ID: 1150244901

View in Genome Browser
Species Human (GRCh38)
Location 17:63667037-63667059
Sequence GACAGAGAGGTGCCTGCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150244901 Original CRISPR GACAGAGAGGTGCCTGCTTC TGG (reversed) Exonic
900983466 1:6059664-6059686 GAAAGAGAGGTGCTCGCTTGGGG + Intronic
902701321 1:18174502-18174524 GACAAAAAGCTGCCTGCTCCAGG + Intronic
902988103 1:20167846-20167868 GACAGAAGGGTGCCTGCTTTAGG - Intronic
904432073 1:30470752-30470774 GACAGAGATAAACCTGCTTCAGG + Intergenic
904570599 1:31461503-31461525 AACAGATTGGTTCCTGCTTCAGG - Intergenic
907312334 1:53546063-53546085 GACAGTGGTGTGCCTGCATCAGG + Intronic
909474812 1:76070954-76070976 GACAGCTAGATGCCTGCTTTAGG + Intergenic
911245042 1:95507629-95507651 AACAAAGAGGCACCTGCTTCAGG + Intergenic
911742365 1:101400956-101400978 GACTGAGATGTGACTGCTTTGGG - Intergenic
913071692 1:115304686-115304708 GCCAGAGGGGTGCCTCCTTCTGG - Intronic
914225177 1:145714151-145714173 GAGACAGAGGTGGCAGCTTCAGG - Intergenic
914677469 1:149916032-149916054 GACATAGGGGTCACTGCTTCTGG - Intronic
915400341 1:155617322-155617344 GAAAGAGAGATGCCTATTTCAGG - Intergenic
916293988 1:163196773-163196795 TAAAGAGAGGTGCCTGCTATGGG - Intronic
916530578 1:165652698-165652720 ACCAGACAGGTGCCTGCCTCAGG - Intronic
916808282 1:168281222-168281244 GCCAGAGAGGTGCATCCTCCAGG - Exonic
918799378 1:188953252-188953274 GACAGAGAGGGGGCTGCAGCAGG + Intergenic
919836212 1:201575239-201575261 GAGAGAGATGTGTCTTCTTCAGG + Intergenic
920380616 1:205532578-205532600 TACAGAGGGGAGCCTTCTTCAGG - Intronic
922933481 1:229407643-229407665 GCCTGAGGGGTGCCTGCTTTGGG + Intergenic
924178219 1:241414303-241414325 GAAAGGGAAGTGTCTGCTTCTGG + Intergenic
1064987531 10:21225998-21226020 CTCAGAGATGTGCCGGCTTCAGG - Intergenic
1065626428 10:27634195-27634217 AACAGAGAGGTGCCTGGACCAGG + Intergenic
1066632599 10:37471508-37471530 GAGAGAGAGGGGCCTGTTTATGG - Intergenic
1067746345 10:48939183-48939205 GGCAGAGTGGGGCCTGCTTCTGG - Intronic
1070290150 10:75108672-75108694 GACAGAGAGCCCCCTGTTTCTGG - Intronic
1071486603 10:86106563-86106585 TAGAGGGAGGAGCCTGCTTCAGG + Intronic
1072316444 10:94208023-94208045 GTCATAGAGGTGACTGATTCCGG + Intronic
1075054207 10:119206324-119206346 GACAGAGGGTTTCCTCCTTCTGG + Intergenic
1075510297 10:123066973-123066995 GAGAGAGAGGTCCCTTCTCCTGG - Intergenic
1075864256 10:125704255-125704277 GCCAGAGAGGTGCCTGCCCTGGG + Intergenic
1076300408 10:129421463-129421485 GACACAGAGGGGCCTGGTTCAGG - Intergenic
1076382743 10:130036486-130036508 CAGAGGGAGCTGCCTGCTTCTGG - Intergenic
1077061224 11:618724-618746 GGCTGAGAGGTTCCTGCCTCTGG + Exonic
1078154125 11:8784285-8784307 GACAGGGAGGTGCATGCCTGTGG + Intronic
1078244612 11:9562956-9562978 GACTGAGATGTGCCAGCTTCAGG - Intergenic
1081259941 11:40947413-40947435 AACAGAGATGTGCCTATTTCAGG + Intronic
1081491578 11:43573436-43573458 GGCAGAGAGGCGCCCTCTTCTGG + Intronic
1082616845 11:55371373-55371395 CCCAGAGAGAAGCCTGCTTCAGG - Intergenic
1083766122 11:64842404-64842426 GGCATAGAGGTGCCTGGTTGGGG + Intronic
