ID: 1150265394

View in Genome Browser
Species Human (GRCh38)
Location 17:63829270-63829292
Sequence GAAGGCTGCTTGTCCAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150265394_1150265402 21 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265402 17:63829314-63829336 CAGAGGGACTCTTGAAGGACAGG 0: 1
1: 0
2: 2
3: 19
4: 171
1150265394_1150265404 26 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265404 17:63829319-63829341 GGACTCTTGAAGGACAGGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 592
1150265394_1150265403 22 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265403 17:63829315-63829337 AGAGGGACTCTTGAAGGACAGGG 0: 1
1: 0
2: 1
3: 24
4: 228
1150265394_1150265398 4 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265398 17:63829297-63829319 ATGGCTGCTGTAAGGTCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 136
1150265394_1150265400 16 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265400 17:63829309-63829331 AGGTCCAGAGGGACTCTTGAAGG 0: 1
1: 0
2: 1
3: 11
4: 147
1150265394_1150265399 5 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265399 17:63829298-63829320 TGGCTGCTGTAAGGTCCAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 156
1150265394_1150265405 27 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265405 17:63829320-63829342 GACTCTTGAAGGACAGGGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 225
1150265394_1150265397 -4 Left 1150265394 17:63829270-63829292 CCAGTATTGGACAAGCAGCCTTC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1150265397 17:63829289-63829311 CTTCTTTGATGGCTGCTGTAAGG 0: 1
1: 0
2: 0
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150265394 Original CRISPR GAAGGCTGCTTGTCCAATAC TGG (reversed) Intronic
900566864 1:3337601-3337623 GAAGGCTGCTTGGCCACTGCGGG + Intronic
902762783 1:18594687-18594709 GATGGCTGCTTGTCAAAGGCAGG - Intergenic
910503225 1:87918612-87918634 GAAGGCAGCTCCTCCAAGACAGG - Intergenic
917504169 1:175613313-175613335 AAAGGCTCCTTGTCCAAATCTGG + Intronic
919746056 1:201009961-201009983 GAAGGCGGCTTGTCCACTGCTGG + Intronic
919930675 1:202219397-202219419 GAAAGCTGCTGGTCCACTGCAGG + Intronic
923989970 1:239425478-239425500 GAAGGCTGCTTATGCATAACTGG - Intronic
1063600465 10:7475863-7475885 GATGTCTGCGTTTCCAATACCGG + Intergenic
1066507506 10:36060579-36060601 GAAGGCTGATTAGCCTATACTGG + Intergenic
1069041352 10:63698935-63698957 GAAGGATTCTTCTCCAAGACAGG - Intergenic
1069751284 10:70746855-70746877 GAAGGCTGCTTCTCCCACACTGG + Intronic
1070581024 10:77719642-77719664 GAAGGATTCTTGGACAATACAGG - Intergenic
1074403639 10:113162781-113162803 GAAGGATGCTATTCCAAAACAGG + Intronic
1083960480 11:66012476-66012498 GAAGGCAGGTAGTGCAATACAGG - Intronic
1088030233 11:105239756-105239778 GAGGGCTGATTGTCCCACACTGG - Intergenic
1090263258 11:125337986-125338008 GAACGCTTCTTCTCCAATTCTGG - Intronic
1094128197 12:27045666-27045688 GAAGGCTGCTTGTGCCAGCCCGG + Intronic
1102466872 12:113135276-113135298 GAGGGGTTCTTGTCCAAGACTGG - Intronic
1103144820 12:118586176-118586198 CAAGGCAGCTTGTCCAATAGAGG + Intergenic
1103186514 12:118962441-118962463 GCAGTCAGCTTTTCCAATACTGG - Intergenic
1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG + Intergenic
1110146192 13:72193198-72193220 GGAGGCTGCCTGTGCATTACAGG - Intergenic
1113092069 13:106626864-106626886 GAAGGCTGCTGATCCAGTAAAGG - Intergenic
1114804644 14:25820833-25820855 CCATGCTGCTTGTCCAAGACTGG - Intergenic
1115481038 14:33861288-33861310 GAAGGCAGCATGACCTATACTGG - Intergenic
1118242584 14:64074362-64074384 GAAGGCTGCTTGGTCCAGACTGG - Intronic
1119653898 14:76402988-76403010 GAAAGCTGCCTGGCCAATATGGG - Intronic
1123204448 14:106698901-106698923 TAATGCTGCTTGTCGAAGACAGG - Intergenic
1123207117 14:106724303-106724325 GAAGGTTGCATGTCCAGTGCGGG - Intergenic
1123209454 14:106745372-106745394 TAATGCTGCTTGTCGAAGACAGG - Intergenic
1125282353 15:38056375-38056397 GCAGGCTTCTTATCCAATTCTGG - Intergenic
1126446270 15:48748181-48748203 GAAGCCTGCTTGACGTATACTGG + Intronic
1126837545 15:52682090-52682112 GTAGTCTGCATGTCTAATACTGG + Intronic
1126913180 15:53436520-53436542 GAAGGGTTCTGCTCCAATACAGG + Intergenic
1134298230 16:12966027-12966049 GAAGGCTTCTTGTCTATTGCAGG + Intronic
1137732140 16:50697073-50697095 GAAGGCTGGTTGGCCAACTCTGG + Intronic
1141136453 16:81468740-81468762 GAAGGCTGCTGATCCAAGAATGG + Intronic
1144359608 17:14479414-14479436 GAAGGCTCCTTCTCAAAAACTGG - Intergenic
1150265394 17:63829270-63829292 GAAGGCTGCTTGTCCAATACTGG - Intronic
1150991372 17:70263828-70263850 GATGGCTACTTGTCCTATAGTGG - Intergenic
1156949989 18:42884230-42884252 TAAGGTTGCTTGTCCCCTACTGG + Intronic
1159377868 18:67617084-67617106 GAAACCTGCTTCTGCAATACTGG - Intergenic
1161753115 19:6111553-6111575 GAAGGCTGCTTTGACACTACAGG + Intronic
1163819734 19:19489339-19489361 GAAGGCTGCGTGTCACAAACCGG + Intronic
1167540599 19:50084855-50084877 GAAGGCAGCCTGGCCAACACGGG + Intergenic
1167629117 19:50612960-50612982 GAAGGCAGCCTGGCCAACACGGG - Intergenic
925312683 2:2897062-2897084 GAAGTCTGCTTTTCCAAGAATGG - Intergenic
928200717 2:29246173-29246195 GAAGGATGCTGGTCCTAGACAGG + Intronic
930555912 2:52895129-52895151 GCAGCCTGCTTGTCCAAGATCGG - Intergenic
935945431 2:108281830-108281852 GAAGGCTGCTTCTCTAATTGAGG - Intergenic
938252066 2:129823012-129823034 GGAGGATGATTGTCCAATGCTGG - Intergenic
945314671 2:208359589-208359611 GAATGCTGCTTGCCCAGTATTGG - Intergenic
948136423 2:235639595-235639617 GCAGGCAGCTTGACCAATAAAGG - Intronic
948157101 2:235792392-235792414 GAAGGTGGCTTGTCCACTCCTGG - Intronic
1169255282 20:4092089-4092111 CTAGGCTGCTTGTCCAAAAGCGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1175237444 20:57524792-57524814 GAGGGCTGCTTGGCCAAGTCTGG - Intronic
1177198155 21:17924394-17924416 CAAGGCTGATTCTCCAATAAAGG - Intronic
1181036493 22:20172215-20172237 GAGGGCTGGCTGTCCAGTACGGG - Intergenic
1181713653 22:24707789-24707811 GCAGGCTGCTAGAACAATACTGG + Intergenic
1182692732 22:32175400-32175422 GAAAGCTGCTTGTCCAGTAAAGG + Intergenic
949204670 3:1423675-1423697 GAAGGGGGCTTGTCCAACAGAGG + Intergenic
949831341 3:8217803-8217825 GAGGTCTGCTTGTTCATTACTGG + Intergenic
952752828 3:36839316-36839338 GAAAGCTGCTTTTCTAAAACAGG + Intronic
953721743 3:45362158-45362180 GAAGGATGTTTGGCCATTACAGG + Intergenic
960959103 3:123056620-123056642 GAAGGCAGCTTCTCCCATACGGG + Intergenic
962469765 3:135695805-135695827 GATGGCTGCTTGGCCAAGAAAGG - Intergenic
964138450 3:153370492-153370514 CAAGGCTGCTTTTCCATTTCTGG - Intergenic
966212706 3:177469544-177469566 GAAGTCTGCTTTTCTAAGACAGG + Intergenic
966282839 3:178254773-178254795 GAAGGCAGCTTCTCCACTACTGG + Intergenic
971616602 4:28798488-28798510 GAAGGCATCTTGTCAAACACTGG + Intergenic
980044792 4:127975319-127975341 GAAGGATGGTTGCCCAGTACTGG - Intronic
987861860 5:23499680-23499702 GAAGGCTTCTCCTCCAACACTGG + Intergenic
990357681 5:54986415-54986437 TAAGTCTGCTTGTCCAATGACGG + Intronic
990375514 5:55166636-55166658 GAAGGAAGATTGTCCAATATAGG - Intronic
991512372 5:67393892-67393914 GAAAGCTTCTTTTGCAATACAGG - Intergenic
998687374 5:144543852-144543874 AAAGGCTGCTGGCCCACTACTGG - Intergenic
999644890 5:153707854-153707876 ACTGGCTGCTTGGCCAATACTGG + Intronic
1017807254 6:157956353-157956375 TAGGGCTGCTTTTCCAAGACAGG - Intergenic
1026886881 7:73955213-73955235 GAAGGCTGCTGGTCCATATCAGG - Intergenic
1030892009 7:115009956-115009978 GAAAGATGCCTGTCCAAAACTGG - Intronic
1032505735 7:132433327-132433349 GAAGGCTTCCTGTCCACTTCAGG - Intronic
1036811847 8:11872529-11872551 GATGGCTGCTCCTCTAATACCGG + Intergenic
1040573696 8:48631951-48631973 CAAGGCTGTTTATCCAATATTGG + Intergenic
1041403621 8:57471747-57471769 AAAGTCTACTTGTCCATTACTGG + Intergenic
1044303652 8:90613634-90613656 GAGGACTGCTGGTCCAATACTGG + Intergenic
1044987899 8:97771145-97771167 GAACTCTCCTTGTCCATTACTGG - Intergenic
1052166630 9:25338842-25338864 GAAGCCTGCTTGGCCAGTATTGG + Intergenic
1052348424 9:27433835-27433857 GAAGGCTGCTTGACCTCTGCAGG - Intronic
1191932175 X:66386139-66386161 GAAGACTGATAGACCAATACTGG + Intergenic
1193422337 X:81296261-81296283 GCAGGCTGCTCCTCCAACACTGG + Intronic