Intronic
959098296 3:101981314-101981336 CTGCACTCCAGCCTGGCAACAGG + Intergenic
959255829 3:104012036-104012058 CTGCACTCCAGCCTGGTGACAGG + Intergenic
959442682 3:106397536-106397558 CTGAACTCCAAAATGGGGAGAGG + Intergenic
959669608 3:108961283-108961305 CTGAGTTCCAGCTTGGTGACTGG + Intronic
959965308 3:112347361-112347383 CTGATCTGCAGGATGGAGACTGG - Intronic
960346257 3:116536700-116536722 TTGCACTCCAGCCTGGCAACAGG + Intronic
961225597 3:125242592-125242614 CTGCACTCCAGCCTGGCAAAGGG + Intronic
961262164 3:125610907-125610929 CTGCACTCCAGCCTGGCAACAGG - Intergenic
961575335 3:127831430-127831452 CTGAACATCAGCATGGTGCCTGG + Intergenic
961777866 3:129302678-129302700 CTGCACTCCAGCTTGGTGACAGG + Intronic
961921195 3:130428217-130428239 CGGAACTCCAGGATGCAGACTGG + Intronic
962244714 3:133782983-133783005 CTGCACTCCAGCCTGGGGACAGG + Intergenic
962506762 3:136054293-136054315 CTGCACTCCAGCCTGGCGACAGG - Intronic
962516277 3:136155171-136155193 CTGCACTCCAGCCTGGCGACAGG + Intronic
962595985 3:136944153-136944175 CTATACTCCAGCCTGGCGACAGG - Intronic
962774239 3:138643752-138643774 CTGTACTCCAGCCTGGTGACAGG + Intergenic
963670250 3:148242262-148242284 CTGTGCTCCAGCTTGGCAACAGG + Intergenic
963899135 3:150717245-150717267 CTGCACTCCAGCATGGGCAACGG - Intergenic
964346777 3:155761711-155761733 CTGTACTCCAGCCTGGCAACAGG + Intergenic
964972700 3:162580783-162580805 CTGTACTCCAGCCTGGTGACAGG + Intergenic
965222492 3:165944546-165944568 ATGCACTTCAGCCTGGCGACAGG + Intergenic
965339101 3:167464047-167464069 CTGCACTCCAGCCTGGCAACAGG - Intronic
965367252 3:167816077-167816099 CTGCACTCCAGCCTGGACACAGG - Intronic
966453667 3:180091393-180091415 TTGCACTCCAGCCTGGTGACAGG - Intergenic
966569372 3:181423936-181423958 CTGAACTCCAGCATGGGTGATGG + Intergenic
966690894 3:182740350-182740372 CTGCACTCCAGCCTGGCAACAGG + Intergenic
966874290 3:184313526-184313548 CTGCACTCTAGCCTGGCGACAGG - Intronic
966993443 3:185256518-185256540 CTGCACTCCAGCCTGGCAACAGG + Intronic
967019872 3:185513301-185513323 CTATACTCCAGCCTGGTGACAGG + Intronic
967108609 3:186273409-186273431 CTGCACTCCAGCCTGGTGAAAGG - Intronic
967365394 3:188681031-188681053 CTGCACTCCAGCCTGGTGACAGG - Intronic
967990975 3:195130576-195130598 CTGAGCTCTAGCATAGCTACTGG - Intronic
968365124 3:198179185-198179207 CTGCACTCCAGCATGGGGGACGG - Intergenic
968692842 4:2004120-2004142 CTGCACTCCAGCCTGGCGACAGG + Intronic
969166133 4:5315739-5315761 CTGCACTCCAGCCTGGGCACTGG - Intronic
969360596 4:6660876-6660898 CTGCACTCCAGCCTAGCAACAGG - Intergenic
969547399 4:7840348-7840370 CTGAACTTCAGCCTGGGCACCGG - Intronic
970202704 4:13626282-13626304 TTGCATTCCAGCCTGGCGACAGG + Intronic
970340990 4:15106634-15106656 CTGACCTCCAGAAAGGTGACAGG - Intergenic
970394231 4:15649541-15649563 CTGCACTCCAGCCTGGAGACAGG + Intronic
970531099 4:16985295-16985317 CTGAACTCCAGCCTGGGTGCTGG - Intergenic
970589992 4:17551366-17551388 CTGCACTCCACCATGGTGACAGG + Intergenic
970618892 4:17796668-17796690 CTGCGTTCCAGCCTGGCGACAGG + Intergenic
970849961 4:20589940-20589962 CTGCACTCCAGCTGGGCAACAGG - Intronic
970921886 4:21404038-21404060 AAGAAATCCAGCATGGCTACCGG - Intronic
972098387 4:35379178-35379200 CTGCACTCCAGCCTGGCAACAGG + Intergenic
972792158 4:42383545-42383567 TTGCACTCCAGCCTGGCAACAGG - Intergenic
972890906 4:43554773-43554795 CTGCACTCCAGCCTGGCAACAGG - Intergenic
972922918 4:43966381-43966403 GTGCACTCCAGCCTGGTGACAGG - Intergenic
973099119 4:46240307-46240329 CTGCACTCCAGCCTGGAGACAGG + Intergenic
974057204 4:56996315-56996337 CTGCACTGCAGCCTGGTGACAGG - Intronic