1083913346 11:65723490-65723512 GAAAGAGAGGTGACTAATTCTGG - Intergenic
1085637557 11:78170199-78170221 GTCAGAGTGGTGCCTGCTGCTGG + Intergenic
1086399584 11:86449592-86449614 GACAGAGAGCAGGCTGCTTTTGG + Intronic
1088877076 11:113944912-113944934 GACTGAAGGCTGCCTGCTTCTGG + Intronic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1089771635 11:120807350-120807372 GACAGGGAAGCCCCTGCTTCTGG - Intronic
1091066294 11:132516358-132516380 GACAGAGTGCTTCCTGCATCTGG + Intronic
1091996344 12:4997071-4997093 GAAAGAAAGGAGCTTGCTTCAGG + Intergenic
1092159841 12:6310353-6310375 GAGAGAGGGGTGCCTGCCACAGG + Intergenic
1092238909 12:6825811-6825833 GACAGCAGGGTGCCTGCTTAGGG - Intronic
1092670245 12:10853985-10854007 GCCAGAGAGCTGCCTGCTAGTGG + Intronic
1099948979 12:89278829-89278851 GCTAGAGAGGGGCATGCTTCTGG - Intergenic
1100818033 12:98404673-98404695 GGAAAACAGGTGCCTGCTTCTGG + Intergenic
1101591960 12:106132723-106132745 AGAAGAGATGTGCCTGCTTCTGG - Intronic
1102513523 12:113431374-113431396 GCCAGAGAGGAGGCTGCTTGGGG + Intronic
1102595562 12:113990071-113990093 AACAGAGATGAGCCTGTTTCTGG + Intergenic
1102877658 12:116460311-116460333 GAAACAGAGGAGCCTGCTCCAGG + Intergenic
1103342431 12:120228267-120228289 GAGAGAGAGCTTCCTCCTTCAGG - Intronic
1103809872 12:123604868-123604890 AACAGTGAGGACCCTGCTTCAGG - Intronic
1106903215 13:34376954-34376976 GAAAGAGAGGTGAGTGTTTCAGG + Intergenic
1107418166 13:40220437-40220459 GCCAGTGTGGTGCCTGCCTCGGG - Intergenic
1108257626 13:48625974-48625996 GAGAGATAGGTGCCTCCTTATGG + Intergenic
1114985036 14:28216792-28216814 GTCACAGAGGTGCTTGCATCGGG - Intergenic
1119920406 14:78441040-78441062 CACAGAGAGGTGCAGCCTTCAGG - Intronic
1121729361 14:96175671-96175693 GACAGCGAAGTGGCTGCTGCTGG + Intergenic
1122818105 14:104323970-104323992 GACAGACAGCTACCTGCTCCTGG + Intergenic
1124577522 15:30923003-30923025 GACAGGGAGGGGCCTGCTGGCGG - Intronic
1126808371 15:52376451-52376473 AACTGAGAGCTGCCTGCATCCGG - Exonic
1127509425 15:59625403-59625425 GACAGGTGGGTTCCTGCTTCAGG - Intronic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1128972704 15:72121591-72121613 GACATAGTGGTGCCTGCCTGTGG + Intronic
1132559592 16:587343-587365 GACAGAGGGGTGCCATCCTCTGG - Intergenic
1134111442 16:11517738-11517760 GGCAGAAAGGTGCCTGGGTCTGG + Intronic
1135611359 16:23870614-23870636 GCCAGAGTGGTAGCTGCTTCAGG + Intronic
1135623260 16:23974282-23974304 GACAGAGAGGTGTGGGGTTCAGG + Intronic
1135627426 16:24008288-24008310 GGAAGAAAGCTGCCTGCTTCAGG - Intronic
1140406208 16:74713381-74713403 CACTGAGAGGTGGCTCCTTCTGG + Exonic
1140652871 16:77107442-77107464 AACAAAGAGGTATCTGCTTCAGG + Intergenic
1141877650 16:86837068-86837090 AGCAGAGAGGGGCCTGCTTGTGG - Intergenic
1142864681 17:2783365-2783387 GACAGACAGGTCCCTGCTCTAGG - Intronic
1143185660 17:5008553-5008575 AACAGAGAGGAGCCTTCTTCTGG - Intronic
1143737854 17:8926280-8926302 GACAGAGAGGCAACTGCTTTGGG + Intronic
1144640037 17:16931936-16931958 GACAGAGAGGGGGCTGGGTCAGG - Intronic
1147443711 17:40462464-40462486 GACAGAGAGGTTCCTGCACTGGG + Intergenic
1148156476 17:45427743-45427765 GCCAGAGAGCTGCCTGTCTCTGG + Intronic
