ID: 1150246960

View in Genome Browser
Species Human (GRCh38)
Location 17:63683387-63683409
Sequence CAGCTGTTCTAGGGGTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150246952_1150246960 14 Left 1150246952 17:63683350-63683372 CCTTTCTGGTTTCTCTAACCAGG 0: 1
1: 0
2: 1
3: 23
4: 182
Right 1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG 0: 1
1: 0
2: 1
3: 10
4: 160
1150246951_1150246960 18 Left 1150246951 17:63683346-63683368 CCATCCTTTCTGGTTTCTCTAAC 0: 1
1: 1
2: 2
3: 37
4: 454
Right 1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG 0: 1
1: 0
2: 1
3: 10
4: 160
1150246956_1150246960 -4 Left 1150246956 17:63683368-63683390 CCAGGGCACTTCTGGACATCAGC 0: 1
1: 0
2: 2
3: 14
4: 163
Right 1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG 0: 1
1: 0
2: 1
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150246960 Original CRISPR CAGCTGTTCTAGGGGTGACT TGG Intronic
904983838 1:34528239-34528261 CAGCTGTTCTAGGAGGAACTGGG + Intergenic
905936467 1:41827971-41827993 GAGCTGTCCTAGGAGTGACAAGG - Intronic
907092882 1:51745217-51745239 CTGTTGTTCTAGTGGTGACTGGG + Intronic
908118846 1:60966639-60966661 AAGGTGTTCAAGAGGTGACTTGG - Intronic
909277081 1:73700257-73700279 CAAATGTTCTAGGTGTGAATAGG - Intergenic
909820389 1:80053194-80053216 CAGCTAATCTAGTGGGGACTTGG - Intergenic
910895722 1:92067162-92067184 CAAATGCTCTAGGGGTGCCTGGG + Intergenic
913364610 1:118023019-118023041 CTGCTGTTTTAGGGTTGACTGGG - Intronic
914444165 1:147735671-147735693 CAGCTGTACTTGTGGTGACAGGG + Intergenic
918154693 1:181833195-181833217 CAGCTAATCTAGTGGGGACTTGG + Intergenic
918154704 1:181833314-181833336 TAGCTGATCTAGTGGGGACTTGG + Intergenic
918253116 1:182722576-182722598 CAGCAGTCCTCGGGGTTACTTGG + Intergenic
919880211 1:201896028-201896050 CAGCTGCTCCAGGGGTGCCCTGG - Intergenic
923648411 1:235847345-235847367 CAGTTCTTCTAGTGGTGGCTTGG - Intronic
923661805 1:235963724-235963746 CAGTTCTTCTAGTGGTGGCTTGG - Intergenic
924306034 1:242689995-242690017 CAGCTAATCTAGTGGGGACTTGG + Intergenic
1065733926 10:28734233-28734255 CAGCAGCTCTAGGGGTGAGGTGG - Intergenic
1067722387 10:48738552-48738574 CTGCTGCTCTAGGGGGCACTTGG + Intronic
1069325464 10:67226692-67226714 CAGTTGTTGTAGTGGTGGCTTGG - Intronic
1071857600 10:89641943-89641965 CAGCAGTTCAAGATGTGACTTGG + Intronic
1074881566 10:117663446-117663468 CAGCTGTTCTTGGGGGCTCTTGG + Intergenic
1078919597 11:15817233-15817255 CAGCTGATCTCAGGGTTACTGGG - Intergenic
1081807510 11:45898616-45898638 GAGCTATTCCAGGGGTGCCTTGG - Intronic
1084050202 11:66594387-66594409 CAGCTGGTCTGGAGGTGACCTGG + Intronic
1084186747 11:67476673-67476695 CAGCTGCTCTGGTGGGGACTTGG + Intergenic
1085452039 11:76639991-76640013 CAGCTGTTCATGAGGTGCCTGGG + Intergenic
1089063407 11:115644307-115644329 CAGCTTCTCTAGGGGTGAATAGG + Intergenic
1093598157 12:20986996-20987018 CAGCTATTGTAGTGGTGACCTGG + Intergenic
1095642483 12:44501002-44501024 TAGCTGTTCTAGTGGGGACTTGG + Intergenic
1095642489 12:44501121-44501143 TAGCTATTCTAGTGGGGACTTGG + Intergenic
1096473043 12:51890785-51890807 CAGCCGTTCTAGGAGTGAAGGGG - Exonic
1098960695 12:76737346-76737368 CAGTTGTTGTAGTGGTGATTTGG + Intergenic
1099413613 12:82361196-82361218 TAGCTGATCTAGTGGGGACTAGG - Intronic
