ID: 1150246195

View in Genome Browser
Species Human (GRCh38)
Location 17:63677339-63677361
Sequence TTGGTAGTCCACAAGTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150246195_1150246197 2 Left 1150246195 17:63677339-63677361 CCATAGAACTTGTGGACTACCAA 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1150246197 17:63677364-63677386 TGTCATCCAAAGCTAAAAGTAGG 0: 1
1: 0
2: 1
3: 8
4: 150
1150246195_1150246200 16 Left 1150246195 17:63677339-63677361 CCATAGAACTTGTGGACTACCAA 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1150246200 17:63677378-63677400 AAAAGTAGGAAGCAGGCAGTAGG 0: 1
1: 0
2: 2
3: 37
4: 415
1150246195_1150246199 9 Left 1150246195 17:63677339-63677361 CCATAGAACTTGTGGACTACCAA 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1150246199 17:63677371-63677393 CAAAGCTAAAAGTAGGAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150246195 Original CRISPR TTGGTAGTCCACAAGTTCTA TGG (reversed) Intronic
905910884 1:41653489-41653511 TTTGTAGACCACAAGTGCCATGG - Intronic
906368520 1:45232331-45232353 TTTTTATGCCACAAGTTCTATGG + Intronic
906945221 1:50289256-50289278 TTGGTAGTCCCCATGGTCTCAGG - Intergenic
908846780 1:68332746-68332768 TTCCTAGTCAACAAGTTCTGGGG + Intergenic
911740853 1:101385479-101385501 TTTGTATTACACAAGTTTTAGGG + Intergenic
913999579 1:143681622-143681644 ATGGTAGTCCACAGTGTCTACGG + Intergenic
915793973 1:158706746-158706768 TTGGCAGTCCACAGGTGATATGG + Intergenic
918265143 1:182835463-182835485 TTGTTAATCTACAAGTTCTATGG - Intergenic
921987522 1:221328147-221328169 TTGGGAGGACACAAGTTCAATGG + Intergenic
1066808643 10:39293878-39293900 TTGGGAGTCCACGAGGCCTATGG - Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1078348159 11:10569989-10570011 TTGGTATTCCAGAAATTCTATGG - Intronic
1081711016 11:45215400-45215422 TGGGTAGTCCTCCATTTCTATGG - Intronic
1086676458 11:89613755-89613777 TTGGTAGTCCCCATGTTTTCTGG + Intergenic
1087211059 11:95446847-95446869 TTGGGAGTCCCCAAGCTCTGTGG + Intergenic
1087511334 11:99099033-99099055 TTTGTAGTCCATCTGTTCTAAGG - Intronic
1090591090 11:128269940-128269962 TTGGTGGTCCATAACTTCCAAGG + Intergenic
1095072630 12:37873641-37873663 TTGGGAGTGCACAAGTCCTATGG - Intergenic
1095074787 12:37905260-37905282 TTGGGAGTGCACGAGGTCTATGG - Intergenic
1101842217 12:108336139-108336161 TTGGTAGTTCTCAAGTTTTGGGG + Intronic
1102979708 12:117231781-117231803 CTGGTCTTCCACCAGTTCTAAGG - Intronic
1109234371 13:59797203-59797225 TTAGAAGTCCACAACTTATAAGG - Intronic
1114442561 14:22761834-22761856 ATGGTATTCCACAAGTTCCTTGG - Intergenic
1117131530 14:52692154-52692176 TTGGTGCTCAACAAGTCCTAGGG - Intronic
1118047871 14:61992049-61992071 CTGGGAGTCCACAAGTGCTAGGG - Intergenic
1120322727 14:82985720-82985742 TTGGTAGGACACAATTTCCAAGG + Intergenic
1121756577 14:96408051-96408073 TTGGTAATCAACAACTTGTAGGG - Intronic
1130007438 15:80113425-80113447 TTGCTAGTTCACAACTTCTTTGG + Intronic
1148882822 17:50743922-50743944 TTTGTAGCCCACAAGGTCTGTGG + Intronic
