ID: 1150241201

View in Genome Browser
Species Human (GRCh38)
Location 17:63634381-63634403
Sequence TTGGAAGGCCCAAAAGGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150241201 Original CRISPR TTGGAAGGCCCAAAAGGACG AGG Intronic
902339824 1:15775701-15775723 ATAGAAGGCCCAAGAGGACAGGG - Intronic
904619978 1:31769509-31769531 ATGGAAGGCTGAAAAGGAAGAGG - Intergenic
911048691 1:93651112-93651134 TGGGAAGAACCAAAAGGAAGAGG + Intronic
912008121 1:104929628-104929650 TTGGAAGACAAAAAAGGACCAGG + Intergenic
913330368 1:117662293-117662315 TTGGAAGGCCCAGAAGAAGATGG + Intergenic
918375018 1:183900320-183900342 TTTGAAGGTCCAAAAGTACATGG + Intronic
921020594 1:211231617-211231639 TTGTAAGGCTCATAAGAACGGGG + Intergenic
922440494 1:225652532-225652554 TTGGAAGGGACAAAAGGCGGAGG + Intronic
1065798644 10:29330975-29330997 ATGGAAGGCCCCAGAGGAAGAGG + Intergenic
1072044698 10:91643301-91643323 TTTGAAGGCCCACAAGGAAAAGG - Intergenic
1074075654 10:110121546-110121568 TTGGAAGGGCCACAAGAAAGGGG + Intronic
1075776366 10:124991463-124991485 TTTTGAGGGCCAAAAGGACGGGG + Intronic
1077162945 11:1121868-1121890 TGGCAAGGCCCAGGAGGACGGGG - Intergenic
1077968984 11:7167558-7167580 TAGGCAGGCCCAGAAGGATGGGG + Intergenic
1078430427 11:11283952-11283974 CTGAAAGGCCCAGAAGGAGGAGG - Intronic
1079319616 11:19441118-19441140 TTAGAAGGGGCAAAAGGAGGTGG + Intronic
1086121864 11:83312754-83312776 TTGGAAGGCTCAACAGGATGTGG + Intergenic
1086373058 11:86174093-86174115 TTGGAGGGCACAAAATGAAGTGG + Intergenic
1089177714 11:116560461-116560483 ATGGAAAGCCTAAAAGGATGGGG + Intergenic
1090207066 11:124891299-124891321 TTGGAAGGCCAAAAAGAAGCAGG - Exonic
1095835642 12:46636511-46636533 TTGGAATGTCCAAAAGTACTTGG - Intergenic
1103931441 12:124453051-124453073 TTGGAAAGCCCAGAAGGGAGTGG + Intronic
1105236363 13:18557986-18558008 ATGGAAGTCCCAAAAGGAGAGGG - Intergenic
1105455638 13:20538852-20538874 TTGGAAGGGCCAAAAGGATCAGG - Intergenic
1114223087 14:20714305-20714327 TAGTAAGACCCAAAAGGAAGAGG - Intergenic
1119473965 14:74916442-74916464 TTGGGAGGCCTAAACGGAGGTGG + Intronic
1122195338 14:100080633-100080655 TACGAAGGCCCAAAATGACAGGG + Intronic
1122367142 14:101200906-101200928 TTGGAAGCCCCAAACGGACAAGG - Intergenic
1122761652 14:104033226-104033248 TTGGAAGGCCCTAGGGGACCTGG - Intronic
1126734533 15:51717789-51717811 ATGAAAGGCCCAAGAGGACAGGG - Intronic
1128825364 15:70710847-70710869 GTGAAAGCCCCAAAAGGACAGGG - Intronic
1129829962 15:78662150-78662172 TTGAAAGGCCCATTAGGAAGAGG - Intronic
1134287836 16:12877932-12877954 AGGCAAGACCCAAAAGGACGTGG - Intergenic
1134492685 16:14707438-14707460 TTGGAGGGCAGAAAAGGAGGTGG + Intergenic
1134498066 16:14746560-14746582 TTGGAGGGCAGAAAAGGAGGTGG + Intronic
1134582508 16:15382533-15382555 TTGGAGGGCAGAAAAGGAGGTGG - Intergenic
1135313825 16:21426584-21426606 TTGGAGGGCAGAAAAGGAGGTGG - Intronic
1135366749 16:21858864-21858886 TTGGAGGGCAGAAAAGGAGGTGG - Intronic
1135445066 16:22512294-22512316 TTGGAGGGCAGAAAAGGAGGTGG + Intronic
1135980459 16:27142993-27143015 CTGGAAGGCCCTAAAGATCGTGG + Intergenic
1136193788 16:28636833-28636855 TTGGAGGGCAGAAAAGGAGGTGG + Intergenic
1136310488 16:29405287-29405309 TTGGAGGGCAGAAAAGGAGGTGG - Intergenic
1136323936 16:29507075-29507097 TTGGAGGGCAGAAAAGGAGGTGG - Intergenic
1136438621 16:30247058-30247080 TTGGAGGGCAGAAAAGGAGGTGG - Intronic
1138266568 16:55664065-55664087 ATAGAAGGCCCAAGAGGACAGGG + Intronic
1139858174 16:69997673-69997695 TTGGAGGGCAGAAAAGGAGGTGG - Intergenic
1140160463 16:72486389-72486411 ATGGAAGGCAGAAAAGGACAAGG - Intergenic
1141632404 16:85295442-85295464 GTGGATGGGCAAAAAGGACGCGG - Intergenic
1147589981 17:41676508-41676530 TTGGAAAGCCCCTAAGGAGGGGG + Intergenic
1148699235 17:49578022-49578044 TAGGAAGTCCCAAAAGGCAGGGG + Intronic
1148836321 17:50467704-50467726 GTGGAAGGCCCAACAGGAAGAGG + Intronic
1149090273 17:52769727-52769749 TAGGAAACCCCAAAAAGACGAGG + Intergenic
1150241201 17:63634381-63634403 TTGGAAGGCCCAAAAGGACGAGG + Intronic
1151255190 17:72871413-72871435 TTGGAAAGCCCTTAAGGATGGGG + Intronic
1153166034 18:2263143-2263165 TTCGTAGGCCCAAATGGACTTGG - Intergenic
1153509637 18:5838031-5838053 TTGGAAAGCCCCTAAGGATGGGG + Intergenic
1157896623 18:51475031-51475053 TTGCTAGGCCAGAAAGGACGAGG - Intergenic
1165354561 19:35295646-35295668 TTCGAAGGCCGAGATGGACGAGG - Exonic
1168402817 19:56095728-56095750 TGGGAAGGCCCAAAAGGGGCTGG - Intronic
927024254 2:19049328-19049350 TTGGAAGGCCTCAGAGGAGGGGG - Intergenic
939588478 2:144033724-144033746 TTGGAAAGCCCCTAAGGAGGAGG - Intronic
947467254 2:230362191-230362213 TTGGAAAGCCCTTAAGGATGGGG - Intronic
1171095746 20:22331097-22331119 AAGGAAGGACCAAAAGGAGGAGG - Intergenic
1171480264 20:25449931-25449953 ATAAAAGGCCCAAAAGGACAGGG - Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1176780356 21:13186271-13186293 ATGGAAGTCCCAAAAGGAGAGGG - Intergenic
1176978472 21:15351803-15351825 TGGTTAGGCCCAAAAGGGCGAGG + Intergenic
1177978031 21:27875290-27875312 ATGGAAGTCCCAAAAGGAGAGGG - Intergenic
1179207970 21:39301418-39301440 CTGGAAAGACCAAAAGGGCGAGG + Intronic
1183306956 22:37087698-37087720 CGGTAAGGCCAAAAAGGACGTGG - Intronic
952890050 3:38033813-38033835 TTACAAGGCCCAACAGGACTTGG - Intergenic
956381098 3:68665364-68665386 CTTGAAAGCCCAAAAGGACTAGG + Intergenic
956933793 3:74076604-74076626 TTGAAAAGCACAAAAGGAAGTGG - Intergenic
963028495 3:140942563-140942585 TTGCATGGCCCAAGGGGACGGGG + Intronic
966065846 3:175820644-175820666 TAGCAAGGCCCAAAAGGAGGGGG + Intergenic
966197741 3:177330209-177330231 TTGGAAGGCCCAGTAAGATGAGG + Intergenic
979534690 4:121806382-121806404 TTGGAAGGCCGATGTGGACGAGG - Intronic
984810122 4:183788605-183788627 TGGGAAGACCCAACAGGAGGAGG + Intergenic
991703913 5:69339828-69339850 TTGGAATAACCAAAGGGACGTGG + Intergenic
992784844 5:80159758-80159780 ATAAAAGGCCCAAAAGGACATGG + Intronic
994670569 5:102756900-102756922 TTGGAAGGCCCTTCAGGACAAGG - Intronic
1006555004 6:34858524-34858546 TAGGCAGGCCCAAATGGACAGGG - Exonic
1007906984 6:45471676-45471698 TTGGGAGGCCGAGGAGGACGAGG - Intronic
1009301382 6:62027527-62027549 TTGGAAAGCCCCTAAGGATGAGG + Intronic
1009693660 6:67068554-67068576 TTGGAGGGCTCAAAAGTACATGG + Intergenic
1011681743 6:89790256-89790278 TTGGAAGGACCAATAGGATGTGG - Exonic
1012021972 6:93934182-93934204 TGGGAAGGCTCAACAGGACCTGG + Intergenic
1017822785 6:158061163-158061185 TTGGAAGGACTAGAAGGACTTGG - Intronic
1019395911 7:817369-817391 TTTGAAGGCGCAACAGGGCGCGG - Intronic
1023941178 7:44769185-44769207 TGGGAAGGCCCTCAAGGATGGGG - Exonic
1024213475 7:47227321-47227343 TGGGAAGGCCCAGCAGGACAGGG - Intergenic
1024227336 7:47335962-47335984 TAGGGAGGCCTAAAAGGACACGG - Intronic
1031404105 7:121362263-121362285 TTGGAAGTCCCACAAGGAGTGGG - Intronic
1036628034 8:10488111-10488133 TTGGAGGACCCAAACTGACGGGG + Intergenic
1038645087 8:29354276-29354298 TGGGAAGGCTCAAAAGAACTGGG + Intergenic
1039089045 8:33808952-33808974 TTAGAAGGCCCTGAAGGAAGAGG + Intergenic
1044542960 8:93428510-93428532 CTGGAAGGCCCACAAGTACAGGG + Intergenic
1050485027 9:6125154-6125176 GTGGAAAGCCCAAGAGGACTAGG + Intergenic
1051525365 9:18037005-18037027 TAGGAAGCCCCAAAAGGGAGGGG - Intergenic
1055401914 9:75933049-75933071 CTGGAAAACCCAAAAGGACTTGG - Intronic
1058031004 9:100197586-100197608 ATAAAAGGCCCAAAAGGATGGGG - Intronic
1058652737 9:107191751-107191773 TTGTAAGGCACAAAATGAGGAGG - Intergenic
1062290817 9:135793598-135793620 GGGGAAGGACCAAAAGGCCGAGG + Intergenic
1185716703 X:2348499-2348521 TAGAAAGGCTCAAAAGGATGGGG + Intronic
1187478628 X:19634623-19634645 TTGGAGGGGCCACAAGGAGGAGG + Intronic
1190879998 X:54485148-54485170 TTGGAAGGCCCTAGTGGACTAGG + Intronic
1198100795 X:133419965-133419987 TTTGGAGGCCTAAAAGGAGGAGG - Intergenic
1202372951 Y:24210574-24210596 CTGTGAGGCCCAAAAGGAAGGGG - Intergenic
1202497831 Y:25459546-25459568 CTGTGAGGCCCAAAAGGAAGGGG + Intergenic