ID: 1150257970

View in Genome Browser
Species Human (GRCh38)
Location 17:63764046-63764068
Sequence GGCCTGGTTTAACACTCATA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150257970 Original CRISPR GGCCTGGTTTAACACTCATA GGG (reversed) Exonic
902535255 1:17116005-17116027 GGCCTGGATGACCCCTCATAGGG + Intronic
904381398 1:30113545-30113567 GCCCTGGCTTAACACTGAGAAGG + Intergenic
907782056 1:57576060-57576082 GCATTGGTTTAACAATCATAGGG - Intronic
913079610 1:115370297-115370319 GGCCTCTCTTTACACTCATAAGG + Intergenic
1064338847 10:14468803-14468825 GGACTGGTTTATCACTCACCAGG + Intergenic
1068132196 10:52908809-52908831 TGCCTTGTTTAACACTCATGAGG + Intergenic
1076113230 10:127877020-127877042 AGCCAGGTTGAACACTGATAGGG - Intergenic
1078706951 11:13753165-13753187 GGGATGGTTTAACATACATAAGG + Intergenic
1081771486 11:45652843-45652865 GGCCTGCTTTAACCCCCATCTGG + Intronic
1097064684 12:56312174-56312196 GGCCTGGTTTTAAATTAATATGG + Intronic
1097681532 12:62654323-62654345 GGCCGAGTTTAACTATCATATGG + Intronic
1108430419 13:50347803-50347825 GGCATGGATGAACATTCATAGGG + Intronic
1109761111 13:66830261-66830283 GTCCAGGTTGAACAGTCATATGG - Intronic
1115772384 14:36678191-36678213 GGCTTCGTTTAAAACTCAGATGG + Exonic
1121530093 14:94646456-94646478 GGCCTGGTTTGTCCCTCCTATGG + Intergenic
1124151084 15:27178878-27178900 GGCCAGGTTTTACACAGATAGGG + Intronic
1129238270 15:74236675-74236697 GGCCTTGTTTAACAATCTTGGGG - Exonic
1134206663 16:12243720-12243742 GGCCTGGTTCTACCCTCATGGGG + Intronic
1136021664 16:27444495-27444517 GGCCTGGTTTAACCCTGACCTGG + Intronic
1146931336 17:36780258-36780280 GGTCTGGTTGAGCACTGATAGGG - Intergenic
1147557313 17:41487572-41487594 GGCCTGGTTCAACACCCAGGTGG - Exonic
1150257970 17:63764046-63764068 GGCCTGGTTTAACACTCATAGGG - Exonic
1152491088 17:80635214-80635236 GCCCTGGTCCAACACCCATATGG + Intronic
1153062724 18:1010919-1010941 GGCCTGGTTTTAGACCCACAGGG - Intergenic
928141078 2:28729646-28729668 TGACTGGTTTAACTCTCAGAAGG + Intergenic
929680222 2:43986676-43986698 GGCCAGGGTTAGCACTCAGACGG + Intronic
930357164 2:50335651-50335673 GTCCTGGTTTAACTCCCACATGG + Intronic
932325424 2:70856485-70856507 GGCCTGGTTCAAAACTAACATGG + Intergenic
932771846 2:74504875-74504897 GGCCTGGTTTCACACATATAGGG + Intergenic
933098453 2:78218924-78218946 AGCTTGCTTTAACACTCATATGG + Intergenic
939357372 2:141121211-141121233 GGCGGAGTTTAACACTCACATGG - Intronic
940905911 2:159169642-159169664 GGGGTAGTTTAACACTCATTAGG + Intronic
945866812 2:215185197-215185219 CTCCTGGTTTTGCACTCATACGG + Intergenic
1169627690 20:7590935-7590957 GGTCTGTTTTATTACTCATAAGG - Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
949185272 3:1183898-1183920 GGCCTGCTTTCAAACTCATTTGG + Intronic
974824244 4:67106105-67106127 GGCCTTTTTTAACACTAATAAGG + Intergenic
978160301 4:105538906-105538928 GGCATGGTTACAAACTCATAGGG - Intergenic
978416016 4:108476707-108476729 AGCCTGAATTCACACTCATACGG - Intergenic
995066259 5:107866613-107866635 GGCCTGGGTTTACACTTATCTGG - Intronic
997227834 5:132222602-132222624 GGCCTGGTCACACACTCAAAAGG - Intronic
999318282 5:150598178-150598200 GTCCTGGTTAAACTCTCAGATGG - Intergenic
1004876040 6:19956046-19956068 GGCATTGTTTAGCAATCATAAGG + Intergenic
1008812560 6:55521882-55521904 GGCCTGGTTTATCACCTATCGGG - Intronic
1016106892 6:140174113-140174135 GGCCTGCCTTTACACTGATAGGG - Intergenic
1018224886 6:161619156-161619178 TGCCTGGTTTCACAGACATATGG + Intronic
1031207138 7:118774411-118774433 AGCCTGGTTATTCACTCATATGG + Intergenic
1041459098 8:58092127-58092149 GGCTTGGTATTACACTCATCTGG + Intronic
1049699241 8:144000793-144000815 GGCCTGGTATTACAATCATCTGG - Intronic
1052890693 9:33696799-33696821 GGTCTGTTTTGTCACTCATAAGG + Intergenic
1057580111 9:96280065-96280087 GGCCTGCTTTGTCACTCTTAAGG + Intronic
1059921513 9:119165847-119165869 ATCCTGATTTAACCCTCATAAGG + Intronic
1060664880 9:125426958-125426980 GGCCTGGTGTCACACAGATAGGG + Intergenic
1189051126 X:37646820-37646842 GGCCTGTTGTAAGACTCCTAAGG + Intronic
1192892020 X:75400104-75400126 AGCCTGGTTAAACACTCTTTTGG - Intronic