ID: 1150266748

View in Genome Browser
Species Human (GRCh38)
Location 17:63837218-63837240
Sequence CAGGTTAAAGAGGAGGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 0, 2: 3, 3: 87, 4: 757}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150266748_1150266756 3 Left 1150266748 17:63837218-63837240 CCATCTTCCTCCTCTTTAACCTG 0: 1
1: 0
2: 3
3: 87
4: 757
Right 1150266756 17:63837244-63837266 AGGACAGAAACCCACTTAAGAGG 0: 1
1: 0
2: 1
3: 16
4: 138
1150266748_1150266760 21 Left 1150266748 17:63837218-63837240 CCATCTTCCTCCTCTTTAACCTG 0: 1
1: 0
2: 3
3: 87
4: 757
Right 1150266760 17:63837262-63837284 AGAGGTCAATGGTCCAAAAAAGG 0: 1
1: 0
2: 2
3: 16
4: 201
1150266748_1150266757 10 Left 1150266748 17:63837218-63837240 CCATCTTCCTCCTCTTTAACCTG 0: 1
1: 0
2: 3
3: 87
4: 757
Right 1150266757 17:63837251-63837273 AAACCCACTTAAGAGGTCAATGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150266748 Original CRISPR CAGGTTAAAGAGGAGGAAGA TGG (reversed) Exonic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900769403 1:4528789-4528811 CAGGTGACAGAGGAGGCAGCAGG - Intergenic
900824385 1:4914320-4914342 CAGGTCAAAGGTGAGGAAGGAGG + Intergenic
901242084 1:7701322-7701344 CCTGTTGCAGAGGAGGAAGAAGG - Intronic
901613866 1:10521575-10521597 CAGTTTACAGATGAGGAAGCAGG + Intronic
901740321 1:11338024-11338046 GAGGTGAAAGAGGGGGAGGAGGG - Intergenic
901826911 1:11868071-11868093 CAGTATCAAGAGGAGGGAGAAGG - Intergenic
902205800 1:14867225-14867247 AAGGCAAAAGAGGAGGGAGAGGG - Intronic
902597457 1:17519308-17519330 CAGGTTAAGAAGGAGGAAACTGG + Intergenic
902993147 1:20203709-20203731 CAGTAGAAAGAAGAGGAAGATGG + Intergenic
903011175 1:20331493-20331515 AAGGTGGAAGAGGAGGAAGCAGG + Intronic
903047294 1:20574465-20574487 CAGCTAAAAGAGGTGGAAGCTGG + Intergenic
903418613 1:23201927-23201949 CAATTTACAGATGAGGAAGAAGG - Intergenic
903718703 1:25388594-25388616 GGGGTGAAAGAGGAGGAAGCAGG + Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
904874031 1:33639938-33639960 CAGTTTATAGATGAGGAATATGG + Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904957309 1:34295819-34295841 CAATTTAAAGTGGAGGGAGAGGG + Intergenic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905211569 1:36377972-36377994 CATTTTACAGAGGAGGAAGCTGG + Intronic
905227904 1:36492003-36492025 CAGGTTCATGAAGAGGAAGAGGG - Intergenic
905407198 1:37742049-37742071 CAGGATAGAGAGGTAGAAGATGG + Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
906180881 1:43817743-43817765 GAGGAAGAAGAGGAGGAAGAAGG - Intronic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
907164067 1:52394580-52394602 GAGTTGAAAGAGGAAGAAGAGGG + Intronic
907363563 1:53941628-53941650 TAGTTTTAAGAGGAGAAAGATGG + Intronic
907890105 1:58628821-58628843 GTGGTTAAAGTGGAGGTAGAAGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907936388 1:59046011-59046033 AAGGTGACAGAGGAGGAAGCAGG - Intergenic
908028562 1:59975857-59975879 CAGAATATAGAAGAGGAAGAAGG - Intergenic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
908897662 1:68918680-68918702 GAAGGTGAAGAGGAGGAAGAGGG + Intergenic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
909700025 1:78512040-78512062 CAGGTTGAAGAGGTGTCAGAAGG - Intronic
910773950 1:90856347-90856369 AAGCTTAAAGAGGAAGAAAATGG - Intergenic
911465268 1:98244029-98244051 CAGGTCAAAGAGGAGAAAACAGG + Intergenic
911574266 1:99556301-99556323 CAGGTAAAATAGGAGTAAAATGG - Intergenic
912080292 1:105927868-105927890 CATGTTACAAAGAAGGAAGAAGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
912520834 1:110243614-110243636 GAAGATGAAGAGGAGGAAGAGGG + Intronic
913076432 1:115344204-115344226 CAGGTGAAGGAGTAGGGAGAAGG - Intergenic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
916301419 1:163278925-163278947 CAGGTTAAAAGGGACAAAGAAGG + Intronic
916495860 1:165346011-165346033 CAGGGTATAGGGGAGGGAGAAGG + Intronic
917220733 1:172726097-172726119 CAAGTTAAAGTGGAAGAAGATGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917741990 1:177969841-177969863 CAGCTCAAAGAGGGGAAAGAAGG + Intronic
918134341 1:181658435-181658457 CATTTTACAGAGGAGGAAGCAGG - Intronic
919214282 1:194532582-194532604 CAGTTTAAAAAAGACGAAGAGGG - Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919883998 1:201919503-201919525 CAGGTTAAAAAAGAAGAAAAGGG - Intronic
921295540 1:213697805-213697827 CAGGTAATAGAGGAGAAAAATGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921422063 1:214959670-214959692 TAGGATAAAGTGGAGGCAGAAGG + Intergenic
921742158 1:218697634-218697656 CAGGTTAAAGAGGAGGATTGAGG - Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
924016674 1:239733311-239733333 TAGTTGAAAGAGGGGGAAGAAGG + Intronic
924362618 1:243256342-243256364 CACGCTACAGAGGAGCAAGATGG + Intronic
924570278 1:245231656-245231678 GTGGTTAAAGATGAGGGAGAAGG + Intronic
924802889 1:247340469-247340491 CAGCTAATAGAGGAGGAAGAAGG - Intergenic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1062782426 10:226449-226471 CATATTAAAGAGGAGGAAATAGG - Intronic
1063273811 10:4541587-4541609 CAGGCTCAAGAGCAGCAAGAGGG - Intergenic
1064507376 10:16047837-16047859 CATCTTAGAGAAGAGGAAGATGG - Intergenic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066372227 10:34826945-34826967 CAGTTTTAAGATGAGGAAAACGG + Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1068262456 10:54600246-54600268 CAGGAGAAAGAGGAGAAAGTGGG + Intronic
1068322015 10:55431860-55431882 CAAGATAAAGAGGAGGGAAATGG - Intronic
1068431459 10:56937261-56937283 CTGGTTAAATAGGAAGAAGGTGG + Intergenic
1068679678 10:59806245-59806267 GAATTTAGAGAGGAGGAAGAGGG + Intronic
1068847587 10:61696279-61696301 AAGCTAAGAGAGGAGGAAGATGG + Intronic
1069105397 10:64377780-64377802 CACGTTAAATAGGAGCATGAAGG - Intergenic
1069844253 10:71359703-71359725 CATTTTACAGAGGAGGAAGCAGG + Intronic
1070044553 10:72819288-72819310 CAGGTAGAAGAGAAAGAAGAGGG + Intronic
1070277879 10:75025114-75025136 GAGATTGAAGTGGAGGAAGATGG + Exonic
1071073659 10:81726299-81726321 AAGATTAAAGAGGGAGAAGAGGG - Intergenic
1071306433 10:84302970-84302992 AATGTTAAAATGGAGGAAGATGG - Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071441652 10:85703510-85703532 AAGATTAAGTAGGAGGAAGAAGG + Intronic
1071584013 10:86801691-86801713 CAGGTTAAACAGTTGAAAGAAGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072190357 10:93072873-93072895 CCGGTTAAGGAGGAGGAAACAGG + Intergenic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072974256 10:100043962-100043984 CAGGCTGAAGAGGAAGGAGAGGG + Intronic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073172138 10:101519512-101519534 CGGGTTACAGAAGAGGAAGGGGG - Intronic