1100347774 12:93748947-93748969 CAGCTATTCTAGGATTGACATGG + Intronic
1100929191 12:99586185-99586207 AAACTGTTCAAGAGGTGACTTGG - Intronic
1101714256 12:107296739-107296761 CAGCTGTTCTGGGTGTGGCTGGG + Intergenic
1102916551 12:116758515-116758537 CAGTTCTTATAGTGGTGACTTGG + Intronic
1103743770 12:123108536-123108558 CAGCTTCTCCAGGGGTCACTCGG - Intronic
1106414363 13:29534065-29534087 CAGCTGCTTTGGGGGTGACAGGG - Intronic
1107274582 13:38663669-38663691 TAGCTGTTCTAGGTGGGAATGGG + Intergenic
1109233438 13:59786986-59787008 CAGCTACTCAAGGGGTGACGTGG + Intronic
1115958723 14:38810633-38810655 CAGTTGTTGTAGTGGTGGCTTGG - Intergenic
1116335677 14:43653074-43653096 CAGTTCTTGTAGTGGTGACTTGG - Intergenic
1117020522 14:51565731-51565753 CAGCAGTTCTAGAGGTGGCGAGG + Intronic
1117189221 14:53274620-53274642 CCTCTGTTATATGGGTGACTAGG + Intergenic
1122090028 14:99331809-99331831 CATCTGTTCAAGGGGTCGCTAGG + Intergenic
1122287512 14:100660344-100660366 GGGCTGTTCTAGGGGTCTCTGGG + Intergenic
1122988124 14:105221997-105222019 CAGCCGTTCTATGGGTTACCTGG - Intronic
1124421552 15:29527380-29527402 CAGCTGATCGTGGGGTGGCTGGG - Intronic
1124557311 15:30737924-30737946 CAGTTCTTCTAGTGGTGGCTTGG - Intronic
1124673954 15:31667823-31667845 CAGTTCTTCTAGTGGTGGCTTGG + Intronic
1125804710 15:42483460-42483482 CAGCTGTTCATGAGGTGGCTCGG + Intronic
1127110001 15:55658708-55658730 CAACTTTTCTAGGGGTAATTGGG - Intronic
1129199919 15:73992497-73992519 CAGCTTTTCTAGGGCTGAGTAGG - Intronic
1129970247 15:79772123-79772145 CAGCTGTTCTCTGTGTAACTAGG - Intergenic
1129978678 15:79846358-79846380 CAGCTGTCCTGGGGGTTTCTGGG + Intronic
1134247063 16:12547879-12547901 CAGCAGTTCTAGGGCTGTATAGG + Intronic
1139747116 16:69083570-69083592 CAGCTCTTCTAGGGCCAACTGGG - Exonic
1142138110 16:88460854-88460876 CAGCTGTTCATGGGGCCACTGGG + Intronic
1142431810 16:90032626-90032648 CAGGTGTGCTATGGGTGACCAGG + Intronic
1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG + Intronic
1150815129 17:68386660-68386682 CTGCTTTTATAGGGCTGACTTGG + Intronic
1150818593 17:68416204-68416226 CAGTTCTTGTAGTGGTGACTTGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157661947 18:49453180-49453202 TAGCTAATCTAGGGGGGACTTGG + Intronic
1160375229 18:78406348-78406370 CAGCTGTTCTAGGGGGGATTTGG - Intergenic
1160551254 18:79694968-79694990 CAGCTGTTCCACGGGTGGCACGG + Intronic
1165586127 19:36917150-36917172 CAGCTGATCTAGGTGGGGCTTGG + Intronic
925686742 2:6481049-6481071 CAGCTGATCTAGGAGTTACCTGG - Intergenic
926080956 2:9986064-9986086 GAGCTGTGCTAGGTTTGACTTGG + Intronic
927217739 2:20677983-20678005 CAGCTGGGCTTGGGGTGAGTAGG + Intergenic
929397673 2:41542005-41542027 GAGCTGTTGTAAGGGTGAGTAGG - Intergenic
929581995 2:43087133-43087155 AAGCTGCTCTAGGGCAGACTTGG + Intergenic
929981143 2:46681557-46681579 AAGATGTTCCAGGGGTGACCTGG - Intergenic
930235786 2:48887807-48887829 CAGCTGTTGTAGGGGGGAAAAGG + Intergenic
930585138 2:53259479-53259501 TAGCTGATCTAGTGGGGACTTGG - Intergenic
932131943 2:69195473-69195495 TAGCTGTTCTTGCTGTGACTAGG + Intronic
932752354 2:74379469-74379491 CTGCTGTTCCAGGTGTGATTTGG - Intronic
932779313 2:74549937-74549959 CAGGTGCCCCAGGGGTGACTAGG + Intronic
