ID: 1150250275

View in Genome Browser
Species Human (GRCh38)
Location 17:63700771-63700793
Sequence CCTCCCCGCAGCCTCGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150250275_1150250279 -9 Left 1150250275 17:63700771-63700793 CCGGCCGCGAGGCTGCGGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 244
Right 1150250279 17:63700785-63700807 GCGGGGAGGAGCCTGCACGAGGG 0: 1
1: 1
2: 1
3: 22
4: 149
1150250275_1150250278 -10 Left 1150250275 17:63700771-63700793 CCGGCCGCGAGGCTGCGGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 244
Right 1150250278 17:63700784-63700806 TGCGGGGAGGAGCCTGCACGAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1150250275_1150250282 5 Left 1150250275 17:63700771-63700793 CCGGCCGCGAGGCTGCGGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 244
Right 1150250282 17:63700799-63700821 GCACGAGGGCCCGGCAGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 259
1150250275_1150250288 24 Left 1150250275 17:63700771-63700793 CCGGCCGCGAGGCTGCGGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 244
Right 1150250288 17:63700818-63700840 CCGGCAGCCCCCCCAGCCCTCGG 0: 1
1: 1
2: 4
3: 64
4: 612
1150250275_1150250280 -4 Left 1150250275 17:63700771-63700793 CCGGCCGCGAGGCTGCGGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 244
Right 1150250280 17:63700790-63700812 GAGGAGCCTGCACGAGGGCCCGG 0: 1
1: 0
2: 0
3: 23
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150250275 Original CRISPR CCTCCCCGCAGCCTCGCGGC CGG (reversed) Intronic