ID: 1150259298

View in Genome Browser
Species Human (GRCh38)
Location 17:63774998-63775020
Sequence CTATAGGAGTGGGGGCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150259298_1150259306 -1 Left 1150259298 17:63774998-63775020 CCCTCTTGCCCCCACTCCTATAG 0: 1
1: 0
2: 1
3: 15
4: 226
Right 1150259306 17:63775020-63775042 GGCAGTTATCCAATTTCTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150259298 Original CRISPR CTATAGGAGTGGGGGCAAGA GGG (reversed) Intronic
904097279 1:27990025-27990047 ATATAGGGGTGGGGTCAAAAGGG + Intronic
904347746 1:29884364-29884386 CGATGGGAGTGGGGGCAGAAGGG - Intergenic
904750308 1:32737673-32737695 CTTTAGGCCAGGGGGCAAGAGGG + Intergenic
906836165 1:49085498-49085520 ATCTAGGAGTTGGGTCAAGATGG + Intronic
907431715 1:54416040-54416062 CTGTAGGAGGGGTGGCTAGATGG - Intergenic
907971595 1:59388139-59388161 ACATAGGAGTTGGGGCAGGAAGG + Intronic
911437901 1:97886393-97886415 CTCTATGAGTGGGGGCTGGATGG - Intronic
915885914 1:159720813-159720835 CTATGGGAATGAGGCCAAGAAGG + Intergenic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
921246038 1:213241739-213241761 CTATAGGATTTGGGCCCAGAGGG - Exonic
924020939 1:239781471-239781493 TTTTAGGAGTTTGGGCAAGAGGG + Intronic
1062982893 10:1740130-1740152 CTATAGGGGTCGGGGGGAGACGG + Intergenic
1063498035 10:6528112-6528134 CTTAAGGAGAGGGGGCAAGCAGG - Intronic
1064379917 10:14832320-14832342 CTAAAGTAGAGGGAGCAAGAGGG + Intronic
1065853031 10:29806273-29806295 CTACAAGAATGGGAGCAAGAAGG + Intergenic
1066329444 10:34403813-34403835 CAATGGGAGTGGGTGCAGGAAGG + Intronic
1069957312 10:72060012-72060034 CCAGGGGAGTGGGGGCAGGAAGG + Exonic
1072195848 10:93116712-93116734 CTAGAGGAGTGGAACCAAGAGGG - Intergenic
1072883733 10:99254391-99254413 CTAGAGGAGTGAGGGAGAGAAGG + Intergenic
1073018698 10:100422939-100422961 CTAGAGGAGGGAGGGAAAGAGGG - Intergenic
1073019078 10:100426023-100426045 CTAGAGGAGGGAGGGAAAGAGGG + Intergenic
1075239344 10:120764045-120764067 CTTTTGGAGTGGGGGAAACAGGG + Intergenic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1078187206 11:9062165-9062187 CTGAAGGAGTTGGGGGAAGAGGG - Intronic
1079264772 11:18920791-18920813 GTACAGGAGGGGGGCCAAGATGG + Intergenic
1079266947 11:18942938-18942960 GTACAGGAGGGGGGCCAAGATGG + Intergenic
1079936531 11:26623517-26623539 ATATAGGAGAGGGGAAAAGATGG + Intronic
1081368961 11:42274668-42274690 CTGGAGAAGTGGGGGCAAGCTGG - Intergenic
1082253212 11:50004983-50005005 ATATAGGGGTGGAGCCAAGATGG + Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1084475583 11:69386874-69386896 AGCTAGGAGTGGGGGCAAGGAGG - Intergenic
1085931914 11:81094008-81094030 CAAAAGGACTGGGAGCAAGAGGG - Intergenic
1088960693 11:114661962-114661984 CTGTAGGAGGTGGGGTAAGATGG + Intergenic
1090734303 11:129598080-129598102 TTTTTGGAGTGGGGCCAAGATGG + Intergenic
1090814304 11:130277941-130277963 TTATAGCAGTGGAGGCCAGAAGG - Intronic
1091832055 12:3556951-3556973 CCATAGAAGTGGGGGAAAGTGGG + Intronic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1094105765 12:26809839-26809861 GTATTGGAGTGTGGGAAAGAGGG - Intronic
1096048530 12:48586081-48586103 CTACAGGAGGGAGGACAAGATGG + Intergenic
1096460005 12:51817008-51817030 ATAGAGGAGTGGGGGCAGGTGGG + Intergenic
1097801864 12:63923259-63923281 CTATAAGGCTGGGAGCAAGAGGG - Intronic
1098347480 12:69521441-69521463 GAATAGAAGTGGTGGCAAGAGGG + Intronic
1098463880 12:70765016-70765038 TTATAGGGGTGGAGCCAAGATGG + Intronic
1099667393 12:85649714-85649736 GAATAGGAGTGGTGACAAGAGGG + Intergenic
1101293211 12:103393299-103393321 TGATAGAAGTGGGAGCAAGAGGG + Intronic
1102803539 12:115758997-115759019 TCATAGGAGTGGGGCCAAGGAGG - Intergenic
1103004940 12:117413710-117413732 CTGTAGGAGGGTGGGCAATAGGG - Intronic
1103318768 12:120077969-120077991 CTAAAGCAAAGGGGGCAAGAGGG - Intronic
1104784577 12:131441184-131441206 TTATAGGGGTGGGGCCAAGATGG - Intergenic
1106057156 13:26249135-26249157 GTATAGGAGAGGAGGCCAGAGGG - Intergenic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1110152500 13:72271607-72271629 ATATAGGGGTGGAGCCAAGATGG - Intergenic
1110661641 13:78064597-78064619 CTGTAGGAGTGGGGGAGGGAGGG - Intergenic
1111773305 13:92626394-92626416 CTAGAGGTGAGAGGGCAAGAGGG + Intronic
1112663885 13:101545182-101545204 GCATAGGGGTGGGGCCAAGATGG - Intronic
1113571068 13:111358420-111358442 CTACAAAAGTGGGGGCAATAAGG - Intergenic
1113966155 13:114155127-114155149 GTGTAGGTGTGGGGGCATGATGG + Intergenic
1114517898 14:23311908-23311930 GTATAGGAGTGGGGTGAGGATGG - Intronic
1114637957 14:24199166-24199188 CTATATCAGTGGGGGACAGAGGG - Intronic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117460170 14:55937569-55937591 CTAAAGGAGCAGGTGCAAGATGG - Intergenic
1120915404 14:89706013-89706035 CTATAGGAGTGGGCACAAAGGGG - Intergenic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121628566 14:95405689-95405711 CTATAGGAGTGCTGGCAACCTGG + Intergenic
1122368633 14:101214632-101214654 CCATAGCAGTGGGGGTAATACGG - Intergenic
1123058193 14:105582286-105582308 GTACAGGAGTGGGGACAGGAAGG - Intergenic
1123082284 14:105701211-105701233 GTACAGGAGTGGGGACAGGAAGG - Intergenic
1125078916 15:35653864-35653886 CTAAAAGAGTGGGGGCTGGATGG + Intergenic
1125518070 15:40333996-40334018 CTACAGGGCTGGGGGCAGGATGG - Exonic
1126309168 15:47296346-47296368 CTATTGCAAAGGGGGCAAGATGG - Intronic
1128527699 15:68423702-68423724 CTGGATGAATGGGGGCAAGAGGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130312113 15:82764992-82765014 CCAGAGGAGTGTGGGCAAGAGGG - Intronic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1131700727 15:94933309-94933331 TTATCTGAGTGGGGGCCAGAAGG - Intergenic
1133843730 16:9435316-9435338 CTAGAAGAGTGGGGGAAAGGAGG + Intergenic
1135663670 16:24317815-24317837 CCCTAGGAGTGGGGGTCAGAGGG - Intronic
1139429371 16:66903031-66903053 CTAGAGGAGTAGGGCCAAGTGGG - Intergenic
1140874412 16:79137717-79137739 CAGGAGGAGTGGGGGCAGGAAGG - Intronic
1141011470 16:80404390-80404412 TCATAGGATTGGGGGGAAGAGGG + Intergenic
1141029172 16:80572870-80572892 CTAGAGAAGTGGGGGCAAGAGGG - Intergenic
1141997684 16:87645703-87645725 CTTTAGGGGTGGGTGCAGGATGG + Intronic
1144088416 17:11831642-11831664 CTCTAGGATTTGGGGAAAGATGG - Intronic
1145843197 17:28013774-28013796 CTTTAAGAGAGGGGGCCAGAAGG - Intergenic
1146153264 17:30496107-30496129 CTATAGGAAAGGGGTAAAGAGGG - Intronic
1146617718 17:34370131-34370153 CTACGGGAGTGGGGGCCAGGAGG - Intergenic
1147689103 17:42304666-42304688 CTGGAGCAGTGGGGGCAGGAGGG - Intronic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1148443716 17:47725471-47725493 AGCTGGGAGTGGGGGCAAGAAGG - Intergenic
1148743381 17:49905565-49905587 GGGTAGGAGTGGGGGCAAGAAGG - Intergenic
1149895871 17:60427842-60427864 CCAGGGGAGTGGGGGCAGGAAGG - Intronic
1150259298 17:63774998-63775020 CTATAGGAGTGGGGGCAAGAGGG - Intronic
1151491346 17:74433592-74433614 CGATAGGAGTGGAGGCAGGAAGG + Intronic
1152936078 17:83137572-83137594 CTCTCGGAGTGGGGGAAGGAAGG + Intergenic
1153109245 18:1564366-1564388 CAATAGGAAGGGGAGCAAGAAGG + Intergenic
1154031080 18:10755128-10755150 CTTTAGAAGTGGGGATAAGATGG + Intronic
1156778375 18:40821394-40821416 CTATTGGGGTGGGGTCAAGATGG + Intergenic
1157131933 18:45015253-45015275 CTCTAGGGGTCTGGGCAAGATGG + Intronic
1157542437 18:48521291-48521313 GTCAAGGAGTGGGGGCAAGGAGG - Intergenic
1157749385 18:50164739-50164761 CTGTTGGAGGGGTGGCAAGAGGG - Intronic
1161109478 19:2461435-2461457 CTACAGGAGGCGGGGCCAGAGGG + Intergenic
1162076525 19:8191578-8191600 CTGTAGGAGAGGGGGCAGGTAGG - Intronic
1164946337 19:32296287-32296309 CTAGAGGGGTGGGAGCAAGGGGG - Intergenic
1165768934 19:38367349-38367371 ACAAAGTAGTGGGGGCAAGAGGG - Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1167213388 19:48148097-48148119 CAATAGGAGTTGGGGCCTGAGGG + Intronic
926813367 2:16776057-16776079 CTGGAGGAGAGGGAGCAAGAAGG + Intergenic
927176894 2:20416135-20416157 CTAAAAGAATGCGGGCAAGATGG - Intergenic
928121391 2:28586305-28586327 CTATAGGAGCGGAGGGCAGAGGG - Intronic
928472063 2:31584728-31584750 CTATGGGAGGTGGAGCAAGATGG + Intergenic
928759222 2:34561440-34561462 CTAGAGGGGTGGAGCCAAGACGG - Intergenic
929559321 2:42945893-42945915 ACATAGGTGTGGGGGCATGAGGG + Intergenic
930503687 2:52255659-52255681 CTTTAGGAGTGGGGGCCTTATGG - Intergenic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
933462732 2:82609690-82609712 CTATGACAGTGTGGGCAAGAAGG + Intergenic
934792799 2:97076853-97076875 CATTAAGAGTGGGGGCCAGAGGG + Intergenic
934813816 2:97306831-97306853 CATTAAGAGTGGGGGCCAGAGGG - Intergenic
934823879 2:97401649-97401671 CATTAAGAGTGGGGGCCAGAGGG + Intergenic
937931382 2:127208078-127208100 GTATGGGAGAGGGGCCAAGATGG + Intronic
938096096 2:128465280-128465302 TTGGAGGAGTGGGGGCAGGAAGG - Intergenic
940273554 2:151916188-151916210 GAATAGGGGTGGGGCCAAGATGG - Intronic
941702849 2:168623246-168623268 GGATAGGAGTGGGGGAAAGAGGG + Intronic
944501046 2:200360552-200360574 CTATCGGAGTGGGGAGAGGAAGG + Intronic
945315024 2:208361260-208361282 CTGTAAGAGTGGGGCCAAGTGGG - Intronic
1172510921 20:35500483-35500505 TTATAGGATTGGGGGCTAGAAGG + Intronic
1172511080 20:35501498-35501520 TTATAGGACTGGGGGCTAGAAGG + Intronic
1173530880 20:43768622-43768644 CTATGGGAGGGGAGGCATGAGGG - Intergenic
1175640594 20:60626645-60626667 TTATAGAAGTGGGGCCAAGCAGG + Intergenic
1177351187 21:19944023-19944045 CTATCGGAGTGGGGAGTAGAAGG - Intergenic
1178399537 21:32273398-32273420 CTTCAGGATTGGGGGCCAGAAGG - Intronic
1178410777 21:32362128-32362150 CTAGAGGAGTGCGTGTAAGAAGG + Intronic
1182487817 22:30649759-30649781 CTATGGCAGTGGGGGCCAGTTGG - Intronic
1183241606 22:36661740-36661762 CTCTAGGATTGGAGGCAAGGTGG + Intronic
1183786474 22:40031767-40031789 TTATAGCAGTGTGGACAAGATGG + Exonic
1184399971 22:44267995-44268017 CTTTGGGAGTGGGGTCAACAGGG + Intronic
950633896 3:14302012-14302034 CAATAGGGGTGGGGGCAACTCGG - Intergenic
952222072 3:31332836-31332858 AACTAGGAGTGGTGGCAAGATGG + Intergenic
953996629 3:47524723-47524745 CTATATGAGTATGGCCAAGATGG + Intergenic
956561672 3:70583979-70584001 CTTTAGTAGAGGGGGCCAGAAGG - Intergenic
960233319 3:115254351-115254373 CTGGAGGAGTGGGGCCAAGATGG + Intergenic
961099237 3:124184626-124184648 TTATAGAAGTGAGGGCAGGAGGG - Intronic
962979316 3:140473488-140473510 TTATAAGAGGGGAGGCAAGAGGG + Intronic
963210304 3:142682127-142682149 CAATATGAGAGGGGGCAAGAGGG + Intronic
964745779 3:160011135-160011157 TTAAAGGAGTGGTTGCAAGAGGG + Intergenic
965547926 3:169934341-169934363 CTAGAGGAGGCAGGGCAAGATGG + Intronic
967072501 3:185973839-185973861 CTATAGCAGTGGAGGCACGGTGG - Intergenic
968756234 4:2417835-2417857 CAATGGGGGTGGGGGCAGGACGG + Intronic
969938340 4:10705503-10705525 CTCTAGAAGTGGGAGAAAGAAGG - Intergenic
969998333 4:11338196-11338218 CTAAAGGAGGGGGGGAAACACGG - Intergenic
971048915 4:22838323-22838345 TACTAGGAGTGGGGGCATGAGGG + Intergenic
974495665 4:62623729-62623751 CTATAGGAGTAGGTAGAAGATGG + Intergenic
976511281 4:85911946-85911968 CAAAAGGAGTGGAGGCCAGAAGG - Intronic
976673801 4:87682651-87682673 CAAAAGGAGTGGAGGCATGAAGG - Intergenic
979439606 4:120735642-120735664 CTAAAGCAGTGGGAGAAAGAGGG + Intronic
980652797 4:135742105-135742127 CTTTTGCAGTGGGAGCAAGAGGG + Intergenic
982063332 4:151626341-151626363 CTATAGGAGTGTGGAGAAGATGG + Intronic
983904300 4:173168725-173168747 CGGTAGGGGTGGGGGAAAGAGGG + Intergenic
987197467 5:15541508-15541530 GAATAGGGGTGGGGGTAAGATGG - Intronic
987231000 5:15893234-15893256 CCATATTAGTGGGGGCATGATGG - Intronic
987516692 5:18918989-18919011 TTTTAGGAGTGGGATCAAGATGG - Intergenic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
988813158 5:34805372-34805394 GTATAGGAGTGGGGGGCAGCAGG - Intronic
989492651 5:42076315-42076337 AAATAGGAGGGGGGTCAAGATGG + Intergenic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
991743655 5:69709535-69709557 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991795228 5:70289267-70289289 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991833370 5:70720820-70720842 CTACGGGGGTGGGGGAAAGAGGG - Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
992079883 5:73226181-73226203 CTAAAGGTGTGGGGGGATGAAGG - Intergenic
993373956 5:87127139-87127161 CTATAGGAGTGAGCTCAGGAAGG + Intergenic
994222443 5:97211482-97211504 CTGTAGGAGTGGGGGGAATGGGG - Intergenic
994310717 5:98267443-98267465 TTATAGGAGGTGGAGCAAGATGG + Intergenic
996004763 5:118406329-118406351 CTACAGGGGAGGGGCCAAGATGG - Intergenic
996005746 5:118419362-118419384 ATATAGGAGAGGGGCCAAGATGG + Intergenic
999034419 5:148331218-148331240 CTAGAGGGGTGGAGCCAAGATGG - Intronic
999081278 5:148846121-148846143 CTGTAGGACTCTGGGCAAGATGG - Intergenic
999319630 5:150605484-150605506 ATGGAGGGGTGGGGGCAAGAAGG + Intronic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1002310374 5:178310265-178310287 CCGCAGGAGTGGGGGCAGGACGG + Intronic
1003322884 6:5068086-5068108 CAATCAGAGTGTGGGCAAGAAGG - Intergenic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1006029310 6:31167734-31167756 CTATAGGAGTAGGGTAAAGGAGG + Intronic
1007640952 6:43339260-43339282 CTATAGTAGTGGTGGAAAGGGGG - Exonic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1011620445 6:89237581-89237603 CTGTTGGAGTGGGGGCATGGCGG - Intergenic
1011944018 6:92879327-92879349 CTTGAGGGGTGGGGCCAAGATGG + Intergenic
1016282958 6:142440159-142440181 CTATAGGATTCGGGGGAAAACGG + Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1020973640 7:14979820-14979842 CTATAGCTGTAGGGGCAAGTAGG + Intergenic
1021358188 7:19680317-19680339 CTATAGCAGAGAGAGCAAGACGG - Intergenic
1022223731 7:28341195-28341217 CTAGAGGAGGTGGAGCAAGATGG - Intronic
1022276118 7:28856568-28856590 CTGGAGGAGTGGGGGTGAGAAGG - Intergenic
1022916949 7:34966212-34966234 CTAACAGAGTGGGGGAAAGAGGG - Intronic
1023507906 7:40919555-40919577 GTATTGGAGTGGGGGCAATGAGG - Intergenic
1024747612 7:52426724-52426746 CTATAGGGGTGGGAGGGAGAAGG - Intergenic
1025110515 7:56212441-56212463 GGACAGGAGTGGGGGGAAGAAGG - Intergenic
1026241826 7:68582341-68582363 CTACAGCAGGGGGCGCAAGAGGG + Intergenic
1026829101 7:73600561-73600583 CAAGTGGGGTGGGGGCAAGAGGG + Intronic
1026829146 7:73600678-73600700 CGAAAGGGGTGGGGGCGAGAGGG + Intronic
1027541782 7:79476253-79476275 GTATAGGAGTGAGGGGAAAAGGG - Intergenic
1028028991 7:85884899-85884921 CTATAGGAGTTGGGGACAGTTGG + Intergenic
1031512528 7:122667911-122667933 CTATAAGAGTGGGGGCCACGTGG + Intronic
1032082690 7:128867923-128867945 TGATGGGAGTGGGGGCAGGAGGG + Intronic
1033278858 7:139991856-139991878 CTCTAGCAGGTGGGGCAAGAGGG + Intronic
1034416419 7:150966771-150966793 CTGTTGGAGTCGGGGCAAAAGGG + Intronic
1035037589 7:155905453-155905475 CTCAAGGAGTGAGGGCAAGAAGG - Intergenic
1035467891 7:159091630-159091652 CAATAGCAGTGGGGGAACGAGGG + Intronic
1036660442 8:10704999-10705021 CTAAAGGAGTGGGGGCAGCCTGG + Intronic
1038667860 8:29556712-29556734 CAAAAGGAAGGGGGGCAAGATGG - Intergenic
1043252197 8:78088774-78088796 CTATGGATGTGCGGGCAAGAAGG + Intergenic
1045869136 8:106905526-106905548 ATATAGGAGAGGGATCAAGATGG - Intergenic
1046524747 8:115370367-115370389 ATATAGTAGTGGCGCCAAGATGG + Intergenic
1047067794 8:121305876-121305898 CCATAGGACTTGGGGCAAAAAGG - Intergenic
1047556049 8:125931527-125931549 CTAGAGGAATGTGAGCAAGAGGG + Intergenic
1048498863 8:134957989-134958011 CTATAGGAGAGAGCTCAAGAGGG + Intergenic
1049201040 8:141340804-141340826 CAATGGGAGTGGGGGAGAGATGG + Intergenic
1049346471 8:142141856-142141878 CTATAGGAGGGTGAGCAAGGTGG - Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050981281 9:12018993-12019015 CTATAGTTGTTGGTGCAAGAGGG + Intergenic
1052945393 9:34164380-34164402 CTATAGGAGATGGTGCAAGTAGG - Intergenic
1053284435 9:36841172-36841194 ATATATGAGTGTGGGCAGGAGGG - Intronic
1056822553 9:89853884-89853906 TTATAGGGGTGGGGAAAAGAGGG + Intergenic
1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG + Intergenic
1057742504 9:97724227-97724249 ATGGAGGAGTTGGGGCAAGAAGG + Intergenic
1058365606 9:104205056-104205078 TTATAGCAGTGGAGGCAGGAAGG + Intergenic
1058653026 9:107194888-107194910 CTAGAGGAGTGGGAGGAGGATGG + Intergenic
1060280590 9:122213441-122213463 ATCTAGGAGTTGGGGGAAGAAGG - Intronic
1060943780 9:127558079-127558101 ATATAGGAGTGGGGGTGGGAGGG + Intronic
1186569257 X:10697025-10697047 CTATTGAAGTGGAGGCAGGAGGG - Intronic
1188360041 X:29241929-29241951 CTATTGCAGTAGGGACAAGATGG + Intronic
1189613707 X:42763898-42763920 CTAAAGGCTTGGGGGCAGGAGGG - Intergenic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1192951832 X:76025838-76025860 TTACTGGAGTGGGGCCAAGATGG + Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1194558339 X:95389602-95389624 CTACGGGAGTGGGGGAAAGGTGG + Intergenic
1195852052 X:109294502-109294524 TCATAGCAGTGGGGGCAACAGGG - Intergenic
1196069397 X:111503434-111503456 CTTTAGTAGTGGGGGGAAAAAGG - Intergenic
1199095944 X:143738663-143738685 CTGTTGGAGGGGTGGCAAGAGGG + Intergenic
1201470960 Y:14334529-14334551 CTGTAGGTGTGGGGAAAAGAAGG - Intergenic