935060160 2:99600441-99600463 CAGCTTTTATAGCGGTGCCTTGG - Intronic
937781801 2:125847347-125847369 CAGTTCTTATAGTGGTGACTTGG + Intergenic
937789348 2:125942710-125942732 CAGCTAATCTAGTGGGGACTTGG - Intergenic
947977047 2:234375818-234375840 CAGCCGTGCTGGGGGGGACTCGG + Intergenic
948013783 2:234671422-234671444 GAGCTGAGCTGGGGGTGACTGGG - Intergenic
948924810 2:241088686-241088708 CAGCTGATCTAGGGGTTTCTTGG - Exonic
949026843 2:241770341-241770363 CTGCTGGCCCAGGGGTGACTTGG + Intergenic
1169630117 20:7622072-7622094 TAGCTAATCTAGGGGAGACTGGG - Intergenic
1170565949 20:17605336-17605358 CAGCTGTAGAAGGGGAGACTTGG + Intronic
1174164403 20:48574623-48574645 CAGCTGCTTTTGGAGTGACTTGG - Intergenic
1174624271 20:51901366-51901388 CAGCTTATCTAGGAGTGCCTTGG - Intergenic
1175731587 20:61357898-61357920 TCGGTGTTGTAGGGGTGACTGGG - Intronic
1176269071 20:64226107-64226129 CAGCTGTTCAAGTGGCCACTTGG - Intronic
1179180336 21:39039341-39039363 GAGCTCCTTTAGGGGTGACTCGG + Intergenic
1179274802 21:39882442-39882464 CAGCTGTACTGGGGAGGACTGGG + Intronic
1180619553 22:17152002-17152024 CATCTAGTCTGGGGGTGACTGGG - Intronic
1180786632 22:18551291-18551313 CACCTGGACTAGGAGTGACTGGG + Intergenic
1181131922 22:20737104-20737126 CACCTGGACTAGGAGTGACTGGG + Intronic
1181243547 22:21490812-21490834 CACCTGGACTAGGAGTGACTGGG + Intergenic
1182480685 22:30606913-30606935 CAGCTGTTCCAGTGGTGGATTGG - Exonic
949806403 3:7960217-7960239 CAGTTTTTATAGGCGTGACTGGG + Intergenic
950150630 3:10684285-10684307 CAGTTGTTCTAGGGCTGATGTGG - Intronic
951242668 3:20305247-20305269 CAGCTGTTGTAGGAGAGACCTGG - Intergenic
953866594 3:46588536-46588558 CAGTTCTTGTAGTGGTGACTTGG - Intronic
954823520 3:53351322-53351344 TTGGTGTTCTAGGGATGACTGGG + Intergenic
957461623 3:80528801-80528823 CAGGTGTTGTAGGAGGGACTTGG - Intergenic
957552690 3:81727397-81727419 TAGCTGTTCTAGGAATGCCTTGG - Intronic
960631103 3:119731559-119731581 CAGCACTTCTGGGTGTGACTTGG - Intronic
962065837 3:131979868-131979890 CAGTTCTTGTAGGGGTGGCTTGG + Intronic
964993403 3:162844236-162844258 CAGCTAATCTAGTGGGGACTTGG - Intergenic
969379319 4:6783396-6783418 CGGCTCTTCTAGGGGAGACGAGG + Intronic
970277285 4:14415199-14415221 CAGGGGTTCCAGGAGTGACTAGG + Intergenic
971900883 4:32656975-32656997 CAGTTCTTCTAGTGGTGGCTTGG + Intergenic
973068985 4:45834186-45834208 CAGTTTTTGTAGGGGTGGCTTGG + Intergenic
973244347 4:47994851-47994873 CAGTTCTTGTAGTGGTGACTTGG + Intronic
974188070 4:58465710-58465732 CAGCTAATCTAGTGGGGACTTGG + Intergenic
974839679 4:67286356-67286378 CAGCTAATCTAGTGGGGACTTGG - Intergenic
977206629 4:94170500-94170522 TAGCTAATCTAGGGGAGACTTGG + Intergenic
979678489 4:123434984-123435006 TAGCTAATCTAGGGGGGACTTGG - Intergenic
984054976 4:174916994-174917016 AAGTTGTTCTAGGGTTGTCTTGG - Intronic
984266479 4:177503621-177503643 CAGTTCTTGTAGTGGTGACTTGG + Intergenic
986256321 5:6103873-6103895 CAGCGGTTCTAGGGGTTAGGAGG - Intergenic
992150468 5:73897355-73897377 CACCTGTTCTAGGGGATATTGGG - Intronic
992802871 5:80309651-80309673 CAGCTAATCTAGTGGGGACTTGG - Intergenic
993964955 5:94348752-94348774 CAGTTCTTCTAGTGGTGGCTTGG - Intronic
994885625 5:105557733-105557755 TACCTGTCCCAGGGGTGACTAGG + Intergenic
995679005 5:114696120-114696142 TAGCTAATCTAGTGGTGACTTGG + Intergenic