1073367974 10:102959740-102959762 CATTTTAAAGATGAGGAAGCTGG - Intronic
1073511896 10:104047719-104047741 CAGGTAACAGAGCAGGAAGAGGG - Exonic
1074103864 10:110374614-110374636 GAGGTGAGAGTGGAGGAAGAGGG - Intergenic
1074577576 10:114684829-114684851 AAGGAAAAAGAGGAGGCAGAAGG - Intronic
1074728927 10:116347575-116347597 GAGGTGAAAGGAGAGGAAGAAGG + Intronic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1074881728 10:117664944-117664966 CAGGATTAAGTGGAGGGAGAGGG - Intergenic
1074998660 10:118779217-118779239 TAGGTCAGAGAGGAGGAAGACGG - Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075548329 10:123373128-123373150 CGGGTTATATTGGAGGAAGAGGG - Intergenic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1076615325 10:131750884-131750906 CAGGATCAAGAGGATGGAGAGGG + Intergenic
1077642810 11:3896854-3896876 CATGTTATAGATGAGGAAGCAGG - Intronic
1078023204 11:7672325-7672347 CAGGCTCAGGAGGAGCAAGAGGG + Intronic
1078349018 11:10577264-10577286 AAGGAAGAAGAGGAGGAAGAGGG - Intronic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078593369 11:12665212-12665234 GAGGAGGAAGAGGAGGAAGAAGG + Intergenic
1078732187 11:13984932-13984954 AAGCTCTAAGAGGAGGAAGAAGG - Intronic
1078834363 11:15012869-15012891 TAAGTTATAGAGGAGGAAGGTGG + Intronic
1078887445 11:15518478-15518500 AAGGTGAAAGAAGACGAAGATGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080182127 11:29438092-29438114 CTTGCTAAAGAGGAAGAAGAGGG + Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080484066 11:32686118-32686140 CAGATGAAAGAGGATGATGAAGG + Intronic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081604905 11:44520904-44520926 CAGGTTAAAGACGAAGAATAAGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081677672 11:44980483-44980505 CAGGTTACAGAGGAGAAAACAGG + Intergenic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1083525678 11:63362357-63362379 CTGATTAAAGAAGAGGACGAAGG - Intronic
1084595510 11:70114519-70114541 CAGCTTCATGGGGAGGAAGATGG - Intronic
1085026464 11:73239415-73239437 CAGCATGGAGAGGAGGAAGAGGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1087109398 11:94447259-94447281 GAGGTCGAAGAGGTGGAAGAGGG - Exonic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1087605652 11:100374399-100374421 CAGATGAAAGAGGATGAAGAGGG - Intergenic
1087861078 11:103157523-103157545 TATGTAAAAGTGGAGGAAGAGGG - Intronic
1088756942 11:112893000-112893022 CAGGTAAAAGAGGACGCACAAGG - Intergenic
1088891080 11:114044700-114044722 CAGGTCATAGAGGAGGGAGTAGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089391148 11:118102778-118102800 CTGGTAAAAGAGGAGGAACCCGG - Intronic
1090507315 11:127331408-127331430 GAAGTAGAAGAGGAGGAAGAAGG + Intergenic
1090640457 11:128725294-128725316 CAGGAGAAAGGGGAGGAAGCGGG - Intronic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1091777983 12:3197121-3197143 CATGTTAAAGAAGAGGAAACGGG + Intronic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1091900616 12:4141183-4141205 CAGGTGAAAGAGCAGGAAACGGG + Intergenic
1092053760 12:5492012-5492034 CAGTTTAAAGAAGAGGAGAAAGG - Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092228786 12:6765897-6765919 AAGCTTAAAGAAGAGGAAGAGGG - Intronic
1093092289 12:14935660-14935682 CAGGGTGAAGAGGAGGGAGTTGG - Intronic
1093124190 12:15308064-15308086 CAAGTTGAGGAGGAGCAAGATGG - Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093491657 12:19711531-19711553 GAGGTTGGAGAGGAGGATGAAGG + Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093861564 12:24173115-24173137 GAGGTGAAAGGAGAGGAAGATGG - Intergenic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094541241 12:31364761-31364783 TATGTTCCAGAGGAGGAAGACGG - Intergenic
1095298198 12:40551078-40551100 CACTATAAAGGGGAGGAAGAAGG - Intronic
1095463866 12:42470226-42470248 GAGGTAAAATAGCAGGAAGAAGG - Exonic
1096071030 12:48775644-48775666 CAGGTTACTGAGGAGGGAGAAGG - Intronic
1096799792 12:54102544-54102566 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1097210231 12:57362251-57362273 TAGGCTGAAGAGGAAGAAGAGGG - Intronic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097533892 12:60840492-60840514 CAGGCTGAGGAGGAGTAAGAAGG - Intergenic
1097905537 12:64915395-64915417 CAGGTGAAGGAGGAGGGAAAGGG + Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098519207 12:71416735-71416757 GAGGTTGAAGAGTAGGGAGAGGG + Intronic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100292042 12:93225037-93225059 CAGGTCATATAAGAGGAAGAAGG - Intergenic
1100880131 12:99007395-99007417 CAGGTTATAGAAGAAGAAGTGGG - Intronic
1102066342 12:109979242-109979264 CTGGTTAAAGAGCAGGAAATGGG - Intronic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1103896677 12:124277903-124277925 GAGGCAGAAGAGGAGGAAGAGGG - Intronic
1104218212 12:126755706-126755728 CAGGGTTAAGAAGAGTAAGAAGG - Intergenic
1104379533 12:128294919-128294941 CAAGTCAAAGATGAGGAAAATGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1105408341 13:20150144-20150166 CCGTTTAAAGAGGAAGAAGTTGG + Intronic
1105502381 13:20983716-20983738 CAGGTTAAAGAGGGCCAAGATGG - Exonic
1105926256 13:25011489-25011511 AAAGTTAAAGCGTAGGAAGAAGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106625462 13:31416640-31416662 TAGGTAGAAGAGGAGGAGGAGGG - Intergenic
1106653985 13:31722570-31722592 AAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1107043639 13:35973770-35973792 CAGGTTAAGGATGGAGAAGATGG + Intronic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1107836452 13:44415911-44415933 CACGCTACAGAGGAGGAAGCTGG + Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108447492 13:50524394-50524416 CATGCTAGAGTGGAGGAAGAGGG + Intronic
1109031835 13:57200168-57200190 CAGTCTAAAGAGGAGGGAGGAGG - Intergenic
1109069636 13:57748059-57748081 CAGGTTAAAGGGGTGGAAATAGG + Intergenic
1109476913 13:62891423-62891445 GAGGGTAAAGGGGAGAAAGAAGG - Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1110143969 13:72167195-72167217 TATCTTAAAGTGGAGGAAGAGGG - Intergenic
1110215509 13:73020609-73020631 CAGGTAATAGAGGAGGATGAAGG - Intergenic
1111083044 13:83337373-83337395 CAAGGTAAAGAAGAAGAAGAAGG + Intergenic
1111215280 13:85133180-85133202 CAGGTTAAAAGGGAGCAAAAGGG - Intergenic