1148736548 17:49868400-49868422 GACAGAGAGGTGGTGGCTGCAGG + Intergenic
1148837038 17:50470728-50470750 CACAGACAGGTGGCTGCTCCAGG + Intronic
1149137587 17:53387912-53387934 GACATATAGTTGCCTGCTTAGGG - Intergenic
1149796137 17:59521744-59521766 GACTGAGAGTTTGCTGCTTCAGG - Intergenic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1150514058 17:65789079-65789101 CACAGAGAGGTGTCTGGATCTGG - Intronic
1150988967 17:70232841-70232863 AACAGAGAGATTCCAGCTTCTGG + Intergenic
1151675278 17:75594435-75594457 GACAGGGAGATCTCTGCTTCAGG - Intergenic
1152259383 17:79258825-79258847 GACAGAGAGGGTCCTGCACCTGG + Intronic
1152995027 18:398584-398606 GACAGTCAGTTGCCTGCATCAGG - Intronic
1156931222 18:42646483-42646505 GAGAGAGAGGTGCTTGTTTCTGG - Intergenic
1158517515 18:58143022-58143044 AGCAGACAGGTGCCTGCTGCAGG + Intronic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1161101518 19:2424216-2424238 GGCAGAGAGGTGGCTGCTGTCGG + Exonic
1162013633 19:7831935-7831957 AACAAAGAGCTGCCTGCTTCTGG - Intronic
1162207604 19:9067425-9067447 GGCAGAGAATTGCCTGCATCAGG + Intergenic
1164452610 19:28379970-28379992 GACTTAGAGATGCCTTCTTCTGG - Intergenic
1165521328 19:36316618-36316640 GAAAGTGAGGGGCCTGCATCTGG + Intergenic
1165622733 19:37261970-37261992 GAAAGTGAGGGGCCTGCATCTGG - Intergenic
1165634432 19:37328605-37328627 GAAAGTGAGGGGCCTGCATCTGG - Intronic
1166062918 19:40337937-40337959 TAGTTAGAGGTGCCTGCTTCTGG - Intronic
1166301209 19:41913081-41913103 GACAGAGCGGTGCCTGCGGGAGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
930008823 2:46918983-46919005 GACAGAGAGGTGGCTTTATCAGG + Intronic
930018606 2:46987242-46987264 GTCAGAAAGGTGCCCCCTTCTGG - Intronic
931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG + Intronic
934122219 2:88851167-88851189 GACAGAGAAATTCTTGCTTCGGG - Intergenic
935269764 2:101423815-101423837 AACACAGTGGTGCCTGTTTCCGG - Intronic
936114670 2:109692266-109692288 GGCAGAGAGGGGGCTGCCTCAGG + Intergenic
937274110 2:120673201-120673223 GAGAGAGTGGTGGCTGTTTCAGG + Intergenic
937450688 2:122000080-122000102 GTCAGAGAGTTCCATGCTTCTGG - Intergenic
940064631 2:149613200-149613222 GACAGAGACTTGGCTGCTACTGG + Intergenic
943086346 2:183316496-183316518 GAGAGAGAGGTGACTGAGTCAGG + Intergenic
944131925 2:196356105-196356127 GACAGGCAGGGGCCAGCTTCCGG + Intronic
945465662 2:210168272-210168294 GGCAGAGAGCTGCTTTCTTCAGG - Intronic
947247963 2:228071044-228071066 GACAATGAGGTCCCTTCTTCTGG - Intronic
948204933 2:236158666-236158688 GCCAGAGAGGCGTCTGCTCCTGG - Intergenic
1169381398 20:5110619-5110641 GACAGAGAGGTGGGCGCTTCTGG - Intronic
1174051203 20:47768760-47768782 GACCGAGCAGGGCCTGCTTCAGG - Intronic
1175058379 20:56218943-56218965 GACAAAGAGTTGCATTCTTCTGG + Intergenic
1176252220 20:64130915-64130937 GACAGAGGCATGCCCGCTTCTGG + Intergenic
1179284142 21:39962147-39962169 GACAGAGAGACTTCTGCTTCAGG - Intergenic
1180248398 21:46563490-46563512 GACAGACATGTGCCTCCTGCAGG + Intronic
1180966223 22:19789229-19789251 GACAGGGAGGTCCCAGCTGCAGG + Intronic
1181534304 22:23533817-23533839 TACAGAGAGATGACTGCTTTGGG + Intergenic
1183491866 22:38121075-38121097 GACAGAGAGAAACCTCCTTCCGG + Intronic
1184231030 22:43158548-43158570 GACAGAGAGCAGCCTGCCTGGGG - Intronic
952651289 3:35729768-35729790 GACAGAAAAGTGGATGCTTCTGG - Intronic
952849826 3:37718796-37718818 CACACAGAGGGGCCTGCATCTGG + Intronic
954370283 3:50166560-50166582 GGCAGACAGGTGCATGCTTGGGG - Intronic
955999058 3:64709423-64709445 GAAAAAGGGGTACCTGCTTCAGG + Intergenic
959069060 3:101686161-101686183 GACAGGGTGGTGCGTCCTTCTGG + Intronic
961378435 3:126482139-126482161 GACAGAGAGCTGCATGTCTCTGG + Exonic
962061147 3:131929068-131929090 GAGAGAAATGTCCCTGCTTCTGG + Intronic
965599975 3:170444873-170444895 GGCAGAGAAGTGCCATCTTCAGG + Intronic
965698701 3:171437620-171437642 GGCAGAGAAGGGCCTGCCTCTGG - Intronic
967192969 3:187001014-187001036 GGCAGAAAGGTGCCTTCCTCGGG + Intronic
967478334 3:189946246-189946268 AACAGAGAGGTAGCTGCCTCAGG + Intergenic
969487442 4:7480187-7480209 CACAGACATGTCCCTGCTTCAGG - Intronic
971017572 4:22504612-22504634 GACAGAGAGCTGAGAGCTTCAGG - Intronic
973114255 4:46436081-46436103 GACACATAGGTTCCTGCTTAGGG - Intronic
979295426 4:119027254-119027276 GACAGAAGGGTGCAGGCTTCAGG + Exonic
980400947 4:132285003-132285025 AAAAGAGAGTTGCCTGCTGCAGG - Intergenic
983194974 4:164797019-164797041 CACAGAGGGGTTCCTGCTTTAGG + Intergenic
985003829 4:185512933-185512955 GACACAGAGCTGCCAGCATCGGG + Intronic
985070472 4:186162573-186162595 GAGAGAGAGGTTCCTGCACCCGG - Intronic
985611734 5:893019-893041 CACAGGGAAGCGCCTGCTTCAGG - Exonic
986731430 5:10637499-10637521 GAGAGAGAGACTCCTGCTTCTGG + Intronic
987100127 5:14583507-14583529 GGCAGAAAGGTGCCTTCTCCAGG + Intronic
988724202 5:33909556-33909578 GAGAGAGAGGATCCTGGTTCCGG - Intergenic
989820941 5:45795530-45795552 TACAGAGAGGGTCCAGCTTCAGG - Intergenic
990741784 5:58919812-58919834 GACAGAGAAGTACCTGGTCCTGG + Intergenic
991113932 5:62931480-62931502 GACAGATAGGTGGATGTTTCAGG + Intergenic
993872351 5:93267786-93267808 CACAGATAGGTTCCTGCTGCTGG + Intergenic
994734100 5:103531072-103531094 CACAGGCAGGTGCCTGCTTGAGG - Intergenic
995044977 5:107635431-107635453 GACACAGAGCTGGCTGCCTCTGG + Intronic
995534260 5:113119545-113119567 AACAGGGCGGTCCCTGCTTCTGG - Intronic
995972431 5:117988811-117988833 CACAGAATGCTGCCTGCTTCTGG + Intergenic
996598865 5:125237915-125237937 GACTAAAAGGTACCTGCTTCTGG + Intergenic
997023691 5:130032722-130032744 GAGAGAGAGGTGTATGCTTTGGG + Intronic
999284562 5:150386496-150386518 AACAGAAAGGTGCCTGCCTGAGG - Intronic
999732308 5:154483831-154483853 CACAGAGAGATGTCTGCTTCGGG + Intergenic
1006824904 6:36927814-36927836 GACAGGGAAATGCCTGCTGCTGG - Intronic
1006910452 6:37560065-37560087 CCCAGAGAGGTGGCTGCTACGGG - Intergenic
1007203481 6:40130765-40130787 ACCATAGAGGTGCCTGCCTCAGG - Intergenic
1009039359 6:58158409-58158431 GACTGAGATGTGCTGGCTTCAGG - Intergenic
1009215255 6:60913252-60913274 GACTGAGATGTGCTGGCTTCAGG - Intergenic
1014950559 6:127549690-127549712 CACAGAAAGGTGACTGCTTGAGG + Intronic
1016616224 6:146051652-146051674 GACAGAGTAGTGCCTGCAGCGGG + Intronic
1016623820 6:146143008-146143030 GACTGAGATGTGCTGGCTTCGGG - Intronic
1017382165 6:153843786-153843808 CAGATAGAGGTGCCTGCCTCTGG + Intergenic
1017872803 6:158501535-158501557 GACAGAGACGTGTCTGCTTGGGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1022517674 7:30986478-30986500 GACAGAGAGGAGCAAGCTTTTGG + Intronic
1023315426 7:38931209-38931231 AACAGAGAGGCGCTTGATTCTGG - Intronic
1023854822 7:44176335-44176357 GGCTGAGAGCTGCCTGCCTCTGG + Intronic
1024088264 7:45914965-45914987 GACAGAGAAGTGAATGCTCCTGG + Intronic
1024544452 7:50505704-50505726 GACAGAGCGATGCCTGCTCAGGG + Intronic
1027520271 7:79198111-79198133 GGCAAAGTGGTGCATGCTTCTGG + Intronic
1029696500 7:102217153-102217175 GACACAGATGGCCCTGCTTCAGG - Intronic
1030269331 7:107653597-107653619 GACAGAGTGTTCCCTGCTGCAGG - Intergenic
1031481983 7:122289166-122289188 GACAGTGAGGTGATTCCTTCAGG - Intergenic
1031546239 7:123053965-123053987 CTCAGAGATGTGCTTGCTTCAGG - Intergenic
1038489294 8:27958323-27958345 GAGACAGAGGTGCCTTCTGCAGG + Intronic
1039542271 8:38382103-38382125 GCCAGAGAGGAGCCTGCGGCTGG + Exonic
1040834218 8:51715567-51715589 GTCAGTGAGGTGCCTGTTTATGG - Intronic
1042250332 8:66750381-66750403 GACAAATAGGTGCCTGGCTCAGG - Intronic
1044866081 8:96572468-96572490 AGCAGAGAGGTGCCTGCATTCGG + Intronic
1049038280 8:140093781-140093803 GAGACAAAGGTGCCTGCTTGAGG + Intronic
1049398745 8:142415360-142415382 GACAGAGAGGGGCCTGGGGCAGG + Intergenic
1050904517 9:10986987-10987009 TTCAGAGAGGAGCCTGCTGCAGG - Intergenic
1050910796 9:11067088-11067110 GACAGAGCCGTGCCTACTGCAGG + Intergenic
1051404435 9:16720178-16720200 GAGAGAGAGGTGCCACCCTCAGG - Intronic
1056557110 9:87698628-87698650 GGCAGAGAGGGAACTGCTTCAGG - Intronic
1056571635 9:87821541-87821563 GAGAGACAGGTGCCAGCATCTGG + Intergenic
1059161320 9:112037896-112037918 AACAAAGCAGTGCCTGCTTCTGG - Intergenic
1059324062 9:113492799-113492821 TAGAGAGAGGTTCCTGCTTATGG + Intronic
1061834244 9:133318313-133318335 GATAGAGAGGGGCCTTCTCCAGG + Intergenic
1062043689 9:134415586-134415608 CCCAGAGAGGTGGCAGCTTCAGG + Intronic
1062238051 9:135522025-135522047 GATAGAGAGGGGCCTTCTCCAGG + Exonic
1185919923 X:4080334-4080356 GACAGAGAGCTGCATGAATCAGG - Intergenic
1186100594 X:6152088-6152110 GACATAGTGGTGCATGCTTGTGG - Intronic
1186146855 X:6633239-6633261 GACAGAGAAATGCCAGTTTCAGG + Intergenic
1189285313 X:39848067-39848089 CACAGAGAGCTGCCTGTGTCAGG + Intergenic
1189288082 X:39866348-39866370 GGGAGAGAGCTGCCTGCCTCAGG - Intergenic
1191652586 X:63557193-63557215 GACAGAGAAGTGCCCTATTCCGG + Intergenic
1192436822 X:71148288-71148310 GACAGACAGATGCATGCTGCAGG - Intronic
1193169047 X:78315291-78315313 GACACAGAGCTGCTGGCTTCAGG + Intronic
1194052922 X:89094325-89094347 GAGAGGGAAGTGTCTGCTTCTGG - Intergenic
1196130095 X:112146254-112146276 GAGAGAAAGGTGCCTGTTTTTGG + Intergenic
1196257214 X:113534768-113534790 GTCTTAGAGTTGCCTGCTTCTGG - Intergenic
1196619592 X:117807012-117807034 CTCAGAGATGTGCTTGCTTCAGG + Intergenic
1197673517 X:129304623-129304645 GACAGTGAAGTGATTGCTTCAGG + Intergenic