ID: 1150257970

View in Genome Browser
Species Human (GRCh38)
Location 17:63764046-63764068
Sequence GGCCTGGTTTAACACTCATA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150257970 Original CRISPR GGCCTGGTTTAACACTCATA GGG (reversed) Exonic