ID: 1150266802

View in Genome Browser
Species Human (GRCh38)
Location 17:63837466-63837488
Sequence GCTGCGCCTGGGGCACAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150266794_1150266802 2 Left 1150266794 17:63837441-63837463 CCCCGGCGCTGGGCAGGCATGGG 0: 1
1: 0
2: 1
3: 27
4: 252
Right 1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG 0: 1
1: 0
2: 0
3: 20
4: 214
1150266796_1150266802 1 Left 1150266796 17:63837442-63837464 CCCGGCGCTGGGCAGGCATGGGA 0: 1
1: 0
2: 5
3: 35
4: 342
Right 1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG 0: 1
1: 0
2: 0
3: 20
4: 214
1150266797_1150266802 0 Left 1150266797 17:63837443-63837465 CCGGCGCTGGGCAGGCATGGGAG 0: 1
1: 0
2: 0
3: 23
4: 316
Right 1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG 0: 1
1: 0
2: 0
3: 20
4: 214
1150266792_1150266802 3 Left 1150266792 17:63837440-63837462 CCCCCGGCGCTGGGCAGGCATGG 0: 1
1: 0
2: 2
3: 25
4: 211
Right 1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG 0: 1
1: 0
2: 0
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150266802 Original CRISPR GCTGCGCCTGGGGCACAAGC AGG Exonic
900001166 1:15656-15678 GCTTCCCCTAGGGCACATGCTGG - Intergenic
900020881 1:186177-186199 GCTTCCCCTAGGGCACATGCTGG - Intergenic
900101798 1:965085-965107 GCTGCGCCGGGTGAACATGCAGG - Exonic
901027597 1:6286874-6286896 GGTGCCCCTGGGGCACACTCAGG - Intronic
901638608 1:10681867-10681889 GGTGAGCCTGGGGCTCAAGAGGG - Intronic
902246513 1:15124470-15124492 GCCGCGCCTGGGGCGCAGGCAGG - Intergenic
903024471 1:20417681-20417703 GCAGCGCCTGGGGTACCTGCAGG - Intergenic
903389286 1:22953060-22953082 GCTGCGGCTGCGGGGCAAGCCGG - Exonic
904619065 1:31764503-31764525 CCGGCGCCTGGGGCCCAAGGCGG - Intronic
905249266 1:36637695-36637717 GCTGCTCCTGGGGAACACCCAGG - Intergenic
906314538 1:44777756-44777778 GCTGCCCCTGGGCCGCAAGAAGG + Exonic
909708633 1:78617789-78617811 GCTGTGCCTGCTGCAGAAGCTGG - Intergenic
913971519 1:143421222-143421244 CCTAGGCCTGGGGCACATGCAGG + Intergenic
914065896 1:144246835-144246857 CCTAGGCCTGGGGCACATGCAGG + Intergenic
914113255 1:144719519-144719541 CCTAGGCCTGGGGCACATGCAGG - Intergenic
915334600 1:155133798-155133820 ACTGGGCCTGGGGCACAGGAAGG + Intronic
915519563 1:156433876-156433898 GCAGAGCCTGGGGGAGAAGCAGG - Intergenic
917978644 1:180255968-180255990 GCTGTGCCTGGGCCAAAAGAGGG - Intronic
920210134 1:204321923-204321945 GCTGCCCCTGGGGCTCTGGCAGG + Intronic
921076799 1:211706474-211706496 GCTGTGCCTGGGCCCCAAGTGGG - Intergenic
922092927 1:222414704-222414726 GCTGAGGATGGGCCACAAGCAGG - Intergenic
922590448 1:226771913-226771935 GATGTGCATGGGGCACATGCTGG - Intergenic
922799529 1:228358873-228358895 GCTGTGCGTGGGGCACTGGCTGG - Intronic
922954601 1:229588448-229588470 GCAGGGCCTTGGGCACCAGCGGG - Intergenic
1063410616 10:5833897-5833919 GCTGCCCCTGGGGAAAAAGCAGG - Intronic
1067237914 10:44467241-44467263 CCTGGGCCTGGGCCACGAGCTGG + Intergenic
1067683322 10:48453585-48453607 GCTTCCCCTGGGGCCCAAGAGGG + Intronic
1067747364 10:48945979-48946001 GTGGCTCCTAGGGCACAAGCGGG + Intronic
1069825114 10:71250156-71250178 GCAGGGCCTGGGGCACCACCTGG - Intronic
