ID: 1150255534

View in Genome Browser
Species Human (GRCh38)
Location 17:63741577-63741599
Sequence ATTGCGGGAGTCGAGGACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150255519_1150255534 22 Left 1150255519 17:63741532-63741554 CCCCGCCAGGCCCAAGCCTATTC 0: 1
1: 0
2: 1
3: 28
4: 282
Right 1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1150255527_1150255534 6 Left 1150255527 17:63741548-63741570 CCTATTCTGCTCTCGGGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1150255521_1150255534 20 Left 1150255521 17:63741534-63741556 CCGCCAGGCCCAAGCCTATTCTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1150255526_1150255534 11 Left 1150255526 17:63741543-63741565 CCAAGCCTATTCTGCTCTCGGGC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1150255520_1150255534 21 Left 1150255520 17:63741533-63741555 CCCGCCAGGCCCAAGCCTATTCT 0: 1
1: 0
2: 4
3: 18
4: 221
Right 1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1150255522_1150255534 17 Left 1150255522 17:63741537-63741559 CCAGGCCCAAGCCTATTCTGCTC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1150255524_1150255534 12 Left 1150255524 17:63741542-63741564 CCCAAGCCTATTCTGCTCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150255534 Original CRISPR ATTGCGGGAGTCGAGGACGC GGG Intronic
907382029 1:54098943-54098965 ATGGCTGGAGTAGAGGACACTGG + Exonic
909054689 1:70807162-70807184 TTTGGGGGGGTCGAGGAAGCAGG + Intergenic
911725439 1:101237114-101237136 ATGGCGGGGGTCGCGGGCGCGGG + Intronic
912726941 1:112067143-112067165 GTTGGGGGAGTCGAGGAACCGGG + Intergenic
919988935 1:202695456-202695478 ACTGCGGGAGCCGGGGAGGCTGG - Intronic
1069751041 10:70745147-70745169 AGTGAGGGAGTGGGGGACGCTGG + Intronic
1073427507 10:103464646-103464668 ATTGGGGCAGTGGAGGAGGCAGG + Intergenic
1077105719 11:841811-841833 ATTGCTGGAGCCCAGGAGGCGGG + Intronic
1077369907 11:2177024-2177046 ATGGCGTGAGGGGAGGACGCAGG - Intergenic
1077730065 11:4721054-4721076 ATTGGGGGAGGCTAGGACACCGG - Intronic
1084041759 11:66546736-66546758 ACTGCGGGACTCGGGGGCGCCGG - Exonic
1099083432 12:78215295-78215317 ATTGCTGGAGCCCAGGAGGCAGG + Intergenic
1103358856 12:120342096-120342118 ATTGCGGGGGTCGAGGGGGAAGG + Exonic
1109006743 13:56886670-56886692 TTTGCGGGAGCAGAGCACGCAGG - Intergenic
1127918536 15:63475145-63475167 TTTGCCGGAGTCGAGGCCCCTGG - Intergenic
1129288070 15:74541435-74541457 AATGCGCGAGTCGGGGGCGCGGG + Intronic
1142971360 17:3614005-3614027 ACTGGGGGAGCTGAGGACGCAGG - Intronic
1146424072 17:32719304-32719326 ATTGCAGGAGTCCAGGAAACAGG - Intronic
1147319796 17:39639254-39639276 AATGCTGGAGTGGAGGACACTGG + Intronic
1147605871 17:41773423-41773445 ATTGCGGGAGGAGAGGAAGGAGG - Intronic
1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG + Intronic
1162771999 19:12954619-12954641 ACTGGGGGAGTTGAGGAGGCAGG - Intronic
1166243295 19:41508819-41508841 ATTGCTTGAGTCCAGGAGGCGGG + Intergenic
1166319163 19:42005835-42005857 GTAGCGGGAGTTGAGGACGCGGG + Exonic
1166381339 19:42356808-42356830 CTGGCGGGAGCCGAGGACGGGGG + Exonic
1167134350 19:47608419-47608441 ATAGCGGGAGTCGAGGATGAAGG - Intronic
1167644897 19:50700261-50700283 ATTGGGAGAGTGGAGGACTCGGG + Intronic
925045009 2:766486-766508 CTTGGGGGAGGCGAGGAAGCTGG + Intergenic
928341335 2:30445801-30445823 ATTGCTTGAGTCCAGGAGGCAGG + Intergenic
941341434 2:164309926-164309948 ATTGCTGGAGTGGAAGATGCAGG - Intergenic
948243084 2:236454941-236454963 ATTGCGGGATTTGAGAAAGCTGG - Intronic
1168823240 20:791519-791541 ATTGCAGGAATCCAGGACACTGG + Intergenic
1175898922 20:62352370-62352392 ATGGCGGGAGGGGAGGGCGCTGG + Intronic
1178915901 21:36705444-36705466 ATTGGGGGAGGAGAGGCCGCAGG + Intronic
951449820 3:22824893-22824915 ATTTTGGGAGTAGAGGAAGCAGG - Intergenic
962679642 3:137784984-137785006 ACTGTGGGAGTGGAGGACCCAGG + Intergenic
963676611 3:148319334-148319356 ATTGCGAGAATCCAGGACTCAGG - Intergenic
965554281 3:170003613-170003635 ATTGTGGGAGGCGAGGAGTCAGG - Intergenic
985877967 5:2614645-2614667 ATAGCGGGAGGAGAGGAGGCTGG - Intergenic
990614784 5:57496562-57496584 ATTGCGAGAGTTTAGAACGCTGG + Intergenic
998261041 5:140632138-140632160 ATTGAGGGAGTTCAGGGCGCTGG + Exonic
1009667774 6:66705602-66705624 ACTGCGGGAATCCAGGACACTGG + Intergenic
1012549714 6:100455605-100455627 ATTGGGAAAGCCGAGGACGCCGG + Intronic
1018745943 6:166762207-166762229 ACTGAGGGAGGGGAGGACGCAGG - Intronic
1022721544 7:32945725-32945747 ATTGTGGGAGTCCAGGAAACAGG - Intergenic
1037801239 8:22037045-22037067 ATTGGGGGTGCCGAGGACGAGGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1043539056 8:81238919-81238941 ATTGCAAGAGTCCAGGACACAGG + Intergenic
1045828483 8:106429257-106429279 AATGAGGGAGTGGAGGATGCCGG + Intronic
1049173923 8:141179892-141179914 ACTGAGGGAGTCCTGGACGCAGG + Intronic
1061382265 9:130265656-130265678 ATTGGGGGAGGGGAGGAGGCGGG + Intergenic
1186108414 X:6229527-6229549 GTTGCGGGGGGCGAGGACGGGGG + Intergenic
1190119640 X:47649875-47649897 ATTGGGGGACTGGAGGAGGCAGG + Intronic