1149506198 17:57195852-57195874 TATGAAGTCCACAAGTTCTTTGG - Intergenic
1150246195 17:63677339-63677361 TTGGTAGTCCACAAGTTCTATGG - Intronic
1151046849 17:70930273-70930295 TTGGCAGTCCACAATTTTTCAGG - Intergenic
1165507093 19:36240475-36240497 TTGAGAGTCCACAAATGCTATGG + Intronic
1168070535 19:53947954-53947976 TAGGAAGTCCACAAGGTCAAAGG + Intergenic
1168440736 19:56364500-56364522 TTGGTAGTGAACATGTTATATGG + Intronic
927014324 2:18941667-18941689 TTATTATTCCAAAAGTTCTAGGG - Intergenic
937539762 2:122934948-122934970 ATGGGAGTACACAAGTTCCAGGG + Intergenic
940787381 2:157996391-157996413 TAGGGAGTAAACAAGTTCTAGGG - Intronic
1171469760 20:25360928-25360950 TTCGTAGTCCAAACCTTCTATGG - Intronic
1181491260 22:23262265-23262287 TCGGTAGTCCAGAAGTGCTGGGG - Intronic
1183576604 22:38694481-38694503 TTTGTAGCCCAGAATTTCTATGG - Intronic
950986324 3:17372194-17372216 TTGCTAGACCACAAGATTTAGGG - Exonic
956322234 3:68009430-68009452 TTGATAATACACAAATTCTAAGG - Intronic
960794706 3:121473184-121473206 TTGGTAGCCCACAAATTCTGTGG - Intronic
963119573 3:141764714-141764736 TGAGTAGTCTACAAGATCTATGG - Intergenic
967534664 3:190588476-190588498 TTGGGAGTCCAAAAGTCCTCAGG + Intronic
984189439 4:176587885-176587907 TTGTTAGACTAAAAGTTCTAAGG + Intergenic
987599195 5:20043456-20043478 CTTCTGGTCCACAAGTTCTATGG - Intronic
989839994 5:46052462-46052484 TTGGCAGCACACAAGTCCTATGG + Intergenic
989840028 5:46052976-46052998 TTGGGAGTGCACGAGATCTATGG + Intergenic
996802388 5:127418224-127418246 TTGGTAGTACATAAGTTTTTAGG + Intronic
998825450 5:146096775-146096797 TTGGTAGTCACCCAGTACTAAGG - Intronic
999478586 5:151924567-151924589 TTTGTAGTCCACGAGTTATGGGG + Exonic
1001731187 5:173960878-173960900 TTGGTAGTCCACATGATTAATGG - Exonic
1004241643 6:13928159-13928181 TTGGTAAGCCACAAGTGCTTGGG + Intronic
1005319135 6:24634913-24634935 ATGGTAATCCACATGTTCCAAGG + Intronic
1007631730 6:43276614-43276636 TTGGTAGTACACAAGCTCTCCGG - Intronic
1008765183 6:54904326-54904348 ATGATCTTCCACAAGTTCTAAGG + Intronic
1010851048 6:80778409-80778431 TTTGTAGTGCACAAGTTTTTTGG - Intergenic
1014690865 6:124561803-124561825 TTAATAGTCCACAAGTGCAAAGG - Intronic
1020973885 7:14981915-14981937 TTGGTAGTCCACACTGTCTATGG + Intergenic
1022512523 7:30949493-30949515 TTGGTCATCCACAAATCCTAGGG - Intronic
1024636598 7:51295730-51295752 TAGGTTGGCCACAAGTTCTTGGG - Intronic
1031954968 7:127933786-127933808 TGGGTAGGTCACAATTTCTATGG - Intronic
1047912773 8:129548494-129548516 TTTGCAGTTGACAAGTTCTAAGG + Intergenic
1055061811 9:72076630-72076652 TTCCTATTCAACAAGTTCTATGG + Intergenic
1056797096 9:89666146-89666168 TTGGTTGTCCACAAGATCATTGG + Intergenic
1186599121 X:11017672-11017694 TTGGAAATCTACAAGTTCTTTGG - Intergenic
1191942449 X:66495842-66495864 TTGAGAGTCCATAAGTTGTATGG - Intergenic
1195277053 X:103292056-103292078 TTGGTAGTCCACACTGTCTGTGG + Intergenic
1196542140 X:116922404-116922426 TTGGTACTGAACAAGTCCTAAGG - Intergenic