1072727188 10:97821960-97821982 CCAGCGCCTGGGGCACAGGGTGG + Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076687297 10:132203932-132203954 GTTGGGCCTGGGGCACCAGTGGG + Intronic
1077308358 11:1877805-1877827 CCTAGGCCTGGGGCACACGCAGG - Intronic
1077358567 11:2129793-2129815 GCTGAGCTGGGGGCACAAGTGGG + Intronic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1079659580 11:23021521-23021543 GCTGAGGCTGGGGCAAAAGCTGG - Intergenic
1080768348 11:35317410-35317432 CCTGCGCCTGTGTGACAAGCTGG - Exonic
1084611145 11:70203727-70203749 GCCGCGCCTGGGGAAGAAGGTGG + Exonic
1085172832 11:74463443-74463465 GCTGCCTCTGGGGCTCAAGCTGG + Intronic
1085767100 11:79292625-79292647 GCTGTGGCTAGGGCACATGCAGG + Intronic
1086457899 11:86977376-86977398 GCTGCTTCTGGGGAACCAGCTGG + Intergenic
1087893228 11:103558589-103558611 ACTGCCCCTGGGGCACACACAGG - Intergenic
1088799141 11:113289584-113289606 GCTGTGCCAGGGTCACAAGGAGG - Intergenic
1089563861 11:119360146-119360168 GGTGGGCCTGGGGAAGAAGCAGG + Intronic
1090619452 11:128548639-128548661 GCAGCGCCTGGGCCCCAAGCGGG - Intronic
1091002133 11:131918577-131918599 GCTGAGCCTGGGACTCAAGATGG + Intronic
1091305833 11:134535529-134535551 ACTCTGCCTGGAGCACAAGCAGG - Intergenic
1091374255 12:15773-15795 GCTTCCCCTAGGGCACATGCTGG - Intergenic
1092094085 12:5827601-5827623 GCTGCTCCTGGGGCCAAGGCAGG + Intronic
1095852477 12:46825963-46825985 GCAGCGCCTGGAGCATGAGCCGG - Exonic
1096747042 12:53735803-53735825 GCTGTTCCTGGGGCCTAAGCAGG + Intergenic
1101496417 12:105258795-105258817 GCAGGGCCTGGGGCACACGGTGG - Intronic
1101755550 12:107618265-107618287 GTTGCGGCTGGCGCACAAGGGGG - Exonic
1103431308 12:120889499-120889521 GCAGTGCCAGGGGCACAAGAGGG - Intronic
1104962431 12:132494549-132494571 GCTGCGCCTGGGCCACAGGGAGG + Intronic
1105927335 13:25019265-25019287 GCTGCACCTAGGGCACGGGCTGG + Intergenic
1106152481 13:27119080-27119102 GTGGCGCCTGGCACACAAGCAGG + Intronic
1109062070 13:57632462-57632484 GCTGCGCCAGGGCCCCAGGCTGG + Exonic
1113657441 13:112076348-112076370 GCTGCTTCTGGGGCTCCAGCGGG + Intergenic
1113963015 13:114135794-114135816 TCTGGGCCTGGGCCACCAGCCGG - Intergenic
1119772827 14:77231745-77231767 GCTGGCCCTGGGGCAGCAGCTGG + Intronic
1120823015 14:88930417-88930439 GCTGCGGCTGGGGGTCAGGCTGG - Intergenic
1121307765 14:92917706-92917728 GCTTTCCCTGGGGCACAGGCAGG + Intergenic
1122260538 14:100517730-100517752 GCTGCTCCTGGGGCTGAGGCAGG + Intronic
1122278889 14:100609875-100609897 GCTGGGGCTGGGGCAGCAGCAGG + Intergenic
1122947892 14:105021420-105021442 CCTGCGCCTGGGGCCCACGTGGG + Intergenic
1122985307 14:105209036-105209058 ACTGCGCTGGGGGCCCAAGCGGG + Intergenic
1130133797 15:81164889-81164911 GCTGAGTCTGGGGCACAGGATGG + Intronic
1130994250 15:88895259-88895281 GGGGCGCCCGGGGCACAAGTGGG - Intronic
1131925577 15:97379716-97379738 GGCCAGCCTGGGGCACAAGCAGG + Intergenic
1132317722 15:100901965-100901987 GCTGGGTTTGGGGCACAGGCTGG - Intronic
1132452343 15:101975283-101975305 GCTTCCCCTAGGGCACATGCTGG + Intergenic
1132454552 16:15340-15362 GCTTCCCCTAGGGCACATGCTGG - Intronic
1132608562 16:803663-803685 GCAGAGCCTAGGGCACAGGCGGG - Intergenic
1132909094 16:2299242-2299264 GCAGGCCCAGGGGCACAAGCAGG - Intronic
1132912381 16:2321148-2321170 GCTGAGACTGGGGCCCAGGCAGG - Intronic
1133379851 16:5320891-5320913 GCCGCCCCTGGGGCAACAGCAGG - Intergenic
1133423301 16:5665551-5665573 CCTGCCCCTGTGGCACTAGCTGG - Intergenic
1136718355 16:32302096-32302118 GCAGGGCCAGGGCCACAAGCAGG + Intergenic
1136768464 16:32811494-32811516 GCTGCGGCGGGGGCAAAAGGCGG + Intergenic
1136836729 16:33508366-33508388 GCAGGGCCAGGGCCACAAGCAGG + Intergenic
1139393114 16:66618558-66618580 GGTACGCCTGGGCCACACGCAGG + Intronic
1140456359 16:75107784-75107806 GCTGAGCTTGGGACACCAGCGGG + Exonic
1141148419 16:81547845-81547867 CCTGGCCCTGGGGCACAAGCTGG - Intronic
1141635896 16:85313585-85313607 GCTGTCCCAGGGGCACTAGCAGG - Intergenic
1141760627 16:86026412-86026434 GCCCTGCCTGGGGCACCAGCGGG + Intergenic
1142210108 16:88804675-88804697 GCGGGGCCTGGGGCAGATGCGGG + Intronic
1203008073 16_KI270728v1_random:215669-215691 GCAGGGCCAGGGCCACAAGCAGG - Intergenic
1203070861 16_KI270728v1_random:1073548-1073570 GCTGCGGCGGGGGCAAAAGGCGG + Intergenic
1203146909 16_KI270728v1_random:1808645-1808667 GCAGGGCCAGGGCCACAAGCAGG + Intergenic
1142622899 17:1176200-1176222 GCTGGGCCTGGAGCCCAGGCAGG - Intronic
1143501848 17:7343845-7343867 GCAGCACCTGGGGGACAAGGCGG - Exonic
1144738425 17:17567809-17567831 GCGGAGCCTGTGGCACAAGAAGG - Intronic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1146729689 17:35183014-35183036 GCAGGGACTGGGGCAGAAGCAGG - Intronic
1147670100 17:42171929-42171951 GCTGCGGCTGCTGCAGAAGCTGG - Exonic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150266367 17:63834677-63834699 AGTGGGCCTGGGGCAAAAGCAGG - Intronic
1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG + Exonic
1150733513 17:67716145-67716167 AGTGCGCCTGGGGCACCAACAGG - Intergenic
1151155869 17:72122767-72122789 GCTGCGCGTGCAGCACAAGAAGG + Exonic
1151591282 17:75046696-75046718 GCGGCGCCTGGGACACAGCCGGG + Intronic
1155168518 18:23249874-23249896 GCAGTGCATGGGGCACGAGCTGG + Intronic
1157933145 18:51845253-51845275 GCTGCCCCTGGGCCGCAAGAAGG - Intergenic
1159378666 18:67628452-67628474 GCTGCTCCTGAGGCTGAAGCAGG - Intergenic
1160543945 18:79640575-79640597 GCAGCGTCTGAGGCACAGGCTGG + Intergenic
1160591219 18:79945647-79945669 TCTGGGCCTGAGGCACAGGCCGG + Intronic
1160763711 19:797980-798002 GCTGCGCCGGGGGCAGAGTCCGG - Intronic
1161335446 19:3710457-3710479 GCTGAGCCTGAGGCATCAGCTGG - Intronic
1161993327 19:7697646-7697668 CCTGAGCCTGGGGCATAGGCGGG - Intronic
1162558412 19:11401953-11401975 GCTGAGCCTGGGTCACCAACTGG - Intronic
1162904944 19:13817819-13817841 GCTGGGGCTGGGGCAGCAGCGGG + Exonic
1162935049 19:13978080-13978102 GCTGCACCTGGGGCAGAGGAAGG + Exonic
1165720137 19:38073230-38073252 GCTGCGTCACGGTCACAAGCTGG - Intronic
1165795968 19:38519329-38519351 GCTGCGCCTGGAGGCCAAGGCGG + Exonic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1167631328 19:50627966-50627988 GCTGGGCTTGGGGGCCAAGCAGG + Intronic
1167752013 19:51387222-51387244 GCCGCGCCTGGGGAAAGAGCAGG - Exonic
1167852529 19:52212999-52213021 GATCCTCCTGGGGCAGAAGCTGG - Exonic
1168018941 19:53594896-53594918 GCTGTGCTGGGGGCCCAAGCCGG + Intergenic
1168409019 19:56127094-56127116 GGTGTGCATGGGGCACAGGCCGG - Intergenic
924988698 2:293237-293259 ACTGGGCCTGGGGCAGCAGCAGG - Intergenic
925011939 2:492541-492563 GCTTCACCTGGAACACAAGCAGG + Intergenic
927754396 2:25697318-25697340 GCTTGGCCTGGAGCCCAAGCTGG + Intergenic
927812457 2:26187616-26187638 GCTGGGCCTGGGGAATACGCAGG - Exonic
930002005 2:46867837-46867859 GCTGTTCATGGGGCACCAGCTGG - Intergenic
931052352 2:58428593-58428615 GCTGCGCCGGGGGCAAGAGGAGG - Intergenic
931944236 2:67287417-67287439 GCTGTGACTGGGGTACAAGGTGG - Intergenic
934176213 2:89582155-89582177 CCTAGGCCTGGGGCACATGCAGG + Intergenic
934176399 2:89582896-89582918 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934286523 2:91656516-91656538 CCTAGGCCTGGGGCACATGCAGG + Intergenic
934286709 2:91657257-91657279 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
936456907 2:112682222-112682244 GCTGCGCCTGGGTGACAGGAGGG - Intergenic
936568558 2:113597756-113597778 GCTTCCCCTAGGGCACATGCTGG + Intergenic
937318198 2:120945354-120945376 TCTGGGCATGAGGCACAAGCAGG - Intronic
937429449 2:121826050-121826072 TCTGTCCCAGGGGCACAAGCTGG + Intergenic
938536269 2:132252355-132252377 GCTGTGCCTGGGGCCCCATCCGG - Intronic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
946774668 2:223125034-223125056 GCTGCTCCTGGGGCAAGGGCAGG + Intronic
948226869 2:236318134-236318156 GCTGCACCTTGGGCCCAAGGAGG - Intergenic
948563246 2:238867654-238867676 GCCGAGGCTGGGGCACAGGCTGG + Intronic
948575535 2:238947184-238947206 GCTGTGCCTGGGGCAGGGGCGGG + Intergenic
948610298 2:239162368-239162390 GGTGCCCCTGGGGCCCAAGCTGG - Intronic
1171400710 20:24871682-24871704 CCTGTGCCTGGGGCAGGAGCAGG - Intergenic
1172310364 20:33913372-33913394 GCAGGACCTGGAGCACAAGCAGG - Intergenic
1172774208 20:37397802-37397824 GCTGCGGCTGGAGGTCAAGCTGG + Exonic
1174193069 20:48754013-48754035 GCAGCGCCTGGGACAGAGGCTGG + Intronic
1174387741 20:50197324-50197346 GCTGAGCTTGGGGCTCAGGCAGG - Intergenic
1174977006 20:55347198-55347220 GCTGAGAGTGGGGCAGAAGCTGG - Intergenic
1175251804 20:57614484-57614506 GCTGACCCTGGGGCTCCAGCCGG + Intronic
1180124393 21:45779061-45779083 GCTGGGACTGGGGAACAAGCTGG - Intronic
1180866308 22:19122009-19122031 GCCGCGCCTGGGGCAGGGGCGGG - Intronic
1181510855 22:23388211-23388233 GCTGCGGCGGGGGCACTGGCTGG - Intergenic
1181610932 22:24011422-24011444 GCAGAGCCCGGGGCACAGGCCGG + Exonic
1182923488 22:34101533-34101555 GCTGGGCCTGGGGCAGGAGAAGG + Intergenic
1185161554 22:49232923-49232945 GCTGTGCTGGGGGCACAGGCTGG + Intergenic
950669981 3:14520134-14520156 GCTGACTCTGGGGCACAGGCAGG + Exonic
954628913 3:52037777-52037799 CCTGAGCCTGGGGCAGAGGCTGG + Intergenic
957421476 3:79977307-79977329 GCCACGCCTGGGGTAGAAGCTGG + Intergenic
961368638 3:126416405-126416427 GCTGCAGCTGGAGGACAAGCAGG + Exonic
961448776 3:126993078-126993100 GGTGCCCCTGGGGCACAAGAGGG - Intronic
962599055 3:136976667-136976689 GCTGAGACTGGGGCACAAACTGG - Intronic
962826819 3:139106510-139106532 GCAGAGCCCGGGGCACAGGCTGG - Intronic
964522015 3:157580277-157580299 GCTGCTACTTGGGCACAAGATGG - Intronic
967170241 3:186817594-186817616 CCTGTGCCTGGTGCACTAGCAGG