974060800 4:57033258-57033280 CAGAACTCCTGCCTGGTGACCGG - Exonic
974297747 4:60024719-60024741 CTCCACTCCAGCCTGGCCACAGG - Intergenic
975161038 4:71124207-71124229 CTGCACTCTAGCCTGGCGACAGG - Intergenic
975572940 4:75836472-75836494 CTGCACTCCAGCCTGGTGACAGG + Intergenic
976292489 4:83434332-83434354 CTGCACTCCAGCCTGGCCACTGG + Intronic
976653128 4:87457270-87457292 CTGCACTCCAGCCTGGCAACAGG - Intronic
976907537 4:90258473-90258495 CTGCATTCCAGCCTGGCGAAAGG + Intronic
976923276 4:90464998-90465020 CTGCACTCTAGCCTGGCCACAGG - Intronic
977975966 4:103267379-103267401 CTGCACTCCAGCCTGGCCGCAGG + Intergenic
978519446 4:109600829-109600851 CTGTACTCCTGCCTGGTGACAGG - Intronic
978521441 4:109619668-109619690 CTGCACTCCAGCCTGGTGACTGG + Intronic
979252116 4:118576480-118576502 CTGCACTCCAGCCTGGCAACAGG - Intergenic
979254171 4:118594576-118594598 CTGCACTCCAGCATGGGGGACGG - Intergenic
979675997 4:123410907-123410929 CTGCACTCCAGCATGGGCAACGG - Intergenic
979733002 4:124047515-124047537 CTGCACTCCAGCCTGATGACAGG - Intergenic
980059978 4:128118266-128118288 CTGCACTCCAGCCTAGTGACAGG - Intronic
980093497 4:128466188-128466210 CTGCACTCTAGCCTGGCGACAGG + Intergenic
980830905 4:138128478-138128500 CTGCACTCCAGCCTGGCGACAGG - Intergenic
981705229 4:147652413-147652435 CTGCACTCCAGCCTGGCGACAGG + Intronic
981744357 4:148037796-148037818 CTGCTCTCCAGCCTGGTGACAGG + Intronic
982036372 4:151350035-151350057 CTGCACTCCAACCTGGCGACAGG - Intergenic
982493177 4:156055598-156055620 CTGCACTCCAGCCTGCCGAGAGG - Intergenic
982717961 4:158828577-158828599 CTGCACTACAGCCTGGCAACAGG + Intronic
983189196 4:164736816-164736838 CTGCACTCCAGCCTGGTGACAGG - Intergenic
983671346 4:170241327-170241349 CTGCACTCCAGCCTGGCGACAGG - Intergenic
983808712 4:172029792-172029814 ATGAACTCTAGCATGGTGGCTGG + Intronic
984178359 4:176448984-176449006 CTGCATTCCAGCCTGGTGACAGG + Intergenic
985256265 4:188072833-188072855 CTGCACTCCAGCCTTGTGACAGG + Intergenic
985272863 4:188210692-188210714 CTGCACTCCAGCCTGGAGATAGG - Intergenic
985304792 4:188527428-188527450 CTGCACTTCAGCCTGGCTACAGG + Intergenic
985497096 5:214989-215011 CTGCACTCCAGCCTGGCGACAGG + Intronic
985738473 5:1599969-1599991 CTGCACTCCAGCCTGGCAACAGG - Intergenic
986554317 5:8996056-8996078 CTGCACTCCAGCCGGGTGACAGG - Intergenic
986956582 5:13158184-13158206 CTGCACTCCAGCCTGGCGACAGG - Intergenic
987368684 5:17173337-17173359 CTGCACTCCAGCCTGGCGACAGG - Intronic
987686718 5:21213987-21214009 CTGCACTCCAGCCTGGTGACAGG + Intergenic
987757496 5:22115726-22115748 CTGCATTCCAGCCTGGTGACAGG - Intronic
987938113 5:24495817-24495839 CTGCACTCCAGCCTGGCAACAGG + Intronic
988695923 5:33622614-33622636 CTGCACTCCACCCTGGCGACAGG + Intronic
988788438 5:34585290-34585312 CTGCACTCCAGCCTGGGCACTGG + Intergenic
988814113 5:34815342-34815364 CTGCACTCTAGCTTGGCAACAGG + Intronic
989775265 5:45198950-45198972 CTGCTCTCCAGCTTGGCGACGGG + Intergenic
990384240 5:55243778-55243800 CTGCACTCCAGCCTGGCAACAGG + Intergenic
991389789 5:66130099-66130121 CTGCACTCCAGCCTGGTGACAGG + Intergenic
991728548 5:69560792-69560814 CTGCACTCCAGCCTGGCGACAGG - Intronic
991804979 5:70415939-70415961 CTGCGCTCCAGCCTGGCGACAGG - Intergenic
991866405 5:71067083-71067105 CTGCGCTCCAGCCTGGCGACAGG + Intronic
991921369 5:71660769-71660791 CTGCACTCCAGCCTGGGCACTGG - Intergenic
992033857 5:72751929-72751951 CTGCACTCCAGCCTGGTGACAGG - Intergenic
992051259 5:72942909-72942931 CTGCACTCCAGCCTGGCGACAGG + Intergenic
992467435 5:77020888-77020910 CTGCACTACAGCCTGGTGACAGG - Intergenic
992555009 5:77894242-77894264 CTGCACTCCAGCCTGGAGAGAGG + Intergenic