996330000 5:122317909-122317931 CAGCATTTGTAGAGGTGACTTGG - Intronic
998403279 5:141859150-141859172 CACCTGGTGTAGGGGTGATTAGG + Intronic
1003593821 6:7457017-7457039 TAGCTGATCTGGTGGTGACTTGG + Intergenic
1004354167 6:14916546-14916568 CAGCTAATCTAGTGGAGACTTGG + Intergenic
1004811851 6:19271113-19271135 CAGCTAATCTAGCGGGGACTTGG + Intergenic
1005114166 6:22318130-22318152 CAGCTCATCTAGTGGGGACTTGG - Intergenic
1005654989 6:27926769-27926791 CAGCTGTTCTAGGGTCATCTTGG + Intergenic
1009162305 6:60298383-60298405 CAGTTGTTGTAGTGGTGGCTTGG + Intergenic
1010401911 6:75455630-75455652 AAGCTGTTCTGGGGTTGATTGGG - Intronic
1013286407 6:108686035-108686057 CAGCTGTGGTATGGGTGACTTGG - Intergenic
1014337002 6:120148983-120149005 CAGTTCTTCTAGTGGTGGCTTGG - Intergenic
1015913194 6:138188610-138188632 CAGCTGCCTTCGGGGTGACTAGG + Intronic
1016804733 6:148201605-148201627 CAGCTGTTCCATGGGTGATACGG - Intergenic
1017686803 6:156921948-156921970 CAGCAGTTTTAGGGATGAATTGG + Intronic
1018114768 6:160572579-160572601 CAGTTCTTCTAGTGGTGACTTGG + Intronic
1019102068 6:169639781-169639803 CAGCCGTTCTAGGGGTTATGAGG - Intronic
1021113164 7:16719100-16719122 TATGTGTTGTAGGGGTGACTAGG + Intergenic
1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG + Intronic
1033597380 7:142867212-142867234 CAGCTGACCTAGGGGCTACTCGG + Intronic
1034337212 7:150331248-150331270 CATCTGCTCTAGTGGTGACCTGG + Exonic
1037178119 8:15971170-15971192 CAACTATTTTAGGGGTGAGTAGG + Intergenic
1041356410 8:57005520-57005542 CAGCTGTGCTAGGGGTGCTGGGG + Intergenic
1042939899 8:74096959-74096981 CTGCTGTTGCAGGGATGACTTGG + Intergenic
1047124875 8:121948858-121948880 TAGCTGATCTAGTGGGGACTTGG + Intergenic
1047894743 8:129354113-129354135 CAGCTGTTGTGGGGGTGAACTGG + Intergenic
1048807640 8:138255437-138255459 CCACTGTTCTAGGGGAGACAGGG - Intronic
1048981548 8:139705397-139705419 CAGCTGGCCAAGGGGTGGCTGGG + Intergenic
1049295808 8:141836564-141836586 CAGTTGTTGTAGGGGTAGCTTGG + Intergenic
1049359084 8:142203357-142203379 CTGCAGTTCTAGGCGTGGCTGGG + Intergenic
1049944418 9:580551-580573 TAGCTGATCTAGTGGGGACTTGG - Intronic
1052247053 9:26348536-26348558 CAGTTCTTGTAGGGGTGGCTTGG - Intergenic
1055550422 9:77427822-77427844 GAGCTGTTCTGGGGCTGTCTGGG - Intronic
1058308227 9:103469859-103469881 CAGTTTTTATAGTGGTGACTTGG + Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1062304744 9:135898839-135898861 CAGCTGTGCTTGGGATTACTGGG - Intronic
1062616145 9:137396905-137396927 CAGCTGTCCTGGGGCTGCCTTGG - Intronic
1186006349 X:5076675-5076697 CACCTGTTGTAGGAGGGACTGGG + Intergenic
1186366928 X:8905293-8905315 CTGCTGTTCTAGCAGAGACTGGG - Intergenic
1190750517 X:53357858-53357880 CAGCAATTCTGGTGGTGACTTGG - Intergenic
1190801722 X:53795297-53795319 CAGCAATTCTGGTGGTGACTTGG - Intergenic
1191903405 X:66062874-66062896 CAGCTCTTGTAGTGGTGGCTTGG + Intergenic
1191945123 X:66525242-66525264 CAGTTCTTCTAGTGCTGACTTGG + Intergenic
1193908345 X:87270322-87270344 CAGCTGATCTAGGATTGGCTTGG + Intergenic
1194806486 X:98334908-98334930 CAGCGCTTCTAGTGGTGAATAGG + Intergenic
1196908118 X:120458894-120458916 CAGCACTTCTAGGGGTATCTAGG - Intronic
1200531766 Y:4348017-4348039 TAGCTAATCTAGTGGTGACTTGG + Intergenic