1111639159 13:90946353-90946375 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1112214173 13:97413025-97413047 GAGCTTAAAGAGGAAGAAGAGGG - Intergenic
1112629180 13:101141644-101141666 GAGGTGAAAAAGGAGGAAAAAGG + Intronic
1112782676 13:102918325-102918347 TAGGTGAAAGAAGAGAAAGAAGG + Intergenic
1114151368 14:20043477-20043499 CAAGTGAAAGAGGAGGCAAATGG - Intergenic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114460940 14:22885942-22885964 CACCTCAAAGAGGAGGAACAGGG - Intronic
1114530966 14:23396264-23396286 CAGGTGAGACAGGAGGAAAAGGG - Exonic
1114672436 14:24418408-24418430 CAGGATACAGTGGAGGTAGAAGG - Exonic
1115350948 14:32395171-32395193 GAGGTGAAAGAGAAAGAAGATGG - Intronic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117283933 14:54267731-54267753 CAATTTATAGAGGAGGAACATGG + Intergenic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1118032409 14:61831560-61831582 CAGTTTAAAGAGGTCTAAGAAGG - Intergenic
1118227839 14:63919600-63919622 CAAGTGGAAGAGGAGGAACAAGG + Intronic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119156758 14:72418497-72418519 TAGGATTAAGAGGAGGTAGAAGG + Intronic
1119276589 14:73362379-73362401 GAGGGAAAAGAGGAGGAAAAGGG + Intronic
1119884646 14:78130079-78130101 TAGGTGAAAAGGGAGGAAGAGGG - Intergenic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120484852 14:85100230-85100252 GAGGCTAAGGAGGAGGAAGAGGG + Intergenic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121495238 14:94387779-94387801 CATTTTACAGATGAGGAAGATGG - Intronic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124546897 15:30637260-30637282 CAGGATAAAGAGGATAAAGATGG - Intronic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124780499 15:32627256-32627278 CAGGATAAAGAGGATAAAGATGG - Intronic
1124833617 15:33174103-33174125 AAGCTTATAGAGGATGAAGAAGG + Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125547284 15:40515320-40515342 AAAGAAAAAGAGGAGGAAGAGGG - Intergenic
1125983923 15:44030710-44030732 AAGGTGAAGGAGGAGGAAGATGG + Intronic
1126373570 15:47972068-47972090 CAAGAGACAGAGGAGGAAGAAGG - Intergenic
1126980559 15:54238021-54238043 CAGCTGGAAGGGGAGGAAGATGG - Intronic
1127953792 15:63834763-63834785 CAGGTACAGAAGGAGGAAGATGG - Intergenic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128038415 15:64547593-64547615 CAGGTTACTCAGGAGGATGATGG + Intronic
1128697649 15:69780587-69780609 CAGGTTGAAGGCCAGGAAGAGGG + Intergenic
1129033418 15:72634967-72634989 TAGGTTAAAGAAGAGAAAAATGG - Intergenic
1129045753 15:72732773-72732795 CAGGTCAATCAGGAGGTAGAGGG + Intronic
1129216467 15:74102263-74102285 TAGGTTAAAGAAGAGAAAAATGG + Intronic
1129450500 15:75648550-75648572 CAGGAGCAAGAGGAGGAAGGAGG + Exonic
1129471362 15:75756540-75756562 TAGGTTAAAGAAGAGAAAAATGG - Intergenic
1129733636 15:77946587-77946609 TAGGTTAAAGAAGAGTAAAATGG + Intergenic
1129841958 15:78749414-78749436 TAGGTTAAAGAAGAGTAAAATGG - Intergenic
1130084402 15:80765058-80765080 CAGGTTCAATAGTAGGAATATGG - Intergenic
1130694188 15:86113585-86113607 CAGGTGAAAGAGGTGAAAGGTGG - Intergenic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131013749 15:89040824-89040846 CAGGTTTCAGAGGAGGCTGATGG + Intergenic
1131418763 15:92285638-92285660 CAGCTAAAAGAAGAGGAAGTTGG - Intergenic
1132225218 15:100135096-100135118 CAGGAGAAAGAGGAAGAAGGTGG + Intronic
1132436821 15:101812966-101812988 CAAGATAAAGAGGTAGAAGATGG + Intronic
1133187782 16:4112803-4112825 CTGTTTAAAAAGGAGGAAGTGGG + Intronic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1133972741 16:10579227-10579249 AAGCTTAAAGAGGACGAGGAAGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134186310 16:12087825-12087847 CACGTCAACCAGGAGGAAGAGGG - Exonic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134649585 16:15898158-15898180 GAGGTTGAGGAGGAGGAGGAGGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135008964 16:18856063-18856085 TAAGATAAAGATGAGGAAGAAGG - Intronic
1135522062 16:23185182-23185204 CATGTTACAGAGGAGAAAAATGG - Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135934371 16:26767268-26767290 CATTTTAAAGTGGAGGAGGAAGG - Intergenic
1136586502 16:31189588-31189610 CATGTTCTAGAGGAAGAAGATGG + Intronic
1137016069 16:35376682-35376704 GAGGTTAAGGAGTAGGGAGATGG + Intergenic
1138756338 16:59490605-59490627 GGGGTTAAAGAGCAGGAAAAAGG + Intergenic
1138955551 16:61966901-61966923 CACTTTAAAGAAGAGGAACATGG + Intronic
1139008754 16:62606709-62606731 CAGGTTAAATACGCTGAAGATGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139975073 16:70803400-70803422 CAGGTCAGAGAAGAGGAACAAGG - Intergenic
1140830425 16:78745748-78745770 GGGGAAAAAGAGGAGGAAGAGGG - Intronic
1140856756 16:78984838-78984860 AAGGAGAAAGACGAGGAAGAAGG + Intronic
1141246836 16:82315723-82315745 CAGTTTAAAGTGGAGACAGATGG + Intergenic
1142761123 17:2042420-2042442 CAGGAGACAGCGGAGGAAGACGG - Intronic
1142888487 17:2928216-2928238 CCGGTTAGACAGGAGGAAGGCGG - Intronic
1143391328 17:6560950-6560972 GAGGAGGAAGAGGAGGAAGAGGG - Intergenic
1143568886 17:7741983-7742005 CAGGCTGCAGAGGAGGAATAGGG + Intronic
1143742005 17:8961239-8961261 CAGGCTACAGGAGAGGAAGAAGG + Intronic
1144074253 17:11702689-11702711 CAAAATAAAGAGGATGAAGAAGG + Intronic
1144214468 17:13043160-13043182 CAAGAGAAAGAGGAGGGAGAGGG + Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1145986726 17:29051979-29052001 CACGTTACAGAGGAGGAATCTGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146636907 17:34513314-34513336 CAGATTTATGAGTAGGAAGACGG + Intergenic
1146915051 17:36673072-36673094 CAGGTGATATAGGAGGAAGGTGG + Intergenic
1147549518 17:41429611-41429633 CTTTTTAAAGAGGAGCAAGAGGG - Intergenic
1147803635 17:43113241-43113263 AAGGTCCAAGAGGAGGCAGAAGG - Intronic
1147903898 17:43810345-43810367 CAGTTTAAAGGGGAAAAAGAGGG - Intronic
1148745138 17:49913903-49913925 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1149669442 17:58393026-58393048 TAGGTTAAGGAGGAAGATGAGGG - Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150702276 17:67458193-67458215 AAGGAAAAAGAGGAGGAAGCAGG - Intronic
1150881630 17:69035666-69035688 CAGGCCATAGAGGAGAAAGAGGG + Exonic
1151209945 17:72537123-72537145 CATGTTGAAGAGGGTGAAGATGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1152904462 17:82962741-82962763 CAGGTTTAAGAAGAGAAAAAAGG + Intronic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153291375 18:3505314-3505336 CAGTTTACAGATGAGGAAAATGG - Intronic
1153350753 18:4078745-4078767 CAGGTTTCAAGGGAGGAAGACGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1154031408 18:10756889-10756911 CAGGATAAAAAGGAGGAATGGGG + Intronic
1154168176 18:12031474-12031496 CAGTTTAAAGAGGAGAAACTGGG + Intergenic
1154392290 18:13948686-13948708 CAAGTTAGAGAAGAGGAAGGGGG - Intergenic
1155495687 18:26439620-26439642 CAAGAAAAAGAGGAGGAAGCTGG - Intergenic
1156386525 18:36610062-36610084 AAGGTGAAAGGGGAAGAAGAAGG + Intronic
1156477885 18:37417659-37417681 CAGGTCAAATAGGAGAGAGACGG + Intronic
1156486028 18:37466250-37466272 GAAGTGGAAGAGGAGGAAGAAGG + Intronic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157618732 18:49003220-49003242 CAGGTAGAAGGGGAGGAAGAGGG - Intergenic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158693969 18:59686702-59686724 CAGCTGAAAAAGGAGGAAGTGGG - Intronic
1158861916 18:61600881-61600903 CAGGTTAGAGAGGGGGTGGAAGG + Intergenic
1159103687 18:63982254-63982276 CAAGTTAAAAAGGAAGGAGAAGG - Intronic
1159752650 18:72322018-72322040 GAGGTTAAAGAGCAGGACAATGG + Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1159953037 18:74498825-74498847 GTGTTTGAAGAGGAGGAAGAGGG + Intronic
1161595615 19:5149711-5149733 AAGCTTAACGAGGAGGAAGCGGG + Intronic
1161607352 19:5222443-5222465 AAGGTGGAGGAGGAGGAAGAGGG + Intronic
1161620286 19:5293719-5293741 CTGGTCTAAGAGGGGGAAGAGGG - Intronic
1161795094 19:6381779-6381801 CAGGAAAAAGAAGAAGAAGAAGG - Exonic
1161866039 19:6832747-6832769 AAAGTGGAAGAGGAGGAAGAGGG - Intronic
1162151873 19:8651869-8651891 AAGGGTAGTGAGGAGGAAGAGGG - Intergenic
1162180851 19:8867756-8867778 CAGGTGAATGGGCAGGAAGATGG + Intronic
1162250373 19:9437658-9437680 GAGCTTAAAGAGGAGGTAAATGG - Intergenic
1162353601 19:10166608-10166630 CAGGCTGACGAGGACGAAGATGG - Exonic
1163061291 19:14763985-14764007 GAGGATAAAGAGGAAGAAAAAGG - Intronic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164470803 19:28530146-28530168 CAGGCTCAAGAAGAGGAAAAGGG + Intergenic
1164696047 19:30245157-30245179 CAGGTAAAAGGTGAGGATGAGGG - Intronic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1164957809 19:32402187-32402209 CAGGAGGAAGAGGAAGAAGAAGG + Intergenic
1165925188 19:39321783-39321805 AAGGTCAAAGGGGTGGAAGATGG - Intergenic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1167572574 19:50298280-50298302 CAGGTGAAAGAGGGGGCAGGAGG + Intronic
1167967161 19:53157493-53157515 CAGGTGCAAGCGGAGGAAGAAGG - Intronic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
925109261 2:1319639-1319661 CAGCTTACACAGGAAGAAGAGGG + Intronic
925683889 2:6451978-6452000 CAGGATAAATAGGAGGACAAAGG + Intergenic
925799504 2:7584084-7584106 CATTTTAAAGAGGAGGAAAGAGG + Intergenic
925898753 2:8493886-8493908 CAGGTCAGAGAGGAGGAAGGAGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926195353 2:10760517-10760539 CATGTGAGAGATGAGGAAGAAGG + Intronic
926422211 2:12711069-12711091 TAGGTCATAGAGGAGGAAAAGGG - Intergenic
927140891 2:20130101-20130123 CAAGTGAGACAGGAGGAAGAGGG - Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
928361088 2:30662885-30662907 CAGGTGCAGGAGGAGGAATAGGG + Intergenic
928582434 2:32722796-32722818 CAGGTTGAAGGGGAGGGAAATGG + Intronic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
929391025 2:41468847-41468869 AAGGTTAAGGATAAGGAAGAAGG - Intergenic
929711619 2:44272280-44272302 GAGGTTTAATAGGCGGAAGAAGG + Intergenic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
931052722 2:58431751-58431773 GAGGGTAAAGAAGAAGAAGATGG + Intergenic
931701696 2:64914272-64914294 CAGGTGGGAGAGAAGGAAGAAGG - Intergenic
931986329 2:67745728-67745750 CTAGTTTAAAAGGAGGAAGATGG - Intergenic
931992797 2:67807892-67807914 CAAGTGGAGGAGGAGGAAGAAGG - Intergenic
932394071 2:71427204-71427226 GAAGTTGGAGAGGAGGAAGATGG + Exonic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
934475975 2:94593785-94593807 GAGGATAAAGAGGAAGAAGAGGG - Intronic
934509795 2:94928464-94928486 CAAGTAAAAGAGGAGGCGGACGG + Intergenic
934555136 2:95283094-95283116 CTGGTTAAAGATGCGGAAGGAGG - Intronic
935086436 2:99850196-99850218 CAGGTTTATAAGTAGGAAGAGGG - Intronic
935106178 2:100045677-100045699 CTGGCTGAAGAGGAAGAAGAAGG - Intronic
935346465 2:102112624-102112646 CAGGTAAAAGAGGAAGCAAAAGG + Intronic
935665186 2:105505907-105505929 AAGGTTAATTAAGAGGAAGATGG - Intergenic
935687888 2:105700394-105700416 CAGATATAAGAGGAGGAAGATGG - Intergenic
935990241 2:108712793-108712815 CAGGTCAAAGATGAGAATGATGG + Intergenic
936343983 2:111661405-111661427 CAGTTTACAGAGGAGGAAACTGG + Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937229313 2:120388319-120388341 AAGGATAATGAGGAGGAAGGAGG + Intergenic
937458916 2:122068613-122068635 CAGGTTAGAGAGTTGGAAGATGG - Intergenic
938253072 2:129831270-129831292 CAGTTTAAAAAGGAGGAAAATGG - Intergenic
938319251 2:130352078-130352100 CATTTTAAAGATGGGGAAGAGGG + Intergenic
939010134 2:136836894-136836916 CTGGGTAAAGATGGGGAAGATGG - Intronic
939559612 2:143717144-143717166 CCATTTAAAGAGGAGAAAGAAGG - Intronic
940626308 2:156179747-156179769 CAAGTAAAAGAGAAGGAAGGTGG + Intergenic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
941357004 2:164505984-164506006 CAAGTTAGAAGGGAGGAAGATGG + Intronic
941693041 2:168521486-168521508 CAGGTGGAAGAAGAGGAGGAGGG + Intronic
942466196 2:176209590-176209612 GATGTTAAAGAAGAGGAAAATGG - Intergenic
942961742 2:181837619-181837641 CAATTGAAAGAGGAGGAAGGTGG - Intergenic
943044076 2:182837522-182837544 CAGGAAAAAGAGGAGGTAAAAGG - Intronic
943436669 2:187872521-187872543 CATGTTTCAGATGAGGAAGATGG + Intergenic
943568661 2:189546158-189546180 AAGGTTAAAGCGGATGAACAGGG - Intergenic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
943918541 2:193671126-193671148 CAGATATAAGAGGAGGAAAATGG + Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944328280 2:198433210-198433232 GAAGTGAAGGAGGAGGAAGAGGG + Intronic
945577816 2:211554275-211554297 CAGTTTATAGATGAGGAAAATGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946226980 2:218269477-218269499 GAGGAAGAAGAGGAGGAAGAGGG - Exonic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947982953 2:234425720-234425742 CAGGTGAAAGAGGAAGAGGCAGG - Intergenic
948091800 2:235301757-235301779 AAGGATAACGAGGAGGGAGAAGG - Intergenic
948261003 2:236604450-236604472 GAGGTCAAAGTGGAGGAAGATGG - Intergenic
948392917 2:237625706-237625728 AGGCTTAAAGATGAGGAAGATGG + Intergenic
948723017 2:239913158-239913180 CAGCTGGCAGAGGAGGAAGAAGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168837338 20:886001-886023 CAGGTTTGAGTGGATGAAGATGG + Intronic
1168996576 20:2137537-2137559 TAGGAAAAAGAGGAGCAAGAGGG - Intronic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169934226 20:10865719-10865741 CAGGTTGAAGAGGAGTAGGAGGG + Intergenic
1170034309 20:11973845-11973867 AAGGAAGAAGAGGAGGAAGAAGG + Intergenic
1170550683 20:17473519-17473541 AAGGTTAAATAGGAGGAGGTTGG - Intronic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171271186 20:23818768-23818790 CAATTTAAAGAGGACAAAGAAGG - Intergenic
1171796647 20:29571803-29571825 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1172180025 20:32997248-32997270 CAGGTTTCTGAGGAGGAAGGAGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172929080 20:38569929-38569951 CAGGTCCAAGGGGAGGAACAGGG - Exonic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173596293 20:44260672-44260694 CAGGTAGAAGGGGAGAAAGAGGG + Intronic
1173630433 20:44509976-44509998 CAGCTGAATGAGGATGAAGAGGG + Exonic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1174001024 20:47374811-47374833 AAGGATAAAGAAGAAGAAGAAGG + Intergenic
1174075016 20:47928643-47928665 CAAGTTACAGAGGAGGAAATGGG + Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174724733 20:52849746-52849768 TTGGTGAAAGAGGAGGAAAAAGG + Intergenic
1174944174 20:54966597-54966619 CAGGTTTGAGAGGAAGAAAAAGG - Intergenic
1175468348 20:59208245-59208267 CTGGATACAGAGGAGGGAGATGG - Intronic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175914584 20:62419727-62419749 CATCCTGAAGAGGAGGAAGAGGG + Exonic
1176094849 20:63335902-63335924 CAGGAAGAAGAGGAGGGAGAAGG + Intergenic
1176605229 21:8824717-8824739 CAGGTAAAAGAGGAGGTGGATGG - Intergenic
1178188813 21:30256525-30256547 TAGGAGAAAGAGGCGGAAGAAGG - Intergenic
1178361546 21:31952696-31952718 CAGCTGAAAGAAGAGGAAAAGGG - Intronic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1178977340 21:37231378-37231400 CAGGCTACAGAGGTGGGAGACGG + Intronic
1179887702 21:44321474-44321496 CAGGCAACAGAGGAGGCAGAAGG - Intronic
1180163073 21:46006710-46006732 CAGCTTACAGGGGAGGAAGCCGG - Intergenic
1180347524 22:11716322-11716344 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1180355289 22:11834432-11834454 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1180382962 22:12157895-12157917 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182676626 22:32043970-32043992 CAAGTTAGAGATGAGAAAGATGG + Intronic
1183843942 22:40524724-40524746 CAGTTAAAAGAGGAAGAAGATGG - Intronic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184205233 22:42998126-42998148 CAGGTTAAGGAGGGAGCAGAAGG + Intronic
1184449723 22:44575799-44575821 GAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184746842 22:46461156-46461178 GAGGGAAAAGGGGAGGAAGAGGG + Intronic
1184786331 22:46673718-46673740 CTGGGTAAAGAGGAGGACGCCGG + Exonic
1185157882 22:49205183-49205205 CATGTGAAAGGGGAGGAAGATGG + Intergenic
949163559 3:910516-910538 AAGGGCAAAGAGGAGGTAGAAGG + Intergenic
949379749 3:3431493-3431515 AAGGTTAAAGGGGAGGAAGCAGG + Intergenic
949794334 3:7830753-7830775 TAAATTAAAAAGGAGGAAGAAGG + Intergenic
950168867 3:10822450-10822472 GACTTTATAGAGGAGGAAGAGGG + Intronic
951643817 3:24865583-24865605 CAGGACAGAGAGGTGGAAGAGGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
953578950 3:44136135-44136157 AAGGGTAAAGGGGAGGAAGCAGG - Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953829009 3:46279135-46279157 CAATCTAAAGAGGATGAAGAAGG + Intergenic
954034559 3:47844247-47844269 CTGGAGAAAGACGAGGAAGAGGG + Intronic
954054689 3:48012046-48012068 CAGGTTAAATAGGTGAAGGATGG - Intronic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
955285377 3:57635877-57635899 TAGGTTGAAGAGGAAGAGGAGGG - Intronic
955316127 3:57940672-57940694 CAGATTAAAAAGGGGGAAGAAGG + Intergenic
955354122 3:58216348-58216370 CATGTTAAAGGTGAGGAAAAGGG - Intergenic
955813851 3:62821097-62821119 GATGTTTAAGATGAGGAAGAAGG - Intronic
956145271 3:66185605-66185627 CAGGTTAAAAATCAGGTAGAAGG - Intronic
956832460 3:73065120-73065142 GAGGATGAAGAGGAAGAAGAAGG + Exonic
957808206 3:85180208-85180230 CAGGTTAAAAAAGGGGAAAAAGG + Intronic
957907755 3:86579222-86579244 CATCTTAGAGTGGAGGAAGATGG - Intergenic
958041550 3:88231888-88231910 CAGATTAAAGGGGAAGAGGAAGG - Intergenic
958064510 3:88526089-88526111 AAAGTTAAAAAGGAGAAAGATGG - Intergenic
958454989 3:94319665-94319687 CAGGCTAAAGAGCAGTTAGAAGG + Intergenic
959422008 3:106140357-106140379 CAGCTAAAAGAAAAGGAAGAAGG + Intergenic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960799660 3:121525418-121525440 CAAGGTAAAGATGATGAAGATGG - Intronic
961821706 3:129578635-129578657 CTGTTTAAAGATGAGGAAGGTGG + Intronic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962306868 3:134295339-134295361 CAGGTTAAGGATGAGGGATAAGG + Intergenic
962733864 3:138306755-138306777 CAGGTGGCAGAGGAGGAACATGG + Intronic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
963341335 3:144037651-144037673 CACCTTAAACATGAGGAAGAAGG + Intronic
963800345 3:149669897-149669919 AAAGTTAAAGAGGAGAAAGAAGG + Intronic
963909002 3:150799205-150799227 CCAGTAAAAAAGGAGGAAGACGG - Intergenic
964278209 3:155031448-155031470 CAGATCATAGAGGAAGAAGAAGG + Intronic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
964682826 3:159361390-159361412 CAGTTTAAGGAAGAGCAAGAAGG + Intronic
965039519 3:163488626-163488648 CAGGAGAAAGAGGAAGAAGGGGG + Intergenic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
965628693 3:170708227-170708249 GAGGTAAGTGAGGAGGAAGAAGG + Intronic
965641607 3:170834735-170834757 CAGAATAAAGAGGAGGACAATGG + Intronic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
967150237 3:186641555-186641577 CAGGTTTGAGGGGAGGAAAATGG + Intronic
967298752 3:187991320-187991342 CAGGTGAAAGAGCATGAAGCTGG - Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969279120 4:6157675-6157697 CAGTTTAAACAGGAGAAAGCAGG - Intronic
970000031 4:11355765-11355787 CAGCTTAGAGAGGAAGCAGATGG + Intergenic
970124906 4:12798085-12798107 TTCGTTAAAAAGGAGGAAGATGG + Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971712259 4:30129455-30129477 CAGATTAGAGTGGAGGAATATGG - Intergenic
971812897 4:31450487-31450509 CAGGATAAAGGGGATGAACAAGG - Intergenic
972371549 4:38428774-38428796 CAAGAGAAAGAGGATGAAGAAGG + Intergenic
972448000 4:39165468-39165490 AGGGTTTATGAGGAGGAAGAAGG + Intergenic
972591609 4:40493342-40493364 ATGGTTGAGGAGGAGGAAGAAGG + Intronic
972650150 4:41009396-41009418 CAGACTACAGAGGAGGAAAAGGG + Intronic
972687243 4:41362828-41362850 CACGTTTAAGAAAAGGAAGAAGG + Intronic
972866515 4:43239897-43239919 GAGAATAAAGAAGAGGAAGAAGG + Intergenic
973372876 4:49266186-49266208 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
973388121 4:49528873-49528895 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
975948846 4:79743375-79743397 CAGGTCAATGAGGATGGAGAAGG - Intergenic
977536775 4:98262334-98262356 CAGATTAGACAGGAGGAAGCTGG - Intronic
977725573 4:100293195-100293217 CAGATTCTAGAGGAGCAAGATGG - Intergenic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
980979670 4:139643473-139643495 CAGGGTGCTGAGGAGGAAGAAGG - Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981341585 4:143627950-143627972 CAGATTAAGCAGGAGGAATAGGG - Intronic
981406450 4:144375280-144375302 GAGGTTAAGGAGGAGGGAGATGG - Intergenic
981686826 4:147463962-147463984 TCAGTTAAAGAGGAGGAATATGG + Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982276461 4:153640996-153641018 CAGGTTAGAGAAGAGCAACAAGG + Intergenic
982719020 4:158840123-158840145 CAGGTTATGGAGGAGGAAGGAGG + Intronic
983204839 4:164901590-164901612 CAGTTTAAAGAGGAGAAAACTGG - Intergenic
983344841 4:166515065-166515087 CAGGCTGAGGAGGAAGAAGAGGG + Intergenic
983366484 4:166797066-166797088 CAGATTGAAGAGGAGTAAGGAGG + Intronic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983523415 4:168734943-168734965 GAGGAGAAAGAGGAGGGAGAGGG + Intronic
983595856 4:169467003-169467025 TAGGCTGAAGAGGAGGAAGTTGG - Intronic
984005504 4:174301592-174301614 TAAGTTACAGATGAGGAAGATGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984459285 4:180012532-180012554 CAAGTTGATGAGCAGGAAGAAGG - Intergenic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
985507144 5:289409-289431 GAGGATGAAGAGGAAGAAGAAGG - Intronic
985649456 5:1100575-1100597 TGGGTAACAGAGGAGGAAGACGG + Intronic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
986618835 5:9648821-9648843 CAGGCTCATGAAGAGGAAGAAGG + Intronic
986684005 5:10259937-10259959 CAGGTGACTGAGGAGCAAGAAGG + Intronic
986748911 5:10767656-10767678 CACGTGAAAGAAGAGGAAGGAGG - Intergenic
987011225 5:13767693-13767715 CAGGTAAAAGAGGTTGGAGAGGG + Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987261695 5:16210860-16210882 CAGGTGGAAGAGCAGGGAGAGGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988238108 5:28573334-28573356 CAGTTCAAAGTGGAGGAGGATGG - Intergenic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988803502 5:34718746-34718768 CATTTTAAAGACGAGGAAGCTGG - Intronic
988918792 5:35921874-35921896 CAGTTAAAAGAGGAGGAAACAGG - Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989270517 5:39527463-39527485 CAGGTAAAAAACGATGAAGAAGG - Intergenic
989320627 5:40130404-40130426 CAGGTTCCAGAGGAAGAAGCAGG - Intergenic
990317953 5:54601801-54601823 CAGGTGAGAAATGAGGAAGAAGG - Intergenic
990747465 5:58974725-58974747 CAGGTTGAAGAGGAGGCAGTAGG - Exonic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991603000 5:68372199-68372221 CAGGTTAAATGGGAGAATGAAGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992024260 5:72654939-72654961 GAGGGAAAAGAGGAGGAAAATGG - Intergenic
993156347 5:84229488-84229510 AAGATTAAAAAGGAGGAAAATGG - Intronic
993248267 5:85480397-85480419 CTGTTAAAAGTGGAGGAAGAAGG - Intergenic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993638016 5:90369315-90369337 CAGGTACTAGAGGAGAAAGAGGG + Intergenic
993967426 5:94374815-94374837 AAGGATTAAGAGGAGGAAGTAGG - Intronic
994440137 5:99791528-99791550 AAGGTAAGAGAGGAGGAAGGAGG + Intergenic
994514657 5:100755532-100755554 CAGGTTAAAGATAAAGAAGCTGG - Intergenic
994734561 5:103536393-103536415 CAGGTTAAAGAGAAGGGTCAAGG - Intergenic
994784043 5:104132832-104132854 CATGCTGAAGAGGAGGAAGCTGG - Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
996031203 5:118705841-118705863 CAGTTTAAGGAGCAGGGAGAAGG - Intergenic
996440600 5:123486011-123486033 CAGATGTAAGAGGAGGAGGAGGG - Intergenic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997823851 5:137089106-137089128 CAGGTGCAAGGGGAGGAGGAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998718775 5:144917932-144917954 AAGGGTAAAGAAGAAGAAGACGG + Intergenic
999445025 5:151632469-151632491 GAGGTTAGAGAGGAGGAAGGTGG + Intergenic
999942363 5:156557755-156557777 CAGCTTGATGAGGAGGCAGAGGG - Intronic
1000111920 5:158116344-158116366 CATTTTACAGATGAGGAAGATGG - Intergenic
1000444181 5:161299644-161299666 AAGGAGGAAGAGGAGGAAGAGGG - Intronic
1000569541 5:162895281-162895303 AGGCTTAAAGAGGAGGAAGCTGG + Intergenic
1000730209 5:164825783-164825805 CATTTTAAAAAGGAGTAAGAGGG + Intergenic
1001253455 5:170166253-170166275 CAGGTTACAGAAGTGGAAGTGGG - Intergenic
1001383671 5:171320360-171320382 TAGGCTAAGGAGGAGGAAGTGGG - Intergenic
1001454652 5:171851468-171851490 CAAGTTAAAGAAAAGGAAGCAGG - Intergenic
1001724890 5:173888448-173888470 GAGGAGGAAGAGGAGGAAGAAGG + Exonic
1001740066 5:174045784-174045806 CAATTTGAAGAGGAGGAGGACGG - Exonic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002137413 5:177116543-177116565 CAGGAGGAAGATGAGGAAGAGGG + Intergenic
1002660081 5:180785865-180785887 CAGCTGTAAGAAGAGGAAGATGG - Intergenic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1003477610 6:6498538-6498560 GAGGATAAAGGGGAGGAAGAGGG - Intergenic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004222181 6:13756506-13756528 CCTGTTTGAGAGGAGGAAGAGGG - Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1005083457 6:21980603-21980625 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083529 6:21980967-21980989 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083557 6:21981131-21981153 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083581 6:21981300-21981322 CAGGTTCCAGGGCAGGAAGAAGG - Intergenic
1005083601 6:21981412-21981434 CAGGTTCCAGAGCAAGAAGAGGG - Intergenic
1005083622 6:21981545-21981567 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005962891 6:30705966-30705988 AAGGTAAAAGGGGAGAAAGAAGG + Exonic
1006170466 6:32089054-32089076 CAGGTTAAAGAGGAGGACTCAGG + Intronic
1006970504 6:38039394-38039416 AAGGTTAAAGAGGAAGAAAGTGG - Intronic
1007255879 6:40528380-40528402 CATGTTAAAGAGCTGGGAGAAGG - Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007482333 6:42158348-42158370 GAGGTGGAAGAGGAGGAAGAGGG - Intronic
1007620865 6:43213672-43213694 CAGGTACCAGAGGAGGCAGAGGG - Intronic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1008077877 6:47164644-47164666 AAGGTTAAAGAGAATGGAGAAGG - Intergenic
1008228433 6:48952576-48952598 GAGGAAAAAGAAGAGGAAGATGG + Intergenic
1009357052 6:62763492-62763514 CAGATTCAAGAGGTGCAAGAAGG - Intergenic
1009887442 6:69640612-69640634 CAAGATAAAGACCAGGAAGAGGG + Intergenic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010733461 6:79415176-79415198 AAGGTTCCAGAGGAGGAAGGAGG + Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1011417446 6:87137328-87137350 GAGGAGAAAGAGGAGAAAGAGGG - Intergenic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012258416 6:97060548-97060570 CCGGTGAAAGAGGAGGAGAATGG - Intronic
1012266173 6:97145976-97145998 CTGGCTAAAGAGCAAGAAGATGG + Exonic
1013046697 6:106492752-106492774 GAGGTAAAAGGGAAGGAAGAAGG - Intergenic
1013356385 6:109349277-109349299 CATCTTATAGAGGAGGAAGCTGG - Intergenic
1013773945 6:113658226-113658248 TTGGTAAAAGAGGAGTAAGAAGG - Intergenic
1014532237 6:122572081-122572103 CATGGTAAAGGGGTGGAAGAAGG + Intronic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1015084542 6:129273066-129273088 GATGTTAGAGAAGAGGAAGAAGG + Intronic
1015180651 6:130358521-130358543 CAGTTGACAGAGGAGGAAAAGGG + Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018611764 6:165654254-165654276 CAGGACAATGAGGAGGATGACGG - Intronic
1018767134 6:166943534-166943556 GGGGTTCAAGGGGAGGAAGAAGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1019876847 7:3820474-3820496 CCAGTTAAAGAGGTGGATGAGGG - Intronic
1020059859 7:5144037-5144059 CAGGTTGGAGAGGAAGAAGGGGG + Intergenic
1020085814 7:5309534-5309556 CATGTCAAAGAGATGGAAGAGGG - Intronic
1020273802 7:6613057-6613079 CAGGTCAGAGAGGAGAAGGAGGG + Intergenic
1020986212 7:15137834-15137856 TAGGTTAAGGAGGAGAGAGAGGG + Intergenic
1021758308 7:23877402-23877424 TGGGTTAAGGAGGAGGATGATGG + Intergenic
1021975258 7:26006312-26006334 CGGGTCCAAGAGGAAGAAGATGG + Intergenic
1022134677 7:27436123-27436145 CTGGTTAAAGTGGATGAAAAGGG + Intergenic
1022441272 7:30435489-30435511 CAGGTACAGGAGGAGGAAGTGGG - Intronic
1023274425 7:38502762-38502784 CAGGTTCAAGGGGCCGAAGAAGG - Intronic
1023295876 7:38714747-38714769 GAGGTGGAGGAGGAGGAAGAGGG - Intergenic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1024542270 7:50486600-50486622 CATGTGAATGAGGAGGAAGGGGG - Intronic
1024688945 7:51778873-51778895 CAGTTTACAGAGCAGTAAGAAGG + Intergenic
1025174653 7:56792490-56792512 CAAGATAAAAAGGAGGAAGACGG + Intergenic
1025208491 7:57007616-57007638 CATATCAAAGAGGTGGAAGAGGG + Intergenic
1025663457 7:63569262-63569284 CATATCAAAGAGGTGGAAGAGGG - Intergenic
1025697150 7:63783924-63783946 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025715460 7:63951768-63951790 CAGGTTCAAGAGGCTGAGGAAGG + Intergenic
1025826902 7:65018035-65018057 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025914448 7:65854453-65854475 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025975223 7:66364331-66364353 CAAAATAAAAAGGAGGAAGATGG + Intronic
1026297958 7:69072298-69072320 GAGCCAAAAGAGGAGGAAGAAGG + Intergenic
1026451407 7:70532687-70532709 CATGTTGGAGAGAAGGAAGAAGG - Intronic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1027193169 7:76009785-76009807 GAGGTCAAAGAGGAGGTGGAAGG - Intronic
1027360475 7:77403333-77403355 AAGGTGAAAGGGGTGGAAGAAGG + Intronic
1028064196 7:86361081-86361103 CAAGGTAAAGAGGATAAAGATGG + Intergenic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1028606496 7:92661669-92661691 GAGGGTAAAGGGGAAGAAGAGGG + Intronic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1030047197 7:105508250-105508272 GAGGAAGAAGAGGAGGAAGATGG - Exonic
1030141831 7:106311891-106311913 CAGGTTAATGAGGGTGCAGAGGG - Intergenic
1030236040 7:107263194-107263216 AAGGTTAAAGTGGCTGAAGATGG - Intronic
1030269647 7:107656516-107656538 CATATTAAAGAAGAGGCAGATGG + Intergenic
1030860130 7:114615348-114615370 TAGATTTATGAGGAGGAAGAGGG - Intronic
1030871036 7:114756877-114756899 CTGGTTAGAGAGGAGGGAGAGGG + Intergenic
1032439760 7:131933401-131933423 GAGGAAAAAGAGGAAGAAGAAGG + Intergenic
1032466793 7:132151238-132151260 GAGGATGAAGAGGAAGAAGAAGG + Intronic
1032630421 7:133645010-133645032 CAGGTGAAGGAGGAGGAAAAGGG - Intronic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1036472852 8:9066175-9066197 GAGGACAAAGAAGAGGAAGAAGG - Intronic
1036746959 8:11416739-11416761 CAGGCAGAAGAGGAGGAAGTTGG - Intronic
1036967228 8:13313845-13313867 CAAATTAAAGGTGAGGAAGAAGG - Intronic
1037261229 8:17011017-17011039 CATTTTACAGATGAGGAAGATGG + Intergenic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037360853 8:18072008-18072030 TAAGTTAAAGAGTAGGAAGTTGG - Intronic
1037586591 8:20280892-20280914 CAGCCTAGAGAGGAGGTAGAAGG - Intronic
1037734396 8:21555108-21555130 CAGCTTACAGAGGAGAAGGAGGG + Intergenic
1037855865 8:22370246-22370268 CAGGTAAGGAAGGAGGAAGAAGG - Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038664555 8:29526900-29526922 CAGGTGAAGAGGGAGGAAGAGGG - Intergenic
1038860768 8:31387086-31387108 CAGGTTAGTGAGGAGTAAGGAGG + Intergenic
1039335004 8:36579111-36579133 GAGGGTAAAGGGCAGGAAGAGGG + Intergenic
1039380008 8:37076254-37076276 AGGGTTAAGGAGGAGGAAGATGG + Intergenic
1039790338 8:40870860-40870882 CAGGCTAAAGAAGAGGATGCTGG + Intronic
1040099731 8:43488177-43488199 TAGGCTGAAGAGGAGAAAGAGGG + Intergenic
1043099382 8:76021300-76021322 CAGGAGGAAGAGGAAGAAGAGGG - Intergenic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045017188 8:98010091-98010113 GAGGCTAAAGAAGTGGAAGAGGG - Intronic
1045242183 8:100412152-100412174 GAGCTCAAAGAGCAGGAAGAGGG - Intergenic
1045503048 8:102757955-102757977 CAGGTAAGAGAGGAGGGAGAGGG + Intergenic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046874771 8:119241870-119241892 CTAGTTGAAGTGGAGGAAGAGGG + Intronic
1046990749 8:120450213-120450235 CACGTTAAAGGGGAGGAAAGAGG + Intronic
1047601977 8:126434724-126434746 CAGTTAAAAGAGGAAGAGGAAGG + Intergenic
1047612651 8:126536193-126536215 GAGGTTAAAAAGGTAGAAGAAGG - Intergenic
1047981185 8:130184380-130184402 CAGGTAAAAGAGTTGGAAAAAGG + Intronic
1048231981 8:132651381-132651403 GAGGTGACAGAGGAGGAAGATGG - Intronic
1048445064 8:134487248-134487270 CAGGCTACAGAAGAGAAAGAAGG - Intronic
1048557919 8:135499088-135499110 CAGGTAAAAGAGGTGGAACATGG + Intronic
1048715424 8:137263441-137263463 CAAGTTAAAAAGAAGAAAGAGGG - Intergenic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049223447 8:141438332-141438354 CAGGGTACAGAGGAGGCACATGG + Intergenic
1050703077 9:8363518-8363540 TAGGTAAGAGAGGAGGAAAAAGG - Intronic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1050856723 9:10366914-10366936 CAGGATAATGATTAGGAAGAAGG + Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051209610 9:14727816-14727838 AATTTTAAAGATGAGGAAGAAGG - Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052052947 9:23868833-23868855 CAAGATCAAGAGGTGGAAGAGGG - Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1052854071 9:33396134-33396156 GAGGATAAAGAGGAAGAAGAGGG + Intronic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053655607 9:40215785-40215807 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1053682085 9:40492298-40492320 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1053789373 9:41675618-41675640 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1053905970 9:42845001-42845023 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1053932072 9:43120624-43120646 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054155769 9:61639144-61639166 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054177654 9:61886971-61886993 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1054281628 9:63132634-63132656 GAGGATAAAGAGGAAGAAGAGGG - Intergenic
1054295182 9:63327795-63327817 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054367725 9:64362015-64362037 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054393202 9:64632301-64632323 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054427851 9:65137511-65137533 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054475538 9:65570145-65570167 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054502525 9:65884027-65884049 GAGGATAAAGAGGAAGAAGAGGG - Intronic
1054528999 9:66160507-66160529 CAAGTAAAAGAGGAGGTGGATGG + Intergenic
1054659877 9:67693837-67693859 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054675342 9:67851750-67851772 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055674681 9:78645035-78645057 AGGGTTAAAGAGGAGGATGGGGG - Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055737463 9:79347010-79347032 CTGATTAAAGAGGGAGAAGATGG - Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055862182 9:80764977-80764999 CAGGTTAAGGAGTAGGTAGCAGG - Intergenic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1056625568 9:88250217-88250239 CAGCTTGCAGAGGAGCAAGAGGG + Intergenic
1056852746 9:90097908-90097930 CATTTTATAGAGGAGGAAGTGGG + Intergenic
1057294813 9:93828680-93828702 CAGGTCAGGGAGGAGGCAGAGGG - Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059249120 9:112872447-112872469 CTGGTGAGAGAGGAGGAAGAGGG + Exonic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059606154 9:115838654-115838676 CATGTGAAAAGGGAGGAAGAGGG + Intergenic
1059746264 9:117204585-117204607 CAGCTTTAAGAGCTGGAAGAGGG + Intronic
1059812026 9:117865957-117865979 AAGGGTAAAGGGGAGGAAGCAGG + Intergenic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060246781 9:121953139-121953161 TAGTTTAAGGAGGAGGAAAATGG + Intronic
1060252162 9:121995188-121995210 CAGGATAGAGAGGAAGAAGAGGG + Intronic
1060338386 9:122749936-122749958 CAGGTACATGATGAGGAAGATGG - Exonic
1060832816 9:126728458-126728480 AATTTTAAAGAGGAGGAACAAGG - Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061268937 9:129525309-129525331 CAGGTTCAAGAGTATGAATATGG + Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061605622 9:131708474-131708496 CAGCTTGAGGAGGAGGAAGTTGG - Intronic
1061888498 9:133605491-133605513 CAGGTGGCAGAGGTGGAAGAAGG - Intergenic
1062190777 9:135246841-135246863 CATGCAAGAGAGGAGGAAGAGGG + Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1203696590 Un_GL000214v1:104212-104234 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1203552630 Un_KI270743v1:176816-176838 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1185499177 X:584471-584493 CAGGAAGAAGAGGAGGAAAAAGG + Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186787637 X:12968462-12968484 GGGGTTAAAGAGGAGGAGCATGG + Intergenic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187289880 X:17942698-17942720 GAGGTGGAGGAGGAGGAAGAGGG + Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1187934556 X:24322876-24322898 CAGGTTATAGACAAGGAAGCAGG + Intergenic
1188307509 X:28576219-28576241 CTGGCTCAAGTGGAGGAAGACGG + Intergenic
1188383101 X:29521830-29521852 CATGTTAAAGAGGGGGAAATAGG + Intronic
1190827233 X:54028790-54028812 CAGGGTATAGTGGAGGGAGAGGG - Intronic
1191685375 X:63884597-63884619 GGGATTAAAGAGGAGGAAGCTGG + Intergenic
1191701671 X:64048465-64048487 GAGCTTCCAGAGGAGGAAGAAGG + Intergenic
1191715373 X:64190474-64190496 GAGGACGAAGAGGAGGAAGAAGG - Exonic
1191880068 X:65836996-65837018 CATCTTACAGAAGAGGAAGAAGG - Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192669525 X:73125223-73125245 GAGGTGAAAGAGGAGGAGTATGG - Intergenic
1192912847 X:75623574-75623596 CAGGATGTAGAGGAGAAAGAGGG + Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193758710 X:85440149-85440171 CAGCTTCCAGAGGAAGAAGAAGG - Intergenic
1194844382 X:98786304-98786326 CAGATTCAAGAGGAGGAAACAGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195674823 X:107499995-107500017 CATGTTAAAGAGGCGGTGGAAGG + Intergenic
1195928068 X:110046295-110046317 GAGGTTAAATAGGATAAAGAAGG - Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196469707 X:116011582-116011604 CAGGTTAAGGGGGAAGAAGGAGG - Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1198860595 X:141065070-141065092 CAGGTGAAAGATGGGAAAGAAGG + Intergenic
1198902096 X:141522319-141522341 CAGGTGAAAGATGGGAAAGAAGG - Intergenic
1199096942 X:143754549-143754571 AATGCTAAAGAAGAGGAAGAGGG + Intergenic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1199628678 X:149761736-149761758 CAGGATCAATGGGAGGAAGAGGG - Intergenic
1199848759 X:151710450-151710472 GATGTTGGAGAGGAGGAAGAAGG - Intergenic
1199878446 X:151953892-151953914 GGGGTCAAAGAGAAGGAAGAGGG + Exonic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1201618588 Y:15929198-15929220 CAGGTCAATTAGGAAGAAGAAGG + Intergenic