992620679 5:78589431-78589453 CTGCACTCCAGTCTGGCAACAGG + Intronic
992731838 5:79678940-79678962 CTGCACTCCAGCCTGGTGACAGG - Intronic
992967015 5:82012996-82013018 CTGCACTCCAGCCTGGCAACAGG - Intronic
993180483 5:84546244-84546266 CTGTACTCCAGCCTGGCGACAGG + Intergenic
993368328 5:87060086-87060108 CTGCACTCCAGCCTGGTGTCAGG - Intergenic
993661794 5:90646808-90646830 CTGCACTCCAGCCTGGTGACAGG - Intronic
994373319 5:98991365-98991387 CTGCACTCCAGCCTGGCAACAGG + Intergenic
994770917 5:103980811-103980833 CTGCACTCCAGCCTGCGGACGGG + Intergenic
995107997 5:108397532-108397554 CTGCACTCCAGCCTGGCGACAGG - Intergenic
995154972 5:108899765-108899787 CTGCACTCCAGCCTGGTGAAAGG + Intronic
995516522 5:112959856-112959878 CTGCACTCCAGCTTGGTGGCAGG - Intergenic
996500598 5:124211807-124211829 CACCACTCCAGCATGGTGACAGG + Intergenic
996513699 5:124346127-124346149 CTGCACTCCAGCCTGGGGGCCGG + Intergenic
997051722 5:130389209-130389231 CTGCACTCCAGCCTGGCCACAGG + Intergenic
997139442 5:131363105-131363127 CTGTGCTCCAGCCTGGCGACAGG + Intronic
997221576 5:132170717-132170739 CTGCACTCCAGCCTGGCAACAGG + Intergenic
997298462 5:132784698-132784720 CTGCACTCCAGCCTGGGTACAGG + Intronic
997312979 5:132905011-132905033 CTGCACTCCAGCCTGGCAACAGG + Intronic
997445637 5:133937853-133937875 CTGCACTCCAGCCTGGAGGCTGG + Intergenic
998066779 5:139165692-139165714 CTGTATTCCAGCCTGGTGACAGG - Intronic
998145833 5:139727725-139727747 CTGCACTCCACCCTGGCAACAGG - Intergenic
998395077 5:141813017-141813039 CTGCACTCCAGCCTGGCGACAGG - Intergenic
998801872 5:145877384-145877406 CTGCATTCCAGCCTGGCAACAGG - Intergenic
998833247 5:146181314-146181336 CTGCACTCCAGCCTGGCGACAGG + Intronic
999796841 5:154996770-154996792 CTGCACTCCACCCTGGTGACAGG + Intergenic
1000112359 5:158121072-158121094 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1000438065 5:161237822-161237844 CTGCACTCCAGCATGGGCAAAGG + Intergenic
1000760262 5:165215137-165215159 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1001266418 5:170277705-170277727 CTGCACTCCAGCCTGGGGACAGG + Intronic
1001726900 5:173911304-173911326 CTGCACTCCAGCCTGGCGACAGG - Intronic
1001873087 5:175174547-175174569 CAGCACTCCAGCCTGGCAACAGG + Intergenic
1002165623 5:177343216-177343238 CTGCACTCCAGCCTGGCGACAGG + Intronic
1002274042 5:178092413-178092435 CTGCACTCCAGCTTGGTGACAGG + Intergenic
1002791833 6:442765-442787 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1003027105 6:2564805-2564827 CTGCACTGCAGCCTGGTGACAGG - Intergenic
1003497398 6:6676280-6676302 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1003901122 6:10656551-10656573 CTGCACTCCAGCCTGGCCAACGG + Intergenic
1003937698 6:10992749-10992771 CTGCACTCCAGCCTGGCGACAGG + Intronic
1003942015 6:11038442-11038464 CTGCACTCCAGCCTGGTGATGGG + Intronic
1004125422 6:12868218-12868240 CTGCACTCCAGCCTGGCAACAGG + Intronic
1004476675 6:15979743-15979765 CTGCACTCCAGCCTGGCCACAGG - Intergenic
1004611091 6:17240192-17240214 CTGTACTCCAGCCTGGCCAACGG - Intergenic
1004947291 6:20629888-20629910 CTGCACTCCAGCCTGGCAACAGG - Intronic
1004962009 6:20800657-20800679 CTGCACTCCAGCATGGGCAACGG - Intronic
1005009968 6:21326599-21326621 CTGTACCCCAGCCTGGCAACAGG - Intergenic
1005075385 6:21901931-21901953 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1005201254 6:23347377-23347399 CTGAACTCCAGCAATGCCATTGG + Intergenic
1006149222 6:31977206-31977228 CTGCACTCCAGCTTGGTGACAGG - Intronic
1006471021 6:34228665-34228687 CTGCACTCCAGCCTGGAGCCTGG + Intergenic
1006545414 6:34776814-34776836 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1006595101 6:35187130-35187152 CTGCACTCCAGTCTGGTGACAGG + Intergenic
1006607707 6:35270595-35270617 CTGCACTCCAGCCTGGTGACAGG - Intronic
1006975822 6:38100098-38100120 CTACACTCCAGCCTGGTGACTGG - Intronic
1007411868 6:41668672-41668694 TTGCACTCCAGCCTGGCGACGGG - Intergenic
1007425315 6:41742659-41742681 CTGCATTCCAGCCTGGTGACAGG - Intronic
1007458125 6:41996699-41996721 CTGCACTCCAGCCTGGCAACAGG - Intronic
1007912688 6:45531714-45531736 CTGCACTCCAGTCTGGCAACAGG + Intronic
1008056428 6:46950549-46950571 CTGCACTCCAGCCTGGCGACAGG - Intronic
1008689112 6:53958001-53958023 CCGCACTCCAGCCTGGTGACAGG - Intronic
1008693540 6:54007957-54007979 CTGCACTCCAGCCTGGTGACAGG - Intronic
1008718723 6:54322269-54322291 CTGCACTCCAGCATGGGAATCGG + Intronic
1009284265 6:61795100-61795122 CTGCACTCCAGCCTGGCGACTGG + Intronic
1009298951 6:61990744-61990766 CTGCACTCCAGCCTGGTGACAGG - Intronic
1009674003 6:66793389-66793411 CTGCACTCCAGCCTGGCGACGGG - Intergenic
1009866338 6:69402152-69402174 CTGCACTCCAGCCTGATGACAGG + Intergenic
1009956127 6:70455886-70455908 CTGCACTCCAGCCTGGCGATAGG - Intronic
1011440275 6:87380067-87380089 CTGCACTCCAGCCTGGTGACAGG + Intronic
1011661897 6:89602045-89602067 CTGAGGTCCAGCAGGGTGACAGG + Intronic
1011718185 6:90128542-90128564 CTGCACTCCAGCCTGGTGGCAGG + Intronic
1011961427 6:93095608-93095630 CTGCACTCCAGCCTGGAGACAGG - Intergenic
1012013711 6:93827819-93827841 CTGAACTCCCACATGGCATCAGG + Intergenic
1012741483 6:103021299-103021321 CTGCACTCCAGCTGGGAGACAGG - Intergenic
1012840191 6:104320149-104320171 CTGCACTCCAGCGTGGTGACAGG + Intergenic
1012879891 6:104774419-104774441 CTGCACTCCAGCCTGGTGACAGG - Intronic
1013092643 6:106914200-106914222 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1013189824 6:107792693-107792715 CTGCGCTCCAGCCTGGTGACAGG + Intronic
1013361531 6:109397926-109397948 CTGCACTCCAGTCTGACGACAGG - Intronic
1013503506 6:110775206-110775228 CTGCACTCCAGCCTGGCAACAGG + Intronic
1013504817 6:110789313-110789335 CTGCACTCCAGCCTGGTGACAGG - Intronic
1014197772 6:118578690-118578712 CTGCACTCCAGCCTGGTGACCGG + Intronic
1014293424 6:119588244-119588266 CTGCACGCCAGCCTGGTGACAGG - Intergenic
1014318771 6:119899220-119899242 CTGTCCTCCAGCATAGGGACTGG - Intergenic
1014848242 6:126306665-126306687 CTGCACTCCAGCCTAGCGATAGG + Intergenic
1015445601 6:133300549-133300571 CTGCACTCCAGCCTGGTGACAGG - Intronic
1015577796 6:134691068-134691090 CTGCACTCCAGCCTGGCCAACGG + Intergenic
1015836798 6:137429110-137429132 CTGAAATCCAGAATGGAGAAAGG + Intergenic
1016426987 6:143945510-143945532 CTGCACTTCAGCCTGGTGACAGG - Intronic
1017118366 6:151000298-151000320 CTGCACTCCAGCCTGGCAACAGG + Intronic
1017201484 6:151759236-151759258 CTGCACTCCAGCATGGCGACTGG + Intronic
1017310704 6:152973817-152973839 CTGCACTCCAACCTGGTGACAGG + Intronic
1017484629 6:154891292-154891314 CTGCACTCCAGCTTGGCAACAGG - Intronic
1017907240 6:158765239-158765261 CTGCACTCCAGCCTGGTGACGGG - Intergenic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019251068 7:11707-11729 CTGCACTCCAGCATGGGGGACGG + Intergenic
1019496429 7:1342511-1342533 CTGGGCTCCAGCAGGGCGGCCGG - Intergenic
1019717887 7:2548926-2548948 CTGCACTCCAGCCTGGTGACAGG + Intronic
1020150808 7:5680436-5680458 CTGCTCTCCAGGCTGGCGACAGG - Intronic
1020212282 7:6165917-6165939 CTGAACCCAAGCCTGGCGCCTGG - Intronic
1020218923 7:6218966-6218988 CTGTACTCCAGGCTGGCAACGGG + Intronic
1020424101 7:8044403-8044425 CTTCACTCCAGCCTGGTGACAGG - Intronic
1020457776 7:8393986-8394008 CTGTACTCCAGCCTGGGTACAGG - Intergenic
1020565410 7:9788529-9788551 CTTCACTCCAGCCTGGCGACAGG - Intergenic
1020588839 7:10108459-10108481 CTGCACTCCAGCCTAGTGACAGG - Intergenic
1020998049 7:15290064-15290086 CTGCACTCCAGCCTGGCAACGGG - Intronic
1020999853 7:15315372-15315394 CTACACTCCAGCCTGGCAACAGG - Intronic
1021724301 7:23534522-23534544 CTGTACTCCAGCCTGGGCACGGG - Intergenic
1022303173 7:29120782-29120804 CTGACCTCCAGCCTAGTGACAGG + Intronic
1022728493 7:33001496-33001518 CTGTACTGCAGCCTGGCGACAGG + Intronic
1022775036 7:33518285-33518307 GTGCACTCCAGCCTGGCGACAGG - Intronic
1023792006 7:43760025-43760047 CTGTACTCCAGCCTGGTGACAGG - Exonic
1023942328 7:44777353-44777375 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1024156276 7:46629023-46629045 CTGCACTCAAGCCTGGCGACAGG + Intergenic
1024183129 7:46917610-46917632 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1024359166 7:48449758-48449780 CTGAAATCCAGCATTATGACTGG + Intronic
1024733594 7:52278394-52278416 CTGCACTCCAGCCTGGAGACAGG + Intergenic
1025045158 7:55686514-55686536 CTGTACTGCAGCCTGGCGACAGG - Intergenic
1025118697 7:56280742-56280764 CTGAGATCCAGCATGGTGGCTGG - Intergenic
1025218113 7:57077258-57077280 ACGCACTCCAGCCTGGCGACAGG + Intergenic
1025629027 7:63250883-63250905 ACGCACTCCAGCCTGGCGACAGG + Intergenic
1025653232 7:63493196-63493218 ACGCACTCCAGCCTGGCGACAGG - Intergenic
1025976299 7:66372987-66373009 CAGCACTCCAGCCTGGCAACAGG - Intronic
1026086839 7:67269702-67269724 CTGCACTCCAGCCTGGCTAATGG - Intergenic
1026150591 7:67785076-67785098 CTGCACACCAGCCTGGCGACAGG - Intergenic
1026293599 7:69030612-69030634 CTGCACTTCAGCCTGGGGACTGG + Intergenic
1026306981 7:69150850-69150872 CTGCACTCCAGCCTGGGGGCTGG + Intergenic
1026458340 7:70592398-70592420 CTGTACTCCAGCCTGTCAACAGG - Intronic
1026690274 7:72545019-72545041 CTGCACTCCAGCCTGGCTAATGG + Intergenic
1027133701 7:75609592-75609614 CTGCACTGCAGCCTGGCGACAGG - Intronic
1027198865 7:76049866-76049888 CTGCACTCCAGCCTGTCGACAGG - Intronic
1027228152 7:76257734-76257756 CTGCACTCCAGCCTCGCGACAGG + Intronic
1027362270 7:77421756-77421778 CTGCACTCTAGCCTGGAGACAGG - Intergenic
1027461387 7:78458257-78458279 CTGCACTCCAGCCTGGAGACAGG + Intronic
1027466960 7:78526969-78526991 CTGCACTCCAGCATGGTGACAGG + Intronic
1027598711 7:80211452-80211474 CTGCACTCCAGTCTGGCAACAGG - Intronic
1027927586 7:84486349-84486371 TTGCATTCCAGCCTGGCGACAGG + Intronic
1028533961 7:91870797-91870819 CTGAACTCCAGCATGGGCAAGGG - Intronic
1029029553 7:97453581-97453603 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1029200470 7:98835880-98835902 CTGAGCCCCAGCTTGGCCACAGG - Intergenic
1029350434 7:100009578-100009600 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1029400726 7:100344035-100344057 CTGCACTCCAGCCTGGCAACTGG + Intronic
1029417478 7:100452129-100452151 CTGCACTCCAGCCCGGTGACAGG - Intergenic
1029557810 7:101282455-101282477 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1029892342 7:103943809-103943831 CTGCACTCCAGCTTGGGGAATGG + Intronic
1029905765 7:104092146-104092168 TTGCACTCCAGCCTGGTGACAGG - Intergenic
1030090647 7:105854989-105855011 CTGCACTCCAGCCTGGTGACAGG - Intronic
1030925445 7:115448102-115448124 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1030970763 7:116052463-116052485 CTGCACTCCAGCCTGGCAACAGG - Intronic
1031111930 7:117621063-117621085 CTGCACTCCAGCCTGGTGACAGG + Intronic
1031339343 7:120579563-120579585 CTGCATTCCAGCCTGGAGACGGG + Intronic
1031550971 7:123111168-123111190 CTGAAACCCAGCAAGGAGACAGG - Intergenic
1031814912 7:126421831-126421853 CTGCACTCCAGCCTGGGGCCTGG - Intergenic
1032338672 7:131050226-131050248 CTGTGCTCTAGCCTGGCGACAGG - Intergenic
1032378718 7:131452585-131452607 CTGCACTCCAGCCTGGCGACAGG - Intronic
1032593799 7:133218548-133218570 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1032639966 7:133755378-133755400 CTGCACTCCAGCCTGGTGACAGG - Intronic
1032823490 7:135546399-135546421 CTGCACTCCAGTGTGGCAACAGG - Intergenic
1032830011 7:135613571-135613593 CTGCACTCCAGCCTGGTGACAGG - Intronic
1032887044 7:136151685-136151707 CTGCACTTCAGCCTGGTGACAGG + Intergenic
1033198795 7:139350710-139350732 CTGCACTCCAGCCTGGCAACTGG - Intronic
1033261865 7:139850938-139850960 CTGAACTCCAGAATGATGAGAGG + Intronic
1033295902 7:140135238-140135260 CTGCACTCCAGCCTGGCAACAGG - Intronic
1033611322 7:142965903-142965925 CTGCACTCCAGCCTGCTGACAGG - Intergenic
1034016577 7:147594161-147594183 CTGTACTCCAGCCTGGTGACTGG - Intronic
1034067301 7:148149579-148149601 TTGCACTCCAGCCTGGCCACAGG - Intronic
1035147544 7:156835101-156835123 CTGCACTCCAGCCTGGTGACAGG + Intronic
1035768177 8:2125642-2125664 CTGCACTACAGCCTGGCAACAGG - Intronic
1035868311 8:3109226-3109248 CTGCACTCCAGCTGTGCGACAGG + Intronic
1036149978 8:6288098-6288120 CAGCACTCCAGCCTGGCAACAGG + Intergenic
1036152434 8:6310980-6311002 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1036813192 8:11881689-11881711 CTGCACTCCAGCCTGGAGAAGGG + Intergenic
1036920185 8:12845056-12845078 CTGCACTTCAGCCTGGCGACAGG + Intergenic
1037088009 8:14877008-14877030 CTGTGCTCCAGCCTGGTGACAGG - Intronic
1037306962 8:17515330-17515352 CTGCACTCCAGTCTGGAGACAGG - Intronic
1037322808 8:17659659-17659681 CCGCACTCCAGCCTGGCGACAGG + Intronic
1037654795 8:20873589-20873611 CTGCACTCCAGCCTGGCTAACGG + Intergenic
1037847675 8:22298223-22298245 CTGCACTCCAGCCTGGCCAATGG + Intronic
1038112412 8:24514006-24514028 CTGCACTCCAGCCTGGCGACAGG + Intronic
1038214101 8:25545854-25545876 CTGATCTTCAGCATGGGGAGGGG - Intergenic
1038459829 8:27706446-27706468 CTAAACTCAAGCATGAGGACGGG - Intergenic
1039348762 8:36737603-36737625 TTGCACTCCAGCCTGGCGACAGG + Intergenic
1041153031 8:54955952-54955974 CTGTACTCCAGCCTGGTGACAGG + Intergenic
1041785027 8:61622299-61622321 CTGCACTCCAGTCTGGTGACAGG + Intronic
1042141444 8:65683166-65683188 CTGCACTCCAGCCTGGCAACAGG - Intronic
1042372122 8:68003883-68003905 CTGCACTCCAGCCTGGCGAGAGG - Intronic
1042704813 8:71654986-71655008 CTGCACTCCAGCCTGGTGACTGG - Intergenic
1042895479 8:73662651-73662673 TTGCACTCCAGCCTGGCAACAGG - Intronic
1042915073 8:73867496-73867518 CTGCACTCCAGTCTGGCAACAGG + Intronic
1043639765 8:82437812-82437834 TTGCACTCCAGCTTGGCAACAGG - Intergenic
1043648734 8:82559712-82559734 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1043861327 8:85320456-85320478 CTACACTCCAGCCTAGCGACAGG + Intergenic
1044632844 8:94296073-94296095 CTGCACTCCAGCCTGGCCAGGGG + Intergenic
1044666106 8:94636258-94636280 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1044714944 8:95091674-95091696 CTGCACTCCAGCATGGGTGCAGG - Intronic
1044869178 8:96601602-96601624 TTGCACTCCAGCCTGGTGACAGG + Intronic
1045403088 8:101838256-101838278 CTGCACTCCAGGCTGGCGACAGG - Intronic
1046057224 8:109093440-109093462 CTGCACTCCAGCCTGGTGACAGG - Intronic
1046303853 8:112335947-112335969 CTGCACTCCAGCATGGGCAACGG - Intronic
1046434787 8:114173366-114173388 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1046594099 8:116239846-116239868 TTGCACTCCAGCCTGGTGACAGG + Intergenic
1046720295 8:117611708-117611730 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1046939249 8:119915001-119915023 CTGCCCTCCAGCCTGGTGACAGG - Intronic
1047016500 8:120729014-120729036 GTGCACTCCAGCCTGGGGACAGG - Intronic
1047113175 8:121813576-121813598 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1047257998 8:123230685-123230707 CTGCACTCCAGCCTGGCGACAGG - Intronic
1047286847 8:123494430-123494452 CTGCACTCCAGCCTGGCCACAGG + Intergenic
1047290266 8:123523551-123523573 CTGCACTCCAGCCTGGTGACAGG + Intronic
1047734772 8:127755602-127755624 CTGCACTCCAGCCTGGAGACAGG - Intergenic
1048204263 8:132402979-132403001 CTGTACTCCAGCCTGGCAACAGG + Intronic
1048540040 8:135334133-135334155 CTGAACCCCAGACTTGCGACAGG + Intergenic
1048777561 8:137964085-137964107 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1048994281 8:139782341-139782363 CTGCACTCTAGCCTGGCCACAGG + Intronic
1049571175 8:143370956-143370978 CTGGTCTCCAGCATGCCGAGTGG + Intronic
1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG + Intronic
1050226102 9:3457102-3457124 CTGCGCTCCAGCCTGGCAACAGG + Intronic
1050422661 9:5482965-5482987 CTGAACTCCAGCCTGGGCAATGG - Intergenic
1050513280 9:6416103-6416125 CGCCACTCCAGCCTGGCGACAGG - Intronic
1051368272 9:16336614-16336636 CTGAATTTCAAGATGGCGACAGG - Intergenic
1051410110 9:16780533-16780555 CTACACTCCAGCCTGGCGACAGG + Intronic
1051459835 9:17299204-17299226 TTGCACTCCAGCCAGGCGACAGG + Intronic
1051635579 9:19178299-19178321 CTGCACTCCAGCCTGGCCAATGG - Intergenic
1052443910 9:28534191-28534213 CTGTACTCCAGCCTGGTGACAGG - Intronic
1052521078 9:29549051-29549073 CTGCACTCCAGCCTGGAAACAGG - Intergenic
1052541172 9:29812916-29812938 CTGCACTCTAGCCTGGTGACAGG + Intergenic
1052693743 9:31849712-31849734 CTGCACTTCAGCCTGGTGACAGG + Intergenic
1052816931 9:33109057-33109079 GTGAACTCCTGGATGGGGACTGG + Intronic
1053334179 9:37249505-37249527 GTGGACTCCAGCGTGGCGACAGG - Intronic
1053372102 9:37570955-37570977 CTGCAGTCCAGCCTGGCGACAGG + Intronic
1055080246 9:72261600-72261622 CTGCACTTCAGCCTGGCGACAGG + Intergenic
1055299961 9:74872464-74872486 CTGCACTCCAGCTTGGGCACAGG - Intronic
1055547061 9:77389342-77389364 CTGCACTCCAGCATGGGCAATGG - Intronic
1055704649 9:78984421-78984443 GGGAACTCCAGAATGGAGACAGG - Intergenic
1055759113 9:79588182-79588204 CCGCACTCCAGCCTGGCAACAGG - Intronic
1055922086 9:81471866-81471888 CTGCACTCCAGCCTGGCGACAGG + Intergenic
1055950500 9:81725578-81725600 TTGCACTCCAGCTGGGCGACAGG - Intergenic
1056222716 9:84465961-84465983 CTGAACCCCAACATGACAACAGG - Intergenic
1056474096 9:86936223-86936245 CTGCACTCCAGCCTGGCGATAGG + Intergenic
1056582054 9:87896104-87896126 CTACACTCCAGCCTGGTGACAGG + Intergenic
1056636633 9:88336887-88336909 CTGCACTCCAGCATGGCGACAGG - Intergenic
1057066255 9:92054873-92054895 CTGCACTCCAGCCTGACGACAGG + Intronic
1057070324 9:92092696-92092718 CTGCACTCCAGCCTGACAACAGG + Intronic
1057099964 9:92349438-92349460 CAGCACTCCAGCCTGGTGACAGG - Intronic
1057348264 9:94271681-94271703 TTGCACTCCAGCCTGTCGACAGG + Intronic
1057550276 9:96047189-96047211 CTGACCTCAAGCAGGGCCACCGG - Intergenic
1059232763 9:112736889-112736911 CTGCACTCCAGCCTGGCGACAGG - Intergenic
1059679248 9:116570430-116570452 CTGCACTCCAGCCTGGAGCCGGG - Intronic
1059763901 9:117365110-117365132 CTGCACTCCAGCCTGGGCACTGG + Intronic
1060197257 9:121631777-121631799 CTGCACTCCAGCCTGGCTACAGG + Intronic
1060272196 9:122152590-122152612 CTGCACTCCAGCCTGGGGAATGG - Intronic
1060323423 9:122588391-122588413 CTGCACTCCAGCCTGGTGCCTGG - Intergenic
1060489992 9:124076793-124076815 TTGCACTCCAGCCTGGTGACAGG - Intergenic
1060577111 9:124706546-124706568 CTGCACTCCAGCCTGGCGACAGG - Intronic
1060591165 9:124817821-124817843 CTGTACTCCAGCATGGGGGACGG - Intergenic
1060988366 9:127834107-127834129 TTGCACTCCAGCCTGGCAACAGG - Intronic
1061044594 9:128158149-128158171 TTGCACTCCAGCCTGGCGACAGG + Intergenic
1061088867 9:128415329-128415351 CTGCACTCCAGCCTGGATACAGG + Intronic
1061124793 9:128667767-128667789 CTGCACTCCAGCCTGGCAACAGG - Intergenic
1061823138 9:133239586-133239608 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1062175132 9:135157577-135157599 CTGCACTCAAGCCTGGCGACAGG - Intergenic
1062749493 9:138242063-138242085 CTGCACTCCAGCATGGGGGACGG - Intergenic
1185581977 X:1216662-1216684 CTGCATTCCAGCCTGGTGACAGG + Intergenic
1185640166 X:1586010-1586032 CTGCACTCCAGTCTGGCAACAGG - Intergenic
1185665417 X:1761592-1761614 CTGCACTCTAGCCTGGCGACAGG - Intergenic
1185678672 X:1870135-1870157 CAGCACTCCAGCCTAGCGACAGG - Intergenic
1185713456 X:2322510-2322532 CTGAACTCCAGCCTGACTCCAGG + Intronic
1185729991 X:2453632-2453654 CTGTACTCCAGCCTGGCTATAGG + Intronic
1185732253 X:2470668-2470690 CTGTACTCCAGCCTGGCTATAGG + Intronic
1185864709 X:3613112-3613134 CTGAACTCCAGCCTGGGCAACGG + Intronic
1186110478 X:6249826-6249848 CTGCACTCCAGCCTGGGCACTGG + Intergenic
1186115006 X:6296462-6296484 CTGCACTCCAACCTGGGGACAGG - Intergenic
1186415800 X:9382169-9382191 CTGCACTCCAGCCTGGTGACAGG + Intergenic
1187063586 X:15811459-15811481 CTGCACTCCAGCCTGGTGACAGG - Intronic
1187418338 X:19112919-19112941 CTGCACTCCAGCCTGGCGACAGG + Intronic
1187881744 X:23853660-23853682 CTGCACTCCAGCCTGGTGAATGG - Intronic
1188384172 X:29535095-29535117 CTGAACTCCAGCCTGGGCAATGG + Intronic
1188948694 X:36341070-36341092 CTGCACTCCAGCCTGGTGACAGG - Intronic
1189680465 X:43510869-43510891 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1190081196 X:47358054-47358076 CTGCACCCCAGCCTGGCGACAGG + Intergenic
1190326254 X:49208860-49208882 CTGCACTCCCGCCTGGTGACAGG - Intronic
1190377179 X:49799614-49799636 TTGCACTCCAGCCTGGTGACAGG + Intergenic
1190809328 X:53868529-53868551 CTGCACTCCAGCTGGGCAACAGG - Intergenic
1190820989 X:53972284-53972306 CTGCACTTCAGCCTGGTGACAGG + Intronic
1192490939 X:71577230-71577252 TTGCACTCCAGCATGGGGACAGG - Intergenic
1192742587 X:73907687-73907709 CTGCACTCCAGCCTGGTGACAGG - Intergenic
1192787161 X:74346861-74346883 CTGCTCTCCAGCCTGGTGACAGG - Intergenic
1194572242 X:95567120-95567142 CTGCACTCCAGCCTGGTGAGAGG + Intergenic
1195734578 X:107999323-107999345 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1196104408 X:111881211-111881233 CTACACTCCAGCCTGGTGACAGG - Intronic
1196117907 X:112017048-112017070 CTGCACTGCAGCCTGGAGACAGG - Intronic
1196247109 X:113413722-113413744 CTGCACTCCAGCCTGGTAACAGG - Intergenic
1196795590 X:119499850-119499872 CTGCACTCCAGCCTGGCGATAGG + Intergenic
1198716145 X:139559493-139559515 CTGCTCTCCAGCCTGGTGACAGG + Intronic
1198833714 X:140778566-140778588 CTGCACTCCAGCCTGGCAACAGG + Intergenic
1199592888 X:149484351-149484373 CTGAACTCCATCCTGGAGACAGG - Intronic
1200799245 Y:7370927-7370949 CTGAACTCCAGCCTGGGCAACGG - Intergenic
1201626092 Y:16016289-16016311 CTGCACTCCAGCATGGCTATCGG + Intergenic
1201773529 Y:17641359-17641381 CAGCACTCCAGCCTGGTGACAGG + Intergenic
1201828026 Y:18264627-18264649 CAGCACTCCAGCCTGGTGACAGG - Intergenic
1202131406 Y:21614763-21614785 TTGAACTCCAGCCTGGCAACAGG + Intergenic
1202250199 Y:22863525-22863547 CTGCAGTCCAGCATGGCAACAGG - Intergenic
1202403188 Y:24497273-24497295 CTGCAGTCCAGCATGGCAACAGG - Intergenic
1202467593 Y:25172808-25172830 CTGCAGTCCAGCATGGCAACAGG + Intergenic
1202599535 Y:26578666-26578688 CTTAAGTCCAGCAAGGCAACAGG + Intergenic