ID: 1150262010

View in Genome Browser
Species Human (GRCh38)
Location 17:63801427-63801449
Sequence CAGACTGGCCCCAAATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 746}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150262006_1150262010 15 Left 1150262006 17:63801389-63801411 CCTGTGTTTACTGTTTTTGTTGT 0: 1
1: 0
2: 9
3: 128
4: 1196
Right 1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG 0: 1
1: 0
2: 4
3: 43
4: 746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150262010 Original CRISPR CAGACTGGCCCCAAATCCCC TGG Intronic
900014795 1:140521-140543 CAGGCTGGCCACAAATTCCTGGG - Intergenic
900045061 1:499130-499152 CAGGCTGGCCACAAATTCCTGGG - Intergenic
900067258 1:740860-740882 CAGGCTGGCCACAAATTCCTGGG - Intergenic
900179056 1:1303445-1303467 CAGACGGGCCTCCAAGCCCCAGG - Intronic
900400024 1:2469239-2469261 CCGGGTGGCCCCAAAGCCCCAGG + Intronic
900577471 1:3390457-3390479 CAGACAAACCCCAAAACCCCAGG + Intronic
900843806 1:5079926-5079948 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
901106495 1:6760380-6760402 CAGACTGGTCCCAAACTCCTGGG - Intergenic
901370756 1:8795371-8795393 CAGGCTGGCCTCAAATTCCTGGG + Intronic
902214106 1:14924014-14924036 CAGACTGGCCCCAGTGCCCGGGG - Intronic
902864956 1:19271870-19271892 CAGGCTGGTCTCAAATCCCTGGG - Intergenic
903409201 1:23126405-23126427 CAGGCTGGCCCCAAACTCCTGGG - Intronic
903665191 1:25001734-25001756 CAGAGTGGCCCCAGAGCCCAAGG - Intergenic
903705383 1:25281762-25281784 CACCCACGCCCCAAATCCCCAGG + Intronic
903721845 1:25411568-25411590 CACCCACGCCCCAAATCCCCAGG - Intronic
904228473 1:29045563-29045585 CAGGCTGGTCTCAAATTCCCAGG + Intronic
904303837 1:29574151-29574173 CAAACTTGCCCCAAATGCCCTGG - Intergenic
904805141 1:33125949-33125971 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
907105633 1:51879824-51879846 CAGGCTGGTACCAAATTCCCAGG - Intergenic
907125594 1:52047690-52047712 CAGACTGGCCTCAAACTCCGGGG - Intronic
907541714 1:55221423-55221445 CAGGCTGGTCCCAAATCTCCTGG + Intergenic
907908361 1:58805684-58805706 CATTCAGGCCCCAAATCACCTGG - Intergenic
908396221 1:63728075-63728097 CAGACTGGTCTCAAATTCCTGGG - Intergenic
908437118 1:64117988-64118010 CAGGCTGGTCTCAAATCCCTGGG - Intronic
909000356 1:70210365-70210387 CAGACTGGTCTCAAACTCCCAGG + Intronic
911488570 1:98533503-98533525 CGGGCTGGCCTCAAATCCCTGGG - Intergenic
912712211 1:111958123-111958145 CAGGCTGTCCCCAAACCACCTGG + Intronic
913218853 1:116643532-116643554 CAGGCTGGCCTCAGATCACCAGG - Intronic
914227924 1:145737051-145737073 CAGACTGGCCTCAAACTCCTAGG - Intronic
915101528 1:153504343-153504365 CAGCCTGGCACCAGATCACCTGG + Intergenic
915641990 1:157234839-157234861 CAGACAGGTCCCCAGTCCCCAGG - Intergenic
916548885 1:165830821-165830843 CAGGCTGGCCTCAAACTCCCGGG - Intronic
916686672 1:167153465-167153487 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
917341720 1:173986488-173986510 CAGACTGGCCTCGAATTCCTGGG + Intronic
917468323 1:175304318-175304340 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
918291551 1:183113098-183113120 CAGACTGGTCTCAAACTCCCAGG - Intronic
918314559 1:183312304-183312326 CAGGCTGGTCCCAAATTCCTGGG + Intronic
918331561 1:183466038-183466060 CAGGCTGGCCCCAAACTCCTTGG + Intergenic
919182422 1:194103548-194103570 CAGGCTGGTCCCAACTCCACTGG + Intergenic
919304597 1:195815756-195815778 CAGACTGGTCTCAAACTCCCGGG - Intergenic
919452403 1:197787730-197787752 CAGGCTGGCCCCATAGCCCCAGG - Intergenic
919680042 1:200425115-200425137 CAGAATGGCCTCCAATTCCCGGG - Intergenic
920196851 1:204233657-204233679 CAGACTGGTCTCAAATTCCTGGG + Intronic
920682592 1:208084253-208084275 CAGGCTGAGCCCACATCCCCAGG - Intronic
921157314 1:212448862-212448884 CAGACTGGCCTCAAACACCTGGG - Intergenic
922002316 1:221491942-221491964 CAGACTGGTCTCAAATTCCTGGG - Intergenic
922101869 1:222483635-222483657 CAGGCTGGCCACAAATTCCTGGG - Intergenic
922104253 1:222499199-222499221 CAGACTGGTCTCAAATTCCTAGG - Intergenic
922262949 1:223958756-223958778 CAGGCTGGCCACAAATTCCTGGG - Intergenic
922496946 1:226064367-226064389 CAGACTGCCCGCAAATCGACCGG + Exonic
922641466 1:227236229-227236251 CAGACTGACCTCTAATCCCTTGG + Intronic
922713483 1:227851948-227851970 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
922782334 1:228263346-228263368 CAGACTGGTCTCAAATTCCAGGG - Intronic
923567528 1:235087675-235087697 CAGGCTGGTCTCAAATCCCTAGG - Intergenic
924093328 1:240524918-240524940 CTGCCTGACCCCAAAGCCCCTGG - Intronic
924474448 1:244371028-244371050 GAGCCTGGCCCCACAGCCCCAGG - Intronic
924699735 1:246439170-246439192 CAGGCTGGCCCCAAACTCCTGGG + Intronic
924906950 1:248465194-248465216 CAGGCTGGTCTCAAATACCCAGG - Intergenic
1062831685 10:609950-609972 CAGCCTGTCCCCAAAGCCCTCGG - Intronic
1062927642 10:1328779-1328801 CAGCCTGGTCTCAAATCCCTGGG - Intronic
1063023383 10:2153441-2153463 CAGGCTGGCCTCAAACTCCCCGG - Intergenic
1063402686 10:5762063-5762085 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1063554749 10:7067668-7067690 CAGACTGGTCCCAAACTCCCAGG + Intergenic
1063673976 10:8123390-8123412 CAGGCTGGACTCAAATTCCCGGG + Intergenic
1063770315 10:9189987-9190009 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
1064342344 10:14498808-14498830 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1064379546 10:14828793-14828815 CAGACTGGCTCCAAACTCCTGGG - Intronic
1064388839 10:14923590-14923612 CAGGCTGGCCTCAAATCCCTGGG - Intronic
1064902503 10:20310525-20310547 CAGGCTGGCCTCAAATTCCTAGG - Intergenic
1066094944 10:32063086-32063108 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1066387371 10:34952617-34952639 CAGACTGGCCTCAAATTCCTGGG + Intergenic
1066490088 10:35886031-35886053 CAGGCTGGCCTCAAACCCCTGGG + Intergenic
1066731544 10:38441317-38441339 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1067225656 10:44374259-44374281 CAGACTGGCCACCCCTCCCCAGG + Intronic
1067939546 10:50642691-50642713 CAGACTGGCCTCAAATTCCTGGG - Intergenic
1068587399 10:58814568-58814590 CAGACTGGTCTCAAACCCCTGGG - Intronic
1068875910 10:61996478-61996500 CAGGCTGGACCCAAAACTCCTGG - Intronic
1069032487 10:63612380-63612402 CAGACTGGCCTCAAACTCCTGGG + Intronic
1069447646 10:68488191-68488213 CAGACTGGCCTCAAACTCCTGGG + Intronic
1069476432 10:68737292-68737314 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1069518457 10:69098747-69098769 CAGGCTGGTCCCAAACCTCCTGG - Intronic
1069529939 10:69210042-69210064 CAGACTGGACCCAAACCTTCAGG - Intergenic
1069892170 10:71658772-71658794 CGGTCTGACCCCAAAGCCCCTGG + Intronic
1069968500 10:72143411-72143433 CAGACTGGCCTCAAACCCCTGGG + Intronic
1070173552 10:73951276-73951298 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1070258815 10:74833529-74833551 GAGACAGGTCCCAAATCTCCTGG - Intronic
1070614271 10:77957306-77957328 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1071440845 10:85692449-85692471 CAGACTGGCCTCAAACTCCTGGG - Intronic
1071531821 10:86395639-86395661 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1071850169 10:89560563-89560585 CAGGCTGGCCTCAAATTCCCGGG - Intergenic
1073148575 10:101296412-101296434 CAGACTGGCCTCAAATTCCTGGG + Intergenic
1073373229 10:103009479-103009501 CAGGCTGGTCTCAAATTCCCAGG - Intronic
1074357885 10:112802035-112802057 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1074683929 10:115940306-115940328 ACGACTGGCCCCAAATGGCCAGG - Intronic
1075792005 10:125091560-125091582 CAGACTGGTCTCAAACTCCCGGG - Intronic
1076377633 10:130002344-130002366 CAGACTGGCCCCTTCTCCACCGG + Intergenic
1076971389 11:135621-135643 CAGGCTGGCCACAAATTCCTGGG - Intergenic
1077079634 11:719473-719495 CAGGCTGGCCGCAGATCCTCAGG + Intronic
1077095391 11:796972-796994 CAGACTGGCCACAGCTCTCCGGG + Intronic
1077423325 11:2463025-2463047 CCGACTGGCCCCACTTCCCTGGG - Intronic
1077490360 11:2858230-2858252 CGGACTGGCCCCTGCTCCCCAGG + Intergenic
1077856750 11:6134047-6134069 CAGACTGACCTCAAACTCCCTGG - Intergenic
1078379142 11:10824057-10824079 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1078689803 11:13568003-13568025 CAGACTGGTCTCAAATCCCTGGG + Intergenic
1078745769 11:14112937-14112959 CAGGCAGGCCAGAAATCCCCTGG - Intronic
1078947191 11:16082522-16082544 CAGGATTTCCCCAAATCCCCAGG + Intronic
1079130230 11:17742997-17743019 CAGACTTGACCCAAATCCTTAGG + Intronic
1079150076 11:17890629-17890651 CAGACTGGTCTCAAACCCCTGGG + Intronic
1081371140 11:42305008-42305030 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1081765508 11:45607419-45607441 CAGACTGGTCTCAAACTCCCAGG + Intergenic
1081861671 11:46336515-46336537 CAGGCTGGTCCCAAATCCCTGGG - Intronic
1082262325 11:50086165-50086187 CAGTCTGGCCACAAATTCCTGGG - Intergenic
1082863430 11:57876505-57876527 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1083288922 11:61679431-61679453 CAGACTGGACTCCCATCCCCAGG + Intergenic
1083599431 11:63937777-63937799 CAGACTGGTCCCAAACTCCTGGG - Intergenic
1083730407 11:64649553-64649575 CAAAGTGGCCCCAAACCCCGGGG - Intronic
1083947605 11:65933113-65933135 CAGACTGGACTCAAATTCCTGGG - Intergenic
1084182924 11:67455604-67455626 CAGACAGGCCCCGAGGCCCCGGG + Exonic
1084709763 11:70836615-70836637 CAGTCTGGCACCAAATGCCCAGG - Intronic
1084833984 11:71789665-71789687 CCAACTGGCTCCACATCCCCAGG + Intronic
1085462170 11:76700774-76700796 CACCCTGGCCCCACAGCCCCAGG - Intergenic
1085539542 11:77253982-77254004 CAGAGTGGCCTAACATCCCCAGG - Intronic
1085613997 11:77980587-77980609 CAGACTGGTCTCAAATTCCTGGG + Intronic
1087013168 11:93532384-93532406 CATCCTGCCCCCAAACCCCCAGG + Intronic
1087656953 11:100935919-100935941 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1087922859 11:103886631-103886653 TAGACTGGCCCCTCATCACCAGG + Intergenic
1088631236 11:111775662-111775684 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1088765471 11:112971584-112971606 CAGACTGGCCTCAAACTCCTGGG + Intronic
1088882758 11:113984403-113984425 CAGACTGGCCTCAAACTCCTGGG - Intronic
1089053980 11:115569799-115569821 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1089413200 11:118264497-118264519 CAGACTGGCACCACCTCCTCTGG - Intronic
1089439842 11:118506068-118506090 CAGGCTGGTCCTGAATCCCCAGG - Exonic
1089838569 11:121393637-121393659 CACTCTGGCCACAATTCCCCAGG + Intergenic
1090411775 11:126514059-126514081 CAGACTACCCCCATGTCCCCTGG - Intronic
1090695680 11:129239058-129239080 CAGACTGGTCTCAAACCCCTGGG + Intronic
1090981937 11:131730502-131730524 CAGGCTGGTCCCAAACTCCCGGG - Intronic
1091106499 11:132924349-132924371 CAGACTGGACTCAAATTCCTGGG + Intronic
1091178589 11:133582856-133582878 CAGACTGCGCCCTAATCCTCAGG - Intergenic
1091426613 12:396003-396025 CAGACTGGACTCAAACCCCTGGG - Intronic
1091490587 12:929074-929096 CAGGCTGGTCTCAAATCCCTGGG + Intronic
1091795854 12:3297193-3297215 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1093557233 12:20490892-20490914 CAGACTGGTCTCAAACTCCCCGG - Intronic
1093612778 12:21182724-21182746 CAGGCTAGTCCCAAAACCCCAGG + Intronic
1094028457 12:25984287-25984309 CAGACTGACCTCAAACCCCTGGG + Intronic
1094653241 12:32398190-32398212 CAGACTGGTCTCCAATCCCTGGG - Intergenic
1095472079 12:42548094-42548116 CACACTGGCCTCAAATTCCTGGG + Intronic
1096381218 12:51159696-51159718 CAGGCTGGCCTCAAACTCCCAGG + Intronic
1096477090 12:51914952-51914974 CAGACTGGTCTCAAATTCCTAGG + Intronic
1097129697 12:56802885-56802907 TAGGCTGGCCCCAAATTCCTGGG + Intergenic
1097159109 12:57033567-57033589 CAGACTGGTCACAAATTCCTGGG + Intronic
1097431601 12:59515232-59515254 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1098296442 12:69008910-69008932 CAGGCTGGTCCCAGATTCCCAGG - Intergenic
1098625847 12:72666337-72666359 CAGACTGGTCTCAAACCCCTGGG - Exonic
1099010093 12:77281505-77281527 AAGACAGGCCCCATATCACCTGG + Intergenic
1099650086 12:85415655-85415677 CAGGCTGGTCTCAAATCCCGAGG - Intergenic
1100507100 12:95233014-95233036 CAGACTGGTCTCAAATTCCTTGG + Intronic
1101957463 12:109223544-109223566 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1102004169 12:109578306-109578328 CAGGCTGGTCCCAAATTCCTGGG + Intronic
1102094503 12:110226069-110226091 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1102321894 12:111943132-111943154 CAGACTGGCCTCGAATTCCTGGG + Intronic
1102331504 12:112035893-112035915 CAGACTGGTCTCAAAACTCCCGG + Intronic
1102639632 12:114355650-114355672 CAGACTGGCCTGCAGTCCCCTGG - Exonic
1102891689 12:116563953-116563975 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1102905023 12:116667794-116667816 CAGGCTGGTCTCGAATCCCCGGG - Intergenic
1102914352 12:116741859-116741881 CAGACTGGCCTCAAACTCCTGGG + Intronic
1102983053 12:117257649-117257671 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1103054830 12:117810521-117810543 CAGACTGGTCTCAAACCCCTGGG + Intronic
1103186629 12:118963605-118963627 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1103324044 12:120108685-120108707 CAAGCTGCTCCCAAATCCCCTGG + Intronic
1103359098 12:120342978-120343000 CTGCCTGCCCCCAACTCCCCGGG - Exonic
1103469620 12:121169693-121169715 CAGGCTAGCCTCAAACCCCCGGG - Intronic
1103482461 12:121259870-121259892 CAGCCTGGCCTCAAATGCCTGGG - Intronic
1103504816 12:121435121-121435143 CAGACTGGTCTCAAACCCCTGGG - Intronic
1103585322 12:121949374-121949396 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1103654524 12:122459592-122459614 CAGGCTGGCCTCAAATTCCAGGG - Intergenic
1103697989 12:122832527-122832549 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1104764512 12:131317868-131317890 CAGCCTGGGCTCAAACCCCCGGG + Intergenic
1105308200 13:19183687-19183709 CAGGCTGGACTCAAAACCCCTGG + Intronic
1105481763 13:20784730-20784752 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1105504024 13:20994682-20994704 CAGTCTGGCCTCAAACTCCCGGG - Intronic
1105538029 13:21288025-21288047 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1106010344 13:25814803-25814825 CAGACTGGTCGCAAATTCCTTGG - Intronic
1106171207 13:27290168-27290190 CAGGCTGCCCTCAAATTCCCCGG + Intergenic
1106310759 13:28552083-28552105 CAGACTGGTCTCAAAACTCCTGG + Intergenic
1106501505 13:30333602-30333624 CAGGCTGGTCTCAAACCCCCGGG - Intergenic
1106604295 13:31213377-31213399 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1106747994 13:32724326-32724348 CAGACTGGTCTCAAATTCCTGGG + Intronic
1107502787 13:40997601-40997623 CAGGCTGGTCTCAAATTCCCAGG + Intronic
1107691504 13:42957980-42958002 CAGACTGGTCTCAAAGCCCTGGG + Intronic
1107842783 13:44476876-44476898 CAGGCTGGTCTCAAAACCCCTGG + Intronic
1108335264 13:49434643-49434665 CAGGCTGGTCCCAAACTCCCAGG - Intronic
1108868572 13:54952855-54952877 CAGACTGGTCTCAAATTCCTAGG - Intergenic
1109130445 13:58578045-58578067 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1109783749 13:67147660-67147682 AAGACAGTCCCCAAATTCCCTGG - Intronic
1110105853 13:71675079-71675101 CAGACTGCCCGCAAATCGACCGG + Intronic
1111018713 13:82417436-82417458 CAGGCTGGCCCCAAAACTCCTGG + Intergenic
1111213649 13:85114173-85114195 CAGACTGGTCTCAAACCCCTGGG - Intergenic
1111618888 13:90697878-90697900 CAGGCTGGTCCCAAACTCCCGGG - Intergenic
1112842509 13:103598634-103598656 CAGACTAGCCCCAAACTTCCTGG + Intergenic
1113309953 13:109121721-109121743 CACAGTGGCCCCAAACCCCCAGG + Intronic
1113826219 13:113256109-113256131 CAGGCTGGCCTCAAACTCCCGGG - Intronic
1114496085 14:23133225-23133247 CAGACTGGCCTCAAACTTCCGGG - Intronic
1115218523 14:31036291-31036313 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1115556704 14:34549890-34549912 CAGATTGGCCTCAAACTCCCGGG - Intergenic
1115863431 14:37714965-37714987 CAGACTGGTCTCAAATTCCTGGG - Intronic
1117586441 14:57212073-57212095 CAGGCTGGTCCCAAACTCCCGGG + Intronic
1118211569 14:63770587-63770609 CAGGCTGGTCCCAAACTCCCTGG - Intergenic
1118326966 14:64787802-64787824 CAGACTGACCCCAGGCCCCCAGG - Intronic
1118624307 14:67643611-67643633 CAGACTGGCCTCAAACTCCTGGG - Intronic
1118863606 14:69684776-69684798 CATAATGGCCCCACATCTCCTGG - Intronic
1119024820 14:71144202-71144224 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1119140538 14:72263385-72263407 CAGGCTGGAGCCAAATCTCCAGG - Intronic
1119632345 14:76243971-76243993 CATAGTGGCCCCAATTCCCTTGG + Intronic
1119865357 14:77968653-77968675 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1120713621 14:87817820-87817842 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1120812343 14:88816984-88817006 GAGACTGGCCTCAAATTCCTGGG + Intergenic
1120834328 14:89026972-89026994 CAGAGTGGCCTCAGGTCCCCGGG - Intergenic
1120851117 14:89172294-89172316 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1120990148 14:90368366-90368388 CAGCCTGGCCTCAAAACTCCTGG + Intergenic
1121408791 14:93735155-93735177 CAGACACGCCCCACTTCCCCTGG - Intronic
1122193539 14:100067530-100067552 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1122529128 14:102412882-102412904 CAGACTGGTCTCAAATTCCTGGG - Intronic
1122622478 14:103067661-103067683 CAGGCTGGTCCCAAACTCCCAGG + Intergenic
1122692164 14:103536559-103536581 CAGCCTGACCCCAAAGCTCCTGG - Exonic
1122766620 14:104076250-104076272 CAGACTGGTCTCAAACTCCCAGG - Intergenic
1122921690 14:104882920-104882942 GAGACAGGCCCCATGTCCCCCGG - Intronic
1122984101 14:105204262-105204284 CAGGCTGGCCTTAAATCCCTGGG - Intergenic
1123102535 14:105815028-105815050 CAGGCTGGTCCCAAACCTCCTGG + Intergenic
1123704503 15:22941270-22941292 CAGACTGGTCTCAAATTCCTGGG + Intronic
1123762585 15:23444280-23444302 CAGAATGGCACCAATGCCCCAGG + Intronic
1124183276 15:27498698-27498720 CAGCCTGGCCTCAAATAGCCTGG - Intronic
1124446186 15:29735376-29735398 CAGACTGGTCTCAAATTCCTGGG - Intronic
1124578920 15:30934589-30934611 CAGGCTGATCTCAAATCCCCAGG + Intronic
1125028621 15:35054715-35054737 CAGACTGGTCTCAAAACTCCTGG - Intergenic
1125327223 15:38548350-38548372 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1125465861 15:39951768-39951790 GAGACTGCCCACAAATCCACAGG - Intronic
1125673315 15:41488728-41488750 CAGGCTGGCCTCAAATTCCTAGG + Intergenic
1125810732 15:42538968-42538990 CAGGCTGGCCCCAAACTCCTGGG - Exonic
1126029174 15:44479174-44479196 CAAACTGGTCTCAAATTCCCAGG - Intronic
1126077349 15:44923984-44924006 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1126081372 15:44966886-44966908 CAGACTGGTCTCAAATTCCTAGG - Intronic
1128499943 15:68221060-68221082 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1128516300 15:68344085-68344107 AAGCCTGGCCCCATATCCTCAGG - Intronic
1128683899 15:69669759-69669781 CTGACTGGACCCAAATCTCTGGG + Intergenic
1128864055 15:71099752-71099774 CAGGCTGGTCTCAAATCCCTGGG - Intronic
1128967880 15:72078601-72078623 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1129593566 15:76940252-76940274 CAGACTGGCCTCAAATTCCTGGG - Intronic
1129732611 15:77940653-77940675 CCCTCTGGCCCCAAATCCCACGG - Intergenic
1129813427 15:78530044-78530066 CAGACTGGCCTCAAACTCCTGGG + Intronic
1129870874 15:78940371-78940393 CAGACTGGTCCCAAACTCCTAGG - Intronic
1130121859 15:81057031-81057053 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1130289120 15:82581184-82581206 CAGGCTGGCCCCAAACTCCTGGG + Intronic
1130313817 15:82778058-82778080 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1130614083 15:85387533-85387555 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1131161640 15:90108994-90109016 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1131235171 15:90690415-90690437 CAGACTGGTCTCAAATTCCTAGG + Intergenic
1132105972 15:99062885-99062907 CAGCCTGGGCTCAAATCCCAGGG - Intergenic
1132184539 15:99792043-99792065 CAGACTGGCCCCTAGTCACTGGG - Intergenic
1132415341 15:101615181-101615203 CAAACTGTCCCCAAAGCTCCTGG - Intergenic
1132709956 16:1262063-1262085 CAGGCTGGCCTCAAACTCCCCGG + Intergenic
1132848264 16:2010831-2010853 CAGGCTGGTCTCAAATTCCCAGG - Intronic
1133054573 16:3139107-3139129 CAGCCTGGACCCAAAGGCCCTGG - Intronic
1133317653 16:4894373-4894395 CAGGCTGAGTCCAAATCCCCGGG + Intronic
1133378037 16:5305845-5305867 CAGACTGGTCCCAAACTCCTAGG - Intergenic
1133743512 16:8669717-8669739 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1133974703 16:10592208-10592230 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1134123682 16:11601768-11601790 CAGACTGGTCTCAAATTCCTGGG + Intronic
1134502850 16:14782676-14782698 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1134577713 16:15346219-15346241 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1134622361 16:15699092-15699114 CAGACTGGTCTCAAACCTCCTGG + Intronic
1134724875 16:16411328-16411350 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1134942557 16:18300531-18300553 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1135161086 16:20097030-20097052 CAGACTGGGCTCAAACCCCTGGG + Intergenic
1135649661 16:24194991-24195013 CAGACTGGTCTCAAATTCCTGGG - Intronic
1135831801 16:25780960-25780982 AAGGCTGGCCCCACACCCCCAGG + Intronic
1136125769 16:28179272-28179294 CAGACTGGTCTCAAACCCCTGGG + Intronic
1136553488 16:30994371-30994393 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1136591462 16:31220247-31220269 CAGACTGGTCTCAAATGCCTGGG + Intronic
1137541230 16:49363349-49363371 CAGGCTGGCCTCAAAACTCCTGG + Intergenic
1137876372 16:52000167-52000189 CAGGCTGGTCTCAAATCCCTGGG - Intergenic
1138377742 16:56577635-56577657 CAGACTGGTCTCAAACTCCCTGG - Intergenic
1138648913 16:58446080-58446102 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1139009754 16:62617310-62617332 CAGCCTGGTCCCAGTTCCCCAGG + Intergenic
1139491419 16:67288104-67288126 TAGCCTGGCCCCAGATCCCAAGG - Intronic
1139826963 16:69764991-69765013 CAGGCTGGTCCCAAATTCCTGGG - Intronic
1140122125 16:72093044-72093066 CAGGCTGGTCTCAACTCCCCAGG + Intronic
1140135786 16:72204410-72204432 CAGACTGGTCTCAAAACTCCTGG + Intergenic
1140162486 16:72512577-72512599 CAGGGTAGCCTCAAATCCCCAGG + Intergenic
1140208656 16:72953782-72953804 CAGACTGGTCTCAAACTCCCAGG + Intronic
1140488248 16:75311813-75311835 CAGACTGGCCCCGAACTCCTGGG + Intronic
1140576665 16:76178562-76178584 CAGGCTGGTCCCAAATTCCTGGG - Intergenic
1141144997 16:81523128-81523150 CAGACTGGCCTCGAATTCCTGGG + Intronic
1141158432 16:81612761-81612783 CAGCCAGACCCCAAGTCCCCCGG - Intronic
1141365994 16:83443658-83443680 CAGGCTGGCCTCAAATTCCCAGG - Intronic
1141710047 16:85693358-85693380 TAGACTGGCCTCAAATTCCTGGG + Intronic
1141736974 16:85860391-85860413 CAGAATGGATCCTAATCCCCAGG - Intergenic
1141932590 16:87216039-87216061 TAGAGTGGCCCCAAATCCTTGGG + Intronic
1141985620 16:87577755-87577777 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1142137154 16:88456685-88456707 CAGGCTGGCCCCCCAGCCCCAGG - Intronic
1142301281 16:89259656-89259678 CAGGCTGGTCTCAAATCCCTGGG + Intergenic
1142448862 16:90161901-90161923 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1142458625 17:73388-73410 CAGGCTGGCCACAAATTCCTGGG - Intergenic
1142793874 17:2291660-2291682 CAGGCTGGCCTCAAAACACCTGG - Intronic
1142863995 17:2779451-2779473 CAGTCTGGCCCCTGAGCCCCAGG - Intronic
1143079670 17:4372100-4372122 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1143185706 17:5008747-5008769 CAGAAGGACCCCAAAGCCCCAGG - Intronic
1143212635 17:5200015-5200037 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1143384257 17:6517768-6517790 CAGGCTGGTCCCAAATTCCTGGG + Intronic
1143398196 17:6619635-6619657 CAGGCTGGTCCCAAACCCCTGGG + Intronic
1143797574 17:9349945-9349967 CAGACTGGCCCTCAAACTCCTGG + Intronic
1145861879 17:28217882-28217904 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1145899617 17:28481869-28481891 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1145902349 17:28497035-28497057 TGGACTGCCCCCAAGTCCCCAGG - Intronic
1146132249 17:30288555-30288577 CAGACTGGTCTCAAATTCCTGGG + Intronic
1146358348 17:32154228-32154250 CAGGCTGGCCTCAAACCCCTGGG - Intronic
1147127753 17:38383956-38383978 GACACTGGTCACAAATCCCCAGG - Intronic
1147349295 17:39827516-39827538 CAGGCTGGGCCCAAATTCCTGGG + Intronic
1147415135 17:40283455-40283477 CAGACTGGTCTCAAATTCCTGGG + Exonic
1147511851 17:41076679-41076701 CAGGCTGGCTTCAAATCCCTGGG - Intergenic
1147675946 17:42205697-42205719 CAGACTGGTCTCAAATTCCTGGG - Intronic
1148023784 17:44571075-44571097 CAGACTGGCCTCAAATTCCTGGG - Intergenic
1148244685 17:46022852-46022874 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1148454705 17:47804834-47804856 CAGACTGGGGCCAGAACCCCAGG + Intergenic
1148642434 17:49198333-49198355 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1148822442 17:50367425-50367447 CAGTCAGGCCCCAACTGCCCTGG - Intergenic
1148882603 17:50741872-50741894 CAGACTGGTCTCAAATTCTCCGG - Intronic
1148916166 17:50980785-50980807 CAGACTGGCCTCAAACTCCTGGG - Intronic
1149540435 17:57464230-57464252 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1149611659 17:57961996-57962018 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1149616263 17:58002800-58002822 CAGGCTGGTCCCAAAACTCCTGG - Intronic
1149674611 17:58447936-58447958 CAGACTGGCCTCAAACTCCTGGG - Intronic
1149692044 17:58585664-58585686 CAGGCTGGTCCCAAATTCCTGGG + Intronic
1149897630 17:60441313-60441335 CTGACAGGCCACAGATCCCCGGG + Intergenic
1150161889 17:62905512-62905534 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1150176851 17:63066332-63066354 CAGGCTGGCCCCACATACCCAGG - Intronic
1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG + Intronic
1150268337 17:63845556-63845578 CAGGCTGGCCTCAAACCCCTGGG + Intergenic
1150681774 17:67290437-67290459 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1151463395 17:74269062-74269084 CAGGCTGGTCCCAAATTCCTGGG - Intergenic
1151601083 17:75106540-75106562 CAGGCTGGCCTCAAACTCCCAGG - Intergenic
1151632017 17:75317453-75317475 CAGACTGGCCTCAAAACTCCTGG + Intergenic
1152222662 17:79077538-79077560 CTGACCTGCCCCAAAGCCCCAGG - Intronic
1152525920 17:80888324-80888346 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1152910390 17:83001970-83001992 CAGACTGGTCTTAAATCCCCAGG + Intronic
1153209113 18:2739872-2739894 CAGGCTGGCCTCAAACCCCTTGG - Intronic
1153628757 18:7048460-7048482 CAGGCTGGTCCCAAACTCCCAGG + Intronic
1153671399 18:7415693-7415715 CAGGCTGGCCCCAAATTCCTGGG + Intergenic
1153853764 18:9124331-9124353 CAGACTGGTCTCAAATTCCTGGG + Intronic
1153889386 18:9498577-9498599 CAGGCTGGCCTCAAAACTCCTGG + Intronic
1153910310 18:9700977-9700999 CAGGCTGGTCTCAAAACCCCTGG + Intergenic
1154305286 18:13226229-13226251 CAGGCTGGTCTCAAATTCCCGGG + Intronic
1155008459 18:21750984-21751006 CAGGCTGGTCTCAAATCCCTGGG - Intronic
1155744046 18:29328386-29328408 CAGACTGGCCTCAAACTCCTAGG - Intergenic
1157245605 18:46051672-46051694 CAGAAAAGCCCCAAACCCCCAGG + Intronic
1158719797 18:59914738-59914760 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1159586206 18:70286077-70286099 CAGGCTGGTCTCAAATTCCCTGG + Intergenic
1160648342 19:205901-205923 CAGGCTGGCCACAAATTCCTGGG - Intergenic
1160937545 19:1604287-1604309 CAGGCTGGTCTCAAATTCCCAGG + Intronic
1161108327 19:2455482-2455504 CAGGGAGCCCCCAAATCCCCAGG + Intronic
1161160137 19:2757223-2757245 CAGACAGGCTCCACAGCCCCCGG + Intronic
1161251593 19:3283558-3283580 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1161305859 19:3567457-3567479 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1161334897 19:3707793-3707815 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
1161350399 19:3787971-3787993 CAGGCTGGCCTCAAATGCCTGGG + Intronic
1162143821 19:8600874-8600896 CAGGCTGGCTCCAAGTCCTCAGG + Intronic
1162301080 19:9845563-9845585 CAGGCTGGCCTCAAACCCCTGGG - Intronic
1162699572 19:12503839-12503861 CAGACTGGTCTCAAACTCCCGGG - Intronic
1162976776 19:14211045-14211067 CAGACTGGTCTCAAACTCCCGGG + Intergenic
1163613669 19:18313724-18313746 CAGACTGGTCCCAAACTCCTGGG + Intronic
1163750023 19:19071215-19071237 CAGACTGGTCTCAAACCCCTGGG + Intronic
1163763759 19:19151040-19151062 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1165464239 19:35963165-35963187 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1165845127 19:38813099-38813121 CAGCCAGGACCCAAATCACCTGG + Exonic
1165934983 19:39383733-39383755 CTGGCTGCCCCCAACTCCCCGGG - Exonic
1166034895 19:40160990-40161012 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1166111576 19:40626376-40626398 CATCCTGGCCCCAGACCCCCTGG + Intronic
1166519023 19:43467090-43467112 CAGCCTGGTCTCAAAACCCCTGG - Intergenic
1166537498 19:43583907-43583929 CAGACTGGTCTCAAATTCCTGGG - Intronic
1166548692 19:43650534-43650556 CAGGCTGGTCTCAAATCCCTAGG + Intronic
1166674978 19:44734835-44734857 CAGGCTGGTCCCAAATTCCTGGG + Intergenic
1166687602 19:44805176-44805198 CAGGCTGGTCCCAAATTCCTGGG + Intergenic
1166701197 19:44882639-44882661 CAGACTGGGCTCAAATTCCTGGG - Intronic
1166828908 19:45626675-45626697 CAGCCTGTCCCCCAAACCCCTGG + Intronic
1166953711 19:46447873-46447895 CAGTCTGTCTGCAAATCCCCAGG + Intergenic
1166974550 19:46597596-46597618 CAGACTGGCCTCAAACTCCTAGG + Intronic
1167352622 19:48985245-48985267 CAGGCTGGTCTCAAATTCCCGGG + Intronic
1167648294 19:50717382-50717404 CAGCCTGGCCCCTCATCCCAGGG + Intronic
1167659890 19:50790423-50790445 CAGGGTGGCCCCAAAACCCCAGG - Exonic
1168317642 19:55491009-55491031 GAGACTGCCCCCGAAGCCCCTGG + Exonic
925669956 2:6300872-6300894 CAGACTGGCCTTAAACCCCTGGG + Intergenic
926646775 2:15298132-15298154 CAGGCTGGTCCCAAACCCCTGGG - Intronic
926671505 2:15581238-15581260 CAGACTGGTCTCAAATGCCTGGG - Intergenic
927153051 2:20206473-20206495 CACACTGGCCCCAAGACCTCAGG + Intronic
927977926 2:27353932-27353954 CAGACTGGTCTCAAATTCCTGGG + Intronic
929512599 2:42576552-42576574 CAGGCTGGTCTCAAACCCCCAGG - Intronic
929853892 2:45619371-45619393 CAGACTGGCCTCAAACTCCTGGG + Intergenic
930069624 2:47355597-47355619 CAGGCTGGCCTCAAATTCCTGGG + Intronic
931490002 2:62735103-62735125 CAGGCTGGCCTCAAACCCCTGGG + Intronic
931697867 2:64885209-64885231 CAGACTGGCCTCAAACTCCTGGG + Intergenic
934103267 2:88673172-88673194 CAGACTGGCCTCAAACTCCTGGG - Intergenic
935517113 2:104053599-104053621 CAGACTTTCCCAAGATCCCCAGG + Intergenic
937088910 2:119192018-119192040 CAGGCTGGTCACAAATTCCCAGG - Intergenic
937393870 2:121517642-121517664 CAGGCTGGTCCCAAACCCCTGGG - Intronic
937866745 2:126757785-126757807 GAGAATGGCTGCAAATCCCCTGG + Intergenic
938023881 2:127928063-127928085 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
938124797 2:128664119-128664141 ATGACTGGCCCCAAAACTCCTGG - Intergenic
938860458 2:135362697-135362719 CAGGCTGGCCTCAAATTCCTAGG + Intronic
938871056 2:135476929-135476951 CAGACTGGTCTCAAATTCCTGGG + Intronic
939111987 2:138019394-138019416 CAGACTGGACATAAATCCCAGGG + Intergenic
939488897 2:142852962-142852984 CAGGCTGGTCCCAAATTCCTGGG - Intergenic
939572640 2:143858540-143858562 CAGACTGGTCTCAAACCCCTGGG + Intergenic
939721510 2:145658559-145658581 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
940541657 2:155027999-155028021 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
940560985 2:155296475-155296497 CAGACTGGCCTCAAATTCCCGGG - Intergenic
940563066 2:155326220-155326242 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
940845064 2:158631599-158631621 CAGACTGGTCTCAAATTCCTGGG + Intronic
942319057 2:174719923-174719945 CAGACTGCCCGCAAATCGACCGG + Intergenic
943905403 2:193493906-193493928 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
944091767 2:195919553-195919575 CAGACTGGTCTCAAATTCCTGGG + Intronic
944453882 2:199873704-199873726 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
946202273 2:218077423-218077445 CAGACTGGTCTCAAATTCCTAGG + Intronic
946267452 2:218559094-218559116 CAGGCTGGTCTCAAATTCCCAGG - Intronic
946428581 2:219613066-219613088 CAGTCTGGCCCCACCTCCCCAGG + Intronic
946810230 2:223515621-223515643 CAGACTGGTCTCAAACCCCTAGG - Intergenic
947595480 2:231409037-231409059 CAGGCTGGTCCCAAATTCCTGGG - Intergenic
1169076586 20:2763606-2763628 CAGGCTGGCCTCAAACCCCTGGG - Intergenic
1169168758 20:3446955-3446977 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1169450204 20:5704464-5704486 CAGGCTGGTCCCAAACCCCTCGG + Intergenic
1170240124 20:14155949-14155971 CAGACTGGTCTCAAATTCCCAGG - Intronic
1170411576 20:16097786-16097808 CAGGCTGGCCTCAAACCCCTGGG - Intergenic
1170832786 20:19857773-19857795 CAGACTGGCTTCAAATTCCTGGG - Intergenic
1170898099 20:20434723-20434745 CAGACTGGCCTCAAACTCCTGGG - Intronic
1172032230 20:31990239-31990261 CAGACTGGTCTCAAACTCCCCGG + Intronic
1172131401 20:32658501-32658523 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1172270172 20:33650575-33650597 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1172460705 20:35116214-35116236 CAGGCTGGTCTCAAATCCCTGGG + Intronic
1172663439 20:36583069-36583091 CAGGCTGGCCTCAAAACACCTGG - Intronic
1172841581 20:37905335-37905357 CAGACTGGCACCCAAGTCCCTGG - Intronic
1173604513 20:44322119-44322141 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1174253769 20:49238818-49238840 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1175161921 20:57014671-57014693 CAGGCTGGTCCCAAATTCCTGGG + Intergenic
1175326857 20:58135585-58135607 CAAACTGGCACCACATCCGCGGG - Intergenic
1175852352 20:62100335-62100357 CAGCCTGGCCCTGACTCCCCAGG + Intergenic
1176210443 20:63918303-63918325 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1176421727 21:6521537-6521559 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1177165679 21:17600608-17600630 CAGACTGGTCTCAAATTCCTGGG - Intronic
1177507455 21:22037130-22037152 CAGACTGGCCTCAAACTCCTAGG + Intergenic
1177823586 21:26058723-26058745 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1178939045 21:36889744-36889766 CAGACTGGACCCATGTCCCTGGG + Intronic
1179697217 21:43129853-43129875 CAGACTGGTCTCAAATTCCTGGG - Intergenic
1179885872 21:44314079-44314101 AAGGCTGGTCCCAAAACCCCAGG - Intronic
1179971331 21:44837856-44837878 CAGCTTGGCCCCAAACACCCTGG - Intergenic
1180145370 21:45915715-45915737 CAGACTGTCCCCAGGGCCCCAGG - Intronic
1180608416 22:17079288-17079310 CAGGCTGGCCTCAAACCCCTGGG - Intergenic
1180788969 22:18563552-18563574 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1180820155 22:18821594-18821616 CAGGCTGGCCTCAGATCACCAGG - Intergenic
1180919101 22:19510167-19510189 CAGACTGGTCTCAAATTCCTAGG + Intronic
1180977874 22:19860377-19860399 CAGGCTGGTCCCAAACCCCTGGG + Intergenic
1181048221 22:20226613-20226635 CAGGCTGGTCCCAGGTCCCCAGG + Intergenic
1181171828 22:21014285-21014307 CAGACTCCGCCCACATCCCCGGG - Intronic
1181206378 22:21256066-21256088 CAGGCTGGCCTCAGATCACCAGG - Intergenic
1181232767 22:21431768-21431790 CAGACTGGCCTCAAACTCCTGGG - Intronic
1181245884 22:21503088-21503110 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1181258395 22:21579558-21579580 CAGACTGGTCTCAAATTCCTAGG - Intronic
1181397563 22:22632881-22632903 CAGACTGGCCTCAAATGCCAGGG + Intergenic
1181701768 22:24625474-24625496 CAGACTGGTCTCAAACTCCCGGG + Intronic
1181705535 22:24647562-24647584 CAGACTGGCCTCAAATGCCAGGG + Intergenic
1182027101 22:27128745-27128767 CAGGCTGACCCCAAGCCCCCAGG - Intergenic
1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG + Exonic
1182794008 22:32977230-32977252 CTGACGGGCCCCAGAGCCCCTGG + Intronic
1183248502 22:36711691-36711713 CAGACTGGACCCCGACCCCCAGG - Intergenic
1183916478 22:41124584-41124606 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1184063293 22:42098926-42098948 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1184243551 22:43223974-43223996 AAGCTTTGCCCCAAATCCCCAGG + Intronic
1184344157 22:43902869-43902891 CAGGCTGGCCTCAAACCCCTAGG + Intergenic
1184630240 22:45771831-45771853 CAGACTGACCTCAAATTCCTTGG + Intronic
1203220542 22_KI270731v1_random:39357-39379 CAGGCTGGCCTCAGATCACCAGG + Intergenic
1203270282 22_KI270734v1_random:47465-47487 CAGGCTGGCCTCAGATCACCAGG - Intergenic
949529551 3:4940823-4940845 CAGACTGGCCTCAAACTCCTGGG - Intergenic
950128509 3:10526316-10526338 CAGACTGTCCTCAAAGCCCAGGG + Intronic
950390173 3:12690349-12690371 CAGACTGGTCTCAAATTTCCTGG + Intergenic
950450350 3:13061720-13061742 CAGACTTGCCCCAAACTGCCAGG + Intronic
952364147 3:32660189-32660211 CAGACTGGTCTCAAACCCCTGGG + Intergenic
953981815 3:47417241-47417263 CAGAAAGGCCCACAATCCCCGGG + Intronic
954007931 3:47607830-47607852 CAGACTGGACCCAAATTCCTGGG - Intronic
954018445 3:47716897-47716919 CAGACTGGCCTCAAATTCCTGGG - Intronic
954032296 3:47828247-47828269 CAGGCTGGTCCCAAACCCCTGGG - Intronic
954369708 3:50163743-50163765 CACACTGGCCTCAAAGCTCCTGG - Intronic
954453717 3:50585695-50585717 CAGCTTGGCCCCAAATCACCTGG + Intergenic
954844740 3:53545663-53545685 CAGACTGACCTCAAAATCCCTGG + Intronic
955115121 3:55990624-55990646 CAGGCTGGCCTCAAACCCCTAGG + Intronic
955192942 3:56778743-56778765 CAGACTGGTCTCAAATTCCTGGG + Intronic
956894683 3:73648098-73648120 CAGGCTGGTCCCAAATTCCTGGG + Intergenic
957058703 3:75463884-75463906 CAGGCTGGTCTCAAATTCCCGGG + Intergenic
958812384 3:98876309-98876331 CAGGCTGGCCTCAAACCCCTGGG - Intronic
959930920 3:111981091-111981113 CAGACTGGTCTCAAACTCCCAGG - Intronic
960760262 3:121065616-121065638 CAGGCTGGCCTCAAACCCCTAGG + Intronic
960923177 3:122769079-122769101 CAGACTGGTCTCAAATTCCTGGG - Intronic
961018993 3:123488215-123488237 CAGGCTGGCCCCAAACTCCTGGG - Intergenic
962308436 3:134309113-134309135 CAGGCTGGCCTCAAACCCCTGGG - Intergenic
962616702 3:137133822-137133844 CAGAAAGCCCCCACATCCCCAGG + Intergenic
963800686 3:149673163-149673185 CAGACTGGCCTCAAACTCCTGGG - Intronic
963804441 3:149709183-149709205 CAGGCTGGCCTCAAATTCCTGGG + Intronic
964627127 3:158770533-158770555 CAGACTGGCCCCGGAGCACCTGG - Intronic
964750338 3:160048520-160048542 CAGACTGGTCTCAAACTCCCAGG + Intergenic
964790783 3:160451866-160451888 CAGACTGCTCTCAAATTCCCGGG - Intronic
966164112 3:176997915-176997937 CAGACCTGCCCCAAAGCCCAAGG + Intergenic
966856100 3:184194763-184194785 CAGGCTGGCCGCAAACCCCTGGG - Intronic
966968599 3:185020679-185020701 CAGACTGGTCTCAAATTCCTAGG + Intronic
967066361 3:185920483-185920505 CAGGCTGGTCTCAAATTCCCGGG + Intronic
967971152 3:195000446-195000468 CAGGCTCTCCCCAAAACCCCAGG + Intergenic
968369504 3:198214214-198214236 CAGGCTGGCCACAAATTCCTGGG + Intergenic
968596400 4:1488274-1488296 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
969297565 4:6278835-6278857 GAGGCTGGGCCCAAATCCCGGGG - Intronic
969379219 4:6783093-6783115 CAGGCTGGCCCCGGAGCCCCCGG - Intronic
969591599 4:8125477-8125499 CAGTCTGGCACCAAGGCCCCAGG - Intronic
970420298 4:15899530-15899552 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
972463150 4:39325591-39325613 CAGACTGGTCTCAAACTCCCAGG + Intronic
972593422 4:40509524-40509546 CAGACTGGTCTCAAATTCCTGGG - Intronic
973303765 4:48619710-48619732 CAGACTGGTCTCAAATTCCTGGG + Intronic
973769326 4:54192073-54192095 CAGGCTGGCCTCAAACCCCTGGG - Intronic
973953818 4:56042811-56042833 CAGACTGGCCTCAAACTCCTGGG + Intergenic
974017932 4:56666030-56666052 CAGACTGGCCCCAACCCACAGGG - Intronic
974396312 4:61339856-61339878 CAGACTGGCTTCAAAACACCTGG - Intronic
975134575 4:70862115-70862137 CAGACTGGTCTCAAATTCCTGGG - Intergenic
975155608 4:71068775-71068797 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
978374400 4:108059893-108059915 CAGACTGGTCTCAAATTCCTGGG + Intronic
978781880 4:112565003-112565025 CAGACTGCCCACAAATCAACCGG + Intronic
979257928 4:118623926-118623948 CAGGCTGGCCACAAATTCCTGGG + Intergenic
979265794 4:118701394-118701416 CAGGCTGGCCCCAAACTCCTGGG + Intronic
979330421 4:119416637-119416659 CAGGCTGGCCACAAATTCCTGGG - Intergenic
980521723 4:133945088-133945110 CAGACTGACCTCAAACCCCTGGG - Intergenic
980895578 4:138856627-138856649 CAGGCTGGCCTCAAACCCCTGGG - Intergenic
980911469 4:138998353-138998375 CAGACTGGTCTCAAATACCTGGG + Intergenic
980951685 4:139385204-139385226 CAGACTGGCCTCAAATTCCTGGG - Intronic
980986331 4:139698517-139698539 CAGACTGCCCGCAAATCGACCGG - Intronic
981053403 4:140334127-140334149 CAGACTGGTCTCAAACTCCCAGG + Intronic
982051001 4:151502103-151502125 CAGACTGGTCTCAAATTCCTGGG - Intronic
982345589 4:154354134-154354156 CAGACTGGCCTCGAATTCCTGGG + Intronic
982710469 4:158753592-158753614 CAGGCTGGTCTCAAATCCCTGGG - Intergenic
983070449 4:163261701-163261723 CAGACTGGTCTCAAATCCCTAGG + Intergenic
983198916 4:164839496-164839518 CAGACTGGTCTCAAAACCCTGGG + Intergenic
983637273 4:169910659-169910681 CAGACTGGTCCCAAACTCCTGGG - Intergenic
983986297 4:174064011-174064033 CAGACTGGTCTCAAATTCCTGGG + Intergenic
984401452 4:179270872-179270894 CAGACTGGTCTCAAATTCCTGGG + Intergenic
984887360 4:184461952-184461974 CAGTCCTGCCCCACATCCCCAGG + Intronic
985080256 4:186257845-186257867 CAGACTGGTCTCAAATTCCTAGG - Intronic
985383668 4:189422249-189422271 CAGACGGGCCTCAGATACCCTGG - Intergenic
985977055 5:3428418-3428440 GGGACTGGCTCCAACTCCCCCGG - Intergenic
986682226 5:10244481-10244503 CAGGCTGGTCTCAAATTCCCGGG - Intronic
987080789 5:14423604-14423626 CACACTGGAGCTAAATCCCCAGG - Intronic
988326574 5:29776486-29776508 CAGGCTGGTCCCAAATTCCTAGG + Intergenic
988440863 5:31231272-31231294 AAGACTGGCCTGAAATTCCCAGG + Intronic
988552551 5:32209884-32209906 CAGACTGGTCTCAAACTCCCGGG + Intergenic
989392190 5:40912567-40912589 CAGGCTGGCCTCAAATTCCTGGG + Intronic
989484479 5:41973464-41973486 CAGACTGGTCTCAAACCCCTGGG - Intergenic
991384298 5:66067898-66067920 CAGGCTGGCCTCAAATTCCTGGG - Intronic
992790221 5:80206857-80206879 CAGACTGGCCTCAAACTCCTGGG + Intronic
992984850 5:82217760-82217782 CAGGCTGGCCTCAAATTCCTGGG - Intronic
994191932 5:96878581-96878603 CAGGCTGGCCTCAAATTCCTGGG - Intronic
994891307 5:105639763-105639785 CAGCCTGGCCCCAAGGCCTCAGG - Intergenic
995766294 5:115623455-115623477 CAAACTGCCCCCAAAGCCCTTGG + Intronic
995780547 5:115770601-115770623 CAGACTGCCTGCAAATCCACCGG + Intergenic
996445132 5:123539236-123539258 CAGGCTGGTCTCAAACCCCCAGG - Intronic
996555818 5:124777974-124777996 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
996576012 5:124976936-124976958 CAGACTGGTCTCAAACTCCCAGG + Intergenic
998046416 5:138990636-138990658 CAGGCTGGTCCCAAATTCCAGGG + Intronic
998064388 5:139145846-139145868 CAGGCTGGCCTCAAACCCCTGGG - Intronic
998381783 5:141730875-141730897 CTTCCTGGCCCCAAATCCCTAGG + Intergenic
998496668 5:142596257-142596279 CAGACTGGCCTCAAACTCCTGGG - Intronic
998496687 5:142596392-142596414 CAGACTGGCCTCAAATTCCTGGG - Intronic
998496706 5:142596530-142596552 CAGACTGGCCTCAAATTCCTGGG - Intronic
998880792 5:146642844-146642866 CAGGCTGGTCTCAAATTCCCAGG - Intronic
999171577 5:149599485-149599507 CAGACTGGTCTCAAACTCCCAGG + Intronic
999986558 5:157011005-157011027 CAGGCTGGCCTCAAACCCCTGGG + Intergenic
1000084006 5:157873217-157873239 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1000207690 5:159077948-159077970 CAGGCTGGTCTCAAATTCCCTGG + Intronic
1000428175 5:161116986-161117008 CAGGCTGGCCTCAAACTCCCAGG + Intergenic
1000996863 5:167968212-167968234 CAGAATGGCCCCAAATTGTCTGG - Intronic
1001159009 5:169298125-169298147 CAGACTGTCCCCCATTCCCAGGG + Intronic
1002348376 5:178563740-178563762 CAGGCTGGTCCCAAATTCCTGGG + Intronic
1002536204 5:179877172-179877194 CAGACTGGCCTCAAACTCCTAGG - Intronic
1002542681 5:179916651-179916673 CAGAGAGGCCCCAGCTCCCCTGG - Intronic
1002552115 5:180002343-180002365 CACAGTGGCCCCACATCTCCAGG - Intronic
1002728783 5:181319799-181319821 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1003396860 6:5760819-5760841 CAGACTGGCGCCAAATGAACTGG - Intronic
1003856382 6:10280250-10280272 CACCCTTGCCCCAAATCACCTGG - Intergenic
1004406196 6:15335878-15335900 CAGACTGGTCTCAAATTCCTGGG - Intronic
1004411224 6:15383209-15383231 CAGGCTGGCCTCAAACCCCTGGG + Intronic
1004451141 6:15747862-15747884 CAGGCTGGTCCCAAATTCCTGGG - Intergenic
1004708441 6:18146998-18147020 CAGACTGGTCTCAAATTCCTGGG + Intronic
1004770622 6:18777073-18777095 CAGGCTGGTCCCAAAACTCCTGG + Intergenic
1005608491 6:27500084-27500106 CAGGCTGGTCTCAAATCCCTGGG - Intergenic
1006127955 6:31852155-31852177 CAGGCTGGCCCACAAGCCCCGGG + Intergenic
1006235856 6:32631347-32631369 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1006286263 6:33096784-33096806 CTGACTGGGCACAAATCCTCTGG + Intergenic
1006567959 6:34975546-34975568 CAGGCTGGTCCCAAATTCCTGGG - Intronic
1006631649 6:35434582-35434604 CAGACTGGTCTCAAACCCCTGGG + Intergenic
1006753859 6:36397363-36397385 CAGACTGGCCTCAAACTCCTGGG - Intronic
1006769410 6:36539792-36539814 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1006868398 6:37228183-37228205 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1006885652 6:37380125-37380147 CAGACTGGTCTCAAATTCCTGGG + Intronic
1006930502 6:37685089-37685111 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1006957882 6:37892379-37892401 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1007295594 6:40818484-40818506 GAGACAGGCACCAAAGCCCCAGG + Intergenic
1007527794 6:42511936-42511958 CAGACTGGCCTCAAACCCCTGGG - Intergenic
1007721140 6:43886140-43886162 CAGACTGGCCACAACCCCCAGGG - Intergenic
1007750902 6:44070985-44071007 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1007778920 6:44240235-44240257 CAGACTGGTCTCAAATGCCTGGG - Intergenic
1010410214 6:75552774-75552796 CAGGCTGGTCTCAAATCCCTGGG + Intergenic
1010901032 6:81427646-81427668 CAGATTGGCCTCAAATGCCTGGG + Intergenic
1011059127 6:83243045-83243067 CAGGCTGGTCTCAAATCCCTGGG - Intronic
1011251344 6:85375491-85375513 CATACTGGACTCAAATTCCCAGG - Intergenic
1011626120 6:89285216-89285238 CAGACTGGGCCCAGCTACCCTGG + Intronic
1013246703 6:108294155-108294177 CAGACTGGTCTCAAACTCCCGGG + Intergenic
1013516975 6:110897088-110897110 CAGACTGGCCTCAAACTCCTAGG - Intergenic
1014179232 6:118366533-118366555 GAGACTGGCCCAAAATTTCCAGG - Intergenic
1014249880 6:119104215-119104237 CAGGCTGGCCTCAAACCCCTGGG + Intronic
1015029039 6:128571861-128571883 CAGGCTGGTCCCAAATTCCTGGG - Intergenic
1015412923 6:132914838-132914860 CAGACTGGTCTCAAATGCCTGGG + Intergenic
1015478559 6:133681317-133681339 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1015629827 6:135220917-135220939 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1015684442 6:135843944-135843966 CAGACTGGTCCCAAACTCCTGGG + Intergenic
1015993907 6:138978518-138978540 CAGACTGGTCTCAAACTCCCGGG + Intronic
1016192634 6:141289108-141289130 CAGGCTAGCCCCATAACCCCAGG - Intergenic
1016277696 6:142373930-142373952 CAGACTGGCCTCAAACTCCTGGG + Intronic
1016696239 6:146999809-146999831 CAAACTGGGCCCCTATCCCCAGG + Intergenic
1016700180 6:147045469-147045491 CAGACTGGCCTCAAACTCCTAGG + Intergenic
1016822982 6:148363350-148363372 CAGACTGGCCTCAAACTCCTGGG + Intronic
1016939574 6:149473245-149473267 CAAAGTGAGCCCAAATCCCCAGG + Intronic
1017474539 6:154775692-154775714 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1018777804 6:167034390-167034412 CAGACTGGGCTAAAATCCACAGG + Intronic
1019433524 7:1010550-1010572 CAGACCCGACCCAAATCCCGAGG + Intronic
1019784016 7:2962008-2962030 CAAACTGGCCTCGAATCCCTGGG - Intronic
1020321555 7:6942227-6942249 CAGGCTGGTCCCAAATTCCTGGG + Intergenic
1020324889 7:6966801-6966823 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1020414584 7:7931193-7931215 CAGACTGGCCTCAAACTCCTGGG + Intronic
1021919846 7:25473935-25473957 CAAACTGGCCCCAAATTCACAGG + Intergenic
1022425864 7:30268188-30268210 CAGACTGGTCCCAAACTCCTGGG + Intergenic
1022449386 7:30500839-30500861 CAGACAGGACCCAGATCCCAAGG + Intronic
1022638823 7:32162287-32162309 CAGACTGGCCCAGAATATCCAGG + Intronic
1022776335 7:33531466-33531488 CAGACTGACCCCAAAACACTGGG - Intronic
1023046633 7:36215647-36215669 CAGACTGGCACAAAAATCCCAGG - Intronic
1023312432 7:38901820-38901842 CACACTGGTCTCAAATTCCCTGG - Intronic
1023399916 7:39785212-39785234 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1024124543 7:46279207-46279229 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1024650492 7:51399193-51399215 CAGGCTGGCCACAAATTCCTGGG - Intergenic
1024963531 7:55003074-55003096 CAGACAGGTCTCAAATTCCCGGG + Intergenic
1025054624 7:55754857-55754879 CAGGCTGGCCACAAATTCCTGGG - Intergenic
1025132683 7:56385004-56385026 CAGGCTGGCCACAAATTCCTGGG - Intergenic
1025138743 7:56444372-56444394 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1025184488 7:56846618-56846640 CAGGCTGGCCACAAATTCCTGGG - Intergenic
1025687441 7:63730350-63730372 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1025732525 7:64119133-64119155 CAGACTGGTCTCAAAACTCCTGG - Intronic
1025911152 7:65829869-65829891 CAGTCTGGCCACAAATTCCTGGG + Intergenic
1026161528 7:67873619-67873641 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1026513804 7:71049580-71049602 CAGGCTGGCCCCAAAGACTCAGG + Intergenic
1026564240 7:71476635-71476657 CAGACTTGCCACATATCCCCTGG - Intronic
1029276835 7:99410438-99410460 CAGACTGGTCTCAAATTCCTGGG + Intronic
1029424576 7:100487930-100487952 CAGACTGGTCCCAAATTCCTGGG - Intronic
1029705759 7:102274894-102274916 CAGACTAGGCCTATATCCCCTGG - Intronic
1030168731 7:106580430-106580452 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1030458845 7:109806272-109806294 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1031618695 7:123909990-123910012 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1032050232 7:128644686-128644708 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1032080067 7:128854292-128854314 CAGACTGGCCCCGAAGGCCAGGG + Intronic
1032419124 7:131763937-131763959 CAGACTGGCTCCAAAGCCCTCGG + Intergenic
1032690127 7:134277290-134277312 AAGACTGGCCCCAAATCCAACGG + Intergenic
1032844577 7:135741611-135741633 CAGACTGGTCTCAAATTCCTGGG - Intronic
1033214042 7:139481464-139481486 CTGACAGGCACCAAATTCCCAGG - Intronic
1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG + Intergenic
1033569643 7:142615286-142615308 CAGGCTGGTCCCAAATTCCTGGG - Intergenic
1033771483 7:144557521-144557543 CAGGCTGGCCTCAAACCCCTGGG + Intronic
1033777253 7:144626283-144626305 CAGGCTGGTCTCAAATCCCTGGG + Intronic
1034194105 7:149232888-149232910 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1034219485 7:149432814-149432836 CATACTGGCCTCATATCTCCCGG + Exonic
1034437993 7:151072211-151072233 CAGCCTGGCCTCAAATCCAGAGG - Intronic
1034521058 7:151620384-151620406 CAGACTGGCCTCAAACTCCTGGG + Intronic
1034626339 7:152495811-152495833 CAGGCTGGCCTCAAAACTCCTGG - Intergenic
1034942349 7:155238598-155238620 CATAATGGCCCCTAATGCCCAGG - Intergenic
1035073765 7:156163669-156163691 CAGCCTGGATCCAAATCCCTAGG + Intergenic
1035131682 7:156660557-156660579 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1036797037 8:11763775-11763797 CAGGCTGGCCTCAAATTCCTGGG + Exonic
1037359783 8:18060961-18060983 CAGACTGGTCTCAAACCCCTGGG + Intronic
1037592677 8:20326431-20326453 CAGACTGGTCTCAAATACCTGGG - Intergenic
1038279965 8:26155055-26155077 CAGGCTGGTCTCAAATCCCTGGG - Intergenic
1038960124 8:32509302-32509324 CAGGCTGGTCTCAAATTCCCAGG + Intronic
1039057219 8:33546492-33546514 CAGGCTGGCCTCAAATGCCTGGG - Intergenic
1039183017 8:34887684-34887706 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1039209099 8:35191313-35191335 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1039225462 8:35383866-35383888 CAGGCTGGTCCCAAATTCCGGGG - Intronic
1039488438 8:37929301-37929323 CAGACTGGCCTCGAATTCCTAGG + Intergenic
1039543486 8:38390270-38390292 CAGGCTGGCCTCAAACCCCTGGG - Intronic
1039586275 8:38709857-38709879 CAGACTGGTCCCAAACTCCTGGG + Intergenic
1039593188 8:38767852-38767874 CAGACTGGTCCCAAACTCCTGGG - Intronic
1039717592 8:40127104-40127126 CAGACTGGCCTCAAACTCCAGGG + Intergenic
1039965762 8:42282415-42282437 CAGGCTGGTCTCAAACCCCCGGG + Intronic
1040294203 8:46140862-46140884 CAGACCTGCTGCAAATCCCCAGG - Intergenic
1040944308 8:52867052-52867074 CAGACTGGTCCCAAACTCCTGGG - Intergenic
1041226048 8:55699186-55699208 CACAATGGCCCCAAAGCCCCAGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042228956 8:66537844-66537866 CAGGCTGGTCTCAAATTCCCGGG + Intergenic
1042910365 8:73820022-73820044 CAGGCTGGTCCCAAAACTCCTGG + Intronic
1043456288 8:80415635-80415657 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1043493550 8:80774954-80774976 CAGACTGGCTAGAAACCCCCGGG - Intronic
1044382965 8:91555452-91555474 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1045000942 8:97877529-97877551 CAGACTGGTCTCAAATTCCTGGG + Intronic
1046080265 8:109362598-109362620 CACAGAGGCCCCAAATACCCAGG - Exonic
1047101131 8:121676862-121676884 CAGTCTGGTCTCAAATTCCCAGG + Intergenic
1047766253 8:127992447-127992469 CAGGCTGGCCTCCAATCCCTGGG + Intergenic
1047867727 8:129045846-129045868 CAGGCTGGCCTCAAACCCCCAGG - Intergenic
1047868297 8:129054032-129054054 CAGGGGGGTCCCAAATCCCCAGG + Intergenic
1048329681 8:133463309-133463331 AAGACAGCCCCCAGATCCCCAGG - Intronic
1049654381 8:143791370-143791392 CAGCCCGGCCCCAACTCACCAGG + Exonic
1049690413 8:143956355-143956377 CAGACTGGTCCTGAATTCCCAGG - Intronic
1050726018 9:8650126-8650148 CAGACTGGTCTCAAATTCCTGGG + Intronic
1050913674 9:11105195-11105217 CAGGCTGGCCCCAAACTCCTGGG + Intergenic
1050962339 9:11750837-11750859 CAGGCTGGTCCCGAATTCCCAGG + Intergenic
1051084477 9:13332162-13332184 CAGGCTGGCCTCAAAACTCCTGG - Intergenic
1053019067 9:34682188-34682210 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1053279079 9:36805811-36805833 CACAATGGCCCCAGATCCTCTGG + Intergenic
1054781495 9:69170057-69170079 CAGGCTGGACTCAAATCCCTAGG + Intronic
1056414002 9:86358955-86358977 CAGACTGGTCTCAAATTCCTAGG - Intergenic
1056909432 9:90684978-90685000 CAGGCTGGCTCCCCATCCCCTGG + Intergenic
1056949358 9:91029706-91029728 CAGACTCTCCCCACATCCTCAGG + Intergenic
1057361989 9:94381758-94381780 CAGGCTGGTCTCAAATCCCTGGG - Intronic
1057661366 9:97006406-97006428 CAGGCTGGTCTCAAATCCCTGGG + Intronic
1057885377 9:98825762-98825784 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1058468954 9:105257439-105257461 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1058651963 9:107183583-107183605 CAAACTGGCCTCAAACCCCTGGG - Intergenic
1058728386 9:107825725-107825747 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1060099288 9:120824059-120824081 CAGGCTGGCCCCGAACTCCCGGG - Intronic
1060343555 9:122797459-122797481 CAGCCTGGCCCCTTGTCCCCAGG - Intergenic
1060427150 9:123515854-123515876 CAGACTGGCCTCAAACTCCTGGG - Intronic
1060955303 9:127634563-127634585 CAGGCTGGCCTCAAATACCTGGG - Intronic
1061071700 9:128314786-128314808 CAGACTGGTCTCAAATTCCTGGG + Intronic
1061287060 9:129629887-129629909 CAGGCTGGCCCCAAACTCCTGGG - Intronic
1061465586 9:130776800-130776822 CAGCCTGGTCCCAAACCCCTGGG + Intronic
1061537681 9:131259788-131259810 CACACTGGTCCCAAATGCCTGGG - Exonic
1061547924 9:131315459-131315481 CAGAGTGTCCCTAAATGCCCAGG - Intergenic
1061624866 9:131835665-131835687 CAGAGAAGCCCCAAGTCCCCGGG - Intergenic
1061677339 9:132225478-132225500 CAGTCTGGCCTCAAATTCCTGGG + Intronic
1061847962 9:133398566-133398588 CAGGCTGGTCTCAAATCCCTGGG - Intronic
1061918316 9:133768752-133768774 CACACTGGCCTCCAATCCCAGGG + Intronic
1062384382 9:136303358-136303380 CAGACTGGCCCCACCTCCCCGGG + Intronic
1062497255 9:136837686-136837708 CAAACTGGTCCCAGACCCCCAGG + Intronic
1062753843 9:138276898-138276920 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1203576360 Un_KI270745v1:11677-11699 CAGGCTGGCCACAAATTCCTGGG + Intergenic
1185462171 X:338487-338509 CTGACTGACCCCGCATCCCCCGG + Intronic
1185907453 X:3949237-3949259 CAGACTGGTCTCAAACTCCCAGG + Intergenic
1186084945 X:5977430-5977452 CAGACTGGCCTCAAATTCCCAGG + Intronic
1186532744 X:10313833-10313855 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1186977072 X:14919005-14919027 CAGACTGGCCTCAAACTCCTGGG - Intronic
1187328122 X:18310658-18310680 CAGGCTGGACTCAAATCTCCTGG + Intronic
1187416732 X:19099822-19099844 CAGGCTGGTCTCAAATCCCTGGG - Intronic
1187468457 X:19546939-19546961 CAGGCTGGTCCCAAATTCCTGGG - Intronic
1187665334 X:21602369-21602391 CATGCTGGTCCCAAACCCCCGGG + Intronic
1189035795 X:37492558-37492580 CAGACAGGCCCCACAGCCACGGG + Intronic
1189155048 X:38748449-38748471 CACACTGGCACCAAGTACCCAGG - Intergenic
1189298380 X:39935156-39935178 CAGACTGGTCTCAAACTCCCGGG + Intergenic
1189342399 X:40214141-40214163 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1189470200 X:41307986-41308008 CAGACTGGTCTCAAACCCCTGGG - Intergenic
1189986087 X:46554472-46554494 GAGAAGGCCCCCAAATCCCCAGG - Intergenic
1190255871 X:48761869-48761891 CACCCTTGCCCCAGATCCCCAGG - Intronic
1190724962 X:53183213-53183235 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1190811372 X:53887591-53887613 CAGACTGGTCTCAAACTCCCAGG - Intergenic
1190954190 X:55175495-55175517 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1192119565 X:68442178-68442200 CAGACTGGCCTCAAACTCCTGGG + Intergenic
1192760735 X:74093886-74093908 CGGACTGTCCCCAAATCTGCTGG + Intergenic
1193000337 X:76556079-76556101 AAGAGTGCCCCCACATCCCCAGG - Intergenic
1193900791 X:87174620-87174642 CAGGCTGGCCTCAAATGCCTGGG - Intergenic
1194262667 X:91716568-91716590 CTGACTGTCCCCAACTCCCCTGG + Intergenic
1194534639 X:95091113-95091135 CAGACTGGTCTCAAACTCCCGGG - Intergenic
1195323933 X:103743025-103743047 CAGCCTGGCCCCAGAGCCCATGG + Intergenic
1196990847 X:121327022-121327044 CAGCATGGCCCCTAATCCACAGG - Intergenic
1197127211 X:122960626-122960648 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1197973918 X:132144805-132144827 CAGACTGGCCTCAAACTCCTGGG - Intergenic
1198807478 X:140505478-140505500 CAGACCGGCGCCCCATCCCCCGG + Exonic
1198940789 X:141952998-141953020 CAGACTTGCCCCACATCCCCAGG - Intergenic
1199671532 X:150152101-150152123 CACACTGGGCTCAAATTCCCTGG + Intergenic
1199682316 X:150235216-150235238 CAGACTGGTCTCAAACTCCCGGG - Intergenic
1199769588 X:150966052-150966074 CAGTTTGGCCTCAAATCGCCTGG - Intergenic
1199863234 X:151820717-151820739 CAGTCTTGCCCCAAAACCCATGG + Intergenic
1200225579 X:154415390-154415412 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1200292235 X:154885443-154885465 CCACCCGGCCCCAAATCCCCCGG + Exonic
1200339072 X:155381180-155381202 CCACCCGGCCCCAAATCCCCCGG + Intergenic
1200347397 X:155459512-155459534 CCACCCGGCCCCAAATCCCCCGG - Exonic
1200838861 Y:7759819-7759841 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
1200953152 Y:8919801-8919823 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
1201469100 Y:14314589-14314611 CCGACTGGCCCACAAGCCCCGGG + Intergenic
1201902113 Y:19054043-19054065 CAGACTGGTCTCAAATTCCTGGG + Intergenic
1202268037 Y:23041542-23041564 CAGACTGGCAGAAAATTCCCAGG - Intergenic
1202421029 Y:24675286-24675308 CAGACTGGCAGAAAATTCCCAGG - Intergenic
1202449757 Y:24994796-24994818 CAGACTGGCAGAAAATTCCCAGG + Intergenic