ID: 1150243807

View in Genome Browser
Species Human (GRCh38)
Location 17:63658434-63658456
Sequence TCTGTAGGGTGTCAGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150243803_1150243807 -9 Left 1150243803 17:63658420-63658442 CCAATGGCAGGCAGTCTGTAGGG 0: 1
1: 0
2: 3
3: 15
4: 154
Right 1150243807 17:63658434-63658456 TCTGTAGGGTGTCAGAAGTGGGG 0: 1
1: 0
2: 2
3: 12
4: 161
1150243801_1150243807 -8 Left 1150243801 17:63658419-63658441 CCCAATGGCAGGCAGTCTGTAGG 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1150243807 17:63658434-63658456 TCTGTAGGGTGTCAGAAGTGGGG 0: 1
1: 0
2: 2
3: 12
4: 161
1150243798_1150243807 21 Left 1150243798 17:63658390-63658412 CCTCTTATAACTTATCAGCTGTT 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1150243807 17:63658434-63658456 TCTGTAGGGTGTCAGAAGTGGGG 0: 1
1: 0
2: 2
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150243807 Original CRISPR TCTGTAGGGTGTCAGAAGTG GGG Intronic
900233563 1:1575087-1575109 ACTCTGGGGTGGCAGAAGTGAGG - Intergenic
900282012 1:1876041-1876063 TCTGGTGGGTGCCAGCAGTGTGG - Intronic
901624682 1:10617318-10617340 TCTGAGGGTGGTCAGAAGTGGGG - Intronic
905908682 1:41639010-41639032 TCAGGAGGGTGTCAGGAGGGTGG - Intronic
907987642 1:59548053-59548075 TCTGTAGAGAGTCAGAAGATGGG + Intronic
908395202 1:63719089-63719111 GCTGGAGTGTTTCAGAAGTGAGG - Intergenic
910212849 1:84811293-84811315 TCTGGAGGGGGTCCAAAGTGTGG - Intergenic
911552362 1:99298600-99298622 TCTGTAGGGTGTGATAACTGTGG + Intronic
913176361 1:116276626-116276648 TGTGCAGGGAGACAGAAGTGTGG - Intergenic
914992362 1:152510024-152510046 TCTGGAGGTTTCCAGAAGTGAGG - Intergenic
915909500 1:159904810-159904832 TATGAAGGGTGAGAGAAGTGAGG - Intergenic
916806300 1:168264745-168264767 TCTGTAGGGGGTCATCAGTAAGG + Intergenic
917357390 1:174141133-174141155 TCTGTCAGTGGTCAGAAGTGAGG - Intergenic
921302046 1:213760568-213760590 TGTGTAGGTAGACAGAAGTGTGG - Intergenic
1063702584 10:8400102-8400124 TCTGCTGGGTGTGTGAAGTGAGG + Intergenic
1063706789 10:8438665-8438687 TCTGTGGTATGACAGAAGTGAGG + Intergenic
1067461308 10:46460541-46460563 TCTGTAGTGGGTCAACAGTGGGG + Intergenic
1067625887 10:47924060-47924082 TCTGTAGTGGGTCAACAGTGGGG - Intergenic
1070494643 10:77010436-77010458 TCGGTAGGTTGTCAGAATCGGGG + Intronic
1070891293 10:79943807-79943829 GCTGTTGGGTGTCAGAGGTGGGG - Intronic
1073169809 10:101495941-101495963 AATGTATGGTGTTAGAAGTGAGG - Intronic
1075012984 10:118890824-118890846 TCTCTAGGGTACCCGAAGTGAGG - Intergenic
1075587845 10:123670232-123670254 TCTGGAGGGTGTCAGAATTGTGG + Intronic
1075904750 10:126071526-126071548 TCTTTCGGGGGCCAGAAGTGTGG - Exonic
1076125104 10:127967832-127967854 AATCTATGGTGTCAGAAGTGGGG - Intronic
1078639169 11:13079428-13079450 ACTGTGGGTTCTCAGAAGTGGGG - Intergenic
1080259649 11:30334032-30334054 TCTGAAGGATGAGAGAAGTGAGG + Intronic
1082087092 11:48059011-48059033 TCTGTAGGGTGGAAGAAGTGGGG - Intronic
1085500561 11:77018783-77018805 TGTGAAGGCTGACAGAAGTGAGG + Intronic
1087893291 11:103559508-103559530 TTCTTAAGGTGTCAGAAGTGAGG - Intergenic
1088129225 11:106466882-106466904 TCTGAGGGGTTTCAGAAGTGAGG - Intergenic
1089327739 11:117668936-117668958 TCTGGGGGGTGGCAGTAGTGGGG + Intronic
1089464401 11:118675372-118675394 TGTGGCTGGTGTCAGAAGTGAGG - Intronic
1089766955 11:120774992-120775014 TGTGTGTGGTGTCAGATGTGTGG + Intronic
1091930084 12:4389025-4389047 TTTGTAGGGTTTCAGGAGGGAGG - Intergenic
1092141078 12:6183733-6183755 TCTGCAAGGAGTCAGAAGAGAGG + Intergenic
1092223120 12:6728991-6729013 TCTGTGGTGTGTCAGGGGTGAGG + Intronic
1093167550 12:15822405-15822427 TCTGTGTGGTGTCAGAAGGCTGG - Intronic
1093918986 12:24838040-24838062 ACTCCTGGGTGTCAGAAGTGGGG - Intronic
1095393192 12:41733438-41733460 GCTGTGGGGTGGCAGGAGTGGGG - Intergenic
1098427354 12:70379790-70379812 TATGAAGGCTGCCAGAAGTGAGG - Intronic
1098723538 12:73932235-73932257 TCTGCAGGGTGTGAGAAGCTAGG - Intergenic
1100623036 12:96299178-96299200 TCTGTAGTGTTACAGAAGTATGG - Intronic
1100820305 12:98423428-98423450 TCTGTAGGGGGTCATCAGTAAGG - Intergenic
1100836615 12:98572669-98572691 TTGCTAGGGTGTCTGAAGTGGGG - Intergenic
1104366121 12:128179042-128179064 TCTTGAGGATGTCAGAATTGAGG - Intergenic
1104918729 12:132279561-132279583 TCTGGAGGGTGGAAGGAGTGAGG + Intronic
1105923702 13:24987463-24987485 TTTGTATGGTGGCAGAAGTTGGG - Intergenic
1107824676 13:44317822-44317844 TCTGTAAGGTGGCAGATTTGAGG - Intergenic
1108902602 13:55431249-55431271 TCTGTAGTGTGTAGGAAGAGGGG - Intergenic
1110132450 13:72023756-72023778 TCTGCAGGGTGTCATCAGTAAGG - Intergenic
1110610282 13:77480271-77480293 AATGTAGGGAGTCAGGAGTGGGG - Intergenic
1111072786 13:83189923-83189945 TCCGTAAGAAGTCAGAAGTGTGG - Intergenic
1113548847 13:111176180-111176202 TCTGTAGGTTGATGGAAGTGTGG + Intronic
1113835359 13:113325382-113325404 TGTGTGTGGTGCCAGAAGTGTGG - Exonic
1114654296 14:24306848-24306870 TCTTGAGGGTGTGGGAAGTGAGG - Exonic
1114987300 14:28246386-28246408 TCTGTAGGGTGGTGGAAGGGCGG - Intergenic
1118995950 14:70836121-70836143 TGTGGTGGGTGTCTGAAGTGAGG + Intergenic
1119019564 14:71096952-71096974 TCTGTATGGGGTGAGAAGTAAGG - Intronic
1119513815 14:75232408-75232430 ACAGTAGGGTGGCAGATGTGTGG + Intergenic
1123115330 14:105891850-105891872 TCTGTCTGGTGTCTGGAGTGGGG + Intergenic
1128637664 15:69313669-69313691 TCTGTAGAGTGCCGGAAATGGGG - Intronic
1128736355 15:70056089-70056111 TCTGTGGGTGCTCAGAAGTGTGG + Intronic
1129105406 15:73303973-73303995 TCTGAAGGGGCTCTGAAGTGTGG - Exonic
1134360679 16:13528297-13528319 GTTGCAGGGAGTCAGAAGTGTGG - Intergenic
1137568148 16:49547043-49547065 TCTGCAGGGTATTGGAAGTGTGG - Intronic
1141421951 16:83923190-83923212 TCTGTGTGGCCTCAGAAGTGAGG + Exonic
1143776666 17:9204035-9204057 TCTGTGGGGTGACAGAAGTCAGG + Intronic
1146531560 17:33611519-33611541 TCTGTAGGTTGACTGAAGTTTGG + Intronic
1147893432 17:43733719-43733741 TATGTGGGGTCTCTGAAGTGAGG + Intergenic
1149809085 17:59649680-59649702 TCTGTAGCCTGTCAGGAGAGAGG + Intronic
1150243807 17:63658434-63658456 TCTGTAGGGTGTCAGAAGTGGGG + Intronic
1151706238 17:75769592-75769614 ACTGTTGGGTGTCAGAGGTGAGG - Intergenic
1152307761 17:79531190-79531212 TCTGTGGGGACTGAGAAGTGGGG - Intergenic
1158815374 18:61088792-61088814 TATGTAGAATGTCAGAATTGTGG - Intergenic
1159719900 18:71875589-71875611 TCACTAGGATGACAGAAGTGTGG + Intergenic
1160579372 18:79874916-79874938 CCTGGAGGGTGTCAGGAGAGGGG + Intronic
1162544244 19:11318965-11318987 CATGTTTGGTGTCAGAAGTGTGG - Intronic
1164631446 19:29764415-29764437 TCAGTAGGGGCTCAGAGGTGAGG - Intergenic
1165612683 19:37169936-37169958 TCTGTAGGGTGTCTGAAGCTTGG + Exonic
1167520428 19:49951483-49951505 TGTGGTTGGTGTCAGAAGTGAGG + Intronic
1167799739 19:51732405-51732427 CCTCTTTGGTGTCAGAAGTGTGG - Intergenic
925170620 2:1748134-1748156 TCTGTAACCAGTCAGAAGTGTGG - Intergenic
925899125 2:8495921-8495943 TCTGAAAAGTGTCAGAAGTAAGG + Intergenic
928890240 2:36196190-36196212 TTGGTAGGGTTTCAGCAGTGAGG + Intergenic
931475892 2:62587082-62587104 TCTGGAAGGTGACAGCAGTGAGG - Intergenic
933873626 2:86595804-86595826 TCTGAAGGCTGAGAGAAGTGAGG + Intronic
934115757 2:88791516-88791538 TATTTAAGGTTTCAGAAGTGAGG - Intergenic
935137362 2:100319539-100319561 ACTGTAGGATGTTAGAAGTAAGG - Intronic
935587226 2:104812399-104812421 AATGTATGGTGTCAGAAGTCAGG + Intergenic
936039404 2:109138351-109138373 TCTGTAGGGAGAAAGTAGTGGGG + Intronic
937065898 2:119017404-119017426 TCTGGAGGGTGGCAGAGCTGTGG - Intergenic
940363353 2:152819423-152819445 GCTATAGTGTCTCAGAAGTGGGG + Intergenic
946446743 2:219746487-219746509 GCTGGTGGGTGGCAGAAGTGGGG + Intergenic
946622437 2:221573563-221573585 TCTGGAGGGAGTCAGAGGAGGGG - Intronic
1169054478 20:2609343-2609365 TCTGTAGGATGGGAGAACTGAGG + Intronic
1173193716 20:40896447-40896469 TCTGTAGGATCCCAGAAGTGGGG + Intergenic
1177643214 21:23870539-23870561 TCTGTAGGTGTTAAGAAGTGTGG - Intergenic
1179250557 21:39667964-39667986 TCAGAAGGTTGTCAGAGGTGTGG + Exonic
1182252250 22:29010251-29010273 GCTGTGGGGAGGCAGAAGTGAGG - Intronic
1183406648 22:37633485-37633507 TCTGTCCGTGGTCAGAAGTGGGG + Exonic
1185220796 22:49628205-49628227 TCTGTCGGGTGGCAGATGTGGGG - Intronic
949369647 3:3320309-3320331 TCTGAAGAGTTTAAGAAGTGGGG - Intergenic
951243512 3:20314228-20314250 TGTGGTTGGTGTCAGAAGTGAGG + Intergenic
953052158 3:39354351-39354373 AGAGTAAGGTGTCAGAAGTGTGG + Intergenic
955191946 3:56769825-56769847 TCTCTAAGGTGTCAGAAGCCAGG + Intronic
955546993 3:60041607-60041629 TCTCTGGGTTGACAGAAGTGGGG - Intronic
963707621 3:148708070-148708092 TCTTTAATGTGTCAGCAGTGGGG + Intronic
964012868 3:151911939-151911961 TGTATTTGGTGTCAGAAGTGAGG + Intergenic
965996884 3:174894267-174894289 TCTGTCCAGTGCCAGAAGTGGGG - Intronic
967649018 3:191962848-191962870 TGTGTCTGGTGTCTGAAGTGAGG - Intergenic
967711177 3:192710117-192710139 ACTGTAGGCTGTCAGACGTAAGG - Intronic
967775722 3:193384038-193384060 GCTGGTGGGGGTCAGAAGTGAGG + Intergenic
978319678 4:107479577-107479599 TCTCAAGGGAGTCATAAGTGTGG + Intergenic
978465317 4:109002535-109002557 GCTGGAGGGTGGCAGAAATGGGG + Intronic
978706326 4:111716826-111716848 GTTGTAGGGTGTGAGAGGTGCGG - Intergenic
978898526 4:113920668-113920690 TTTGGAGGCTGACAGAAGTGTGG + Intronic
979730379 4:124016819-124016841 TCTGGTGGGTGCCAGCAGTGTGG - Intergenic
980291662 4:130852829-130852851 CCTGCAGGGTCTCAGAAGTGGGG + Intergenic
981181950 4:141756281-141756303 GCTTTAGAGTGTCTGAAGTGGGG + Intergenic
982139730 4:152305920-152305942 TCTGCAGAGTGAGAGAAGTGGGG + Intergenic
986022537 5:3818476-3818498 TCTGCAGGTTGGCAGCAGTGAGG + Intergenic
986682156 5:10243678-10243700 TCTGAAGGCTGAGAGAAGTGAGG - Intronic
990748866 5:58990152-58990174 GCTGTATGGTGTCAGGAATGAGG + Intronic
992231100 5:74664699-74664721 TCTGAAGAGTGTCAGAAGGAGGG + Intronic
993596256 5:89859787-89859809 TCTGAAGGCTGAGAGAAGTGAGG - Intergenic
994184106 5:96799546-96799568 TTTGTAGGCTTTCAGAAGGGAGG - Intronic
997580441 5:135013513-135013535 TCTGTAAGGTGTGAGAAAAGAGG + Intergenic
999614512 5:153407730-153407752 TCTTTAGGGGATCAGAAGGGTGG + Intergenic
999864722 5:155688168-155688190 CCTGCAGGGAGTCAGAATTGGGG + Intergenic
1000206521 5:159065525-159065547 TCTGTAGGGTGTGAACACTGGGG - Intronic
1000831619 5:166109174-166109196 TATGAAGGGTGAGAGAAGTGAGG - Intergenic
1003998369 6:11567122-11567144 TAGGTAGGTTGTCAGGAGTGGGG - Intronic
1004411203 6:15383021-15383043 TGTGTAGGGAGACAGAAGGGAGG + Intronic
1007112280 6:39319924-39319946 ACTGGAGGTTGTCAGCAGTGGGG - Intronic
1007240332 6:40420264-40420286 TCTTCAGGGTCTCAGAGGTGGGG - Intronic
1008723168 6:54383032-54383054 GCTTTAAGGTGTCAGAAGTGTGG - Intronic
1011469925 6:87698235-87698257 CATGTGGGGTGTCAGCAGTGAGG - Intronic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1017417524 6:154236948-154236970 TCTGTAAGGAGTCAGAATTTAGG - Intronic
1017676162 6:156816426-156816448 TCCATTGGGTGTCAGAAGTTGGG + Intronic
1018894992 6:168008245-168008267 TCTGTATAGTGTAAGAGGTGGGG + Intronic
1019178535 6:170173494-170173516 TCTCTGGGGTGGCAGAGGTGGGG - Intergenic
1020026026 7:4900729-4900751 TCTGGTGGGTGGCAGAAGAGGGG - Intergenic
1023637334 7:42225763-42225785 TGTGTAGGGTGTTAGAATTCAGG - Intronic
1024908847 7:54421709-54421731 TGTGTTGAGTGTCTGAAGTGGGG - Intergenic
1025933185 7:66012721-66012743 TCTGTAGGGTGTTTGCAGTTTGG - Intergenic
1028102333 7:86836564-86836586 TCTGAATTGGGTCAGAAGTGAGG + Intronic
1031176023 7:118351517-118351539 TATGTATGGTGTCTGAAGTGGGG + Intergenic
1033524539 7:142197241-142197263 TTTGTAGGGTGGCAGAGATGGGG + Intronic
1037967077 8:23143289-23143311 TCTATAGTGTGGCAGATGTGTGG + Intronic
1042382314 8:68131097-68131119 TCTGAAAGCAGTCAGAAGTGTGG - Intronic
1042696532 8:71559070-71559092 TCAGTAGGGTCTTAGAATTGGGG + Intronic
1043827887 8:84951160-84951182 GCTGGAGGGTGTCAGGAATGAGG + Intergenic
1046795433 8:118366315-118366337 TCTGAGGTGTGACAGAAGTGTGG - Intronic
1047093068 8:121594791-121594813 TCTGTAGGGAGGCAGATATGCGG - Intergenic
1048631867 8:136251924-136251946 TTCCTAGGGTGTGAGAAGTGGGG + Intergenic
1049760013 8:144327685-144327707 TCTCCAGGATGTCAGAAGTCTGG + Intergenic
1050663020 9:7904420-7904442 TGTTTAGGGAGTTAGAAGTGGGG - Intergenic
1056140062 9:83668354-83668376 TCTGTAGTGTGTCAGGAATTTGG - Intronic
1056253480 9:84774339-84774361 TCTGTTGAGATTCAGAAGTGAGG - Intronic
1057798076 9:98172344-98172366 GGTGTGGGGTCTCAGAAGTGGGG - Intronic
1057798109 9:98172465-98172487 GGTGTGGGGTCTCAGAAGTGGGG - Intronic
1059716242 9:116915961-116915983 TGTGTCAGGTGTCTGAAGTGAGG + Intronic
1062222601 9:135425612-135425634 TATTTTGGGTGGCAGAAGTGGGG - Intergenic
1186553726 X:10534834-10534856 TCTGTAGGATGTCCCAAATGGGG - Intronic
1188743314 X:33811515-33811537 TCAGTGGGGTTTCAGAAATGAGG + Intergenic
1189646489 X:43138413-43138435 GCTGAAGGGTTTCAGGAGTGTGG + Intergenic
1190142585 X:47861158-47861180 TCTGATTGGTGTCTGAAGTGGGG + Intronic
1190668749 X:52719568-52719590 TATTTGTGGTGTCAGAAGTGGGG + Intergenic
1190670668 X:52738836-52738858 TATTTGTGGTGTCAGAAGTGGGG - Intergenic
1193910551 X:87301059-87301081 TATACATGGTGTCAGAAGTGAGG - Intergenic
1194364744 X:93001113-93001135 TCTGAAGGCTGACAGAAGTGAGG + Intergenic
1198789431 X:140327447-140327469 AATGTAGGGTGTGAGAAGGGAGG + Intergenic
1199542147 X:148968939-148968961 TCTGTAGTGTCACAGAATTGAGG - Intronic
1200672970 Y:6117374-6117396 TCTGACGGCTGACAGAAGTGAGG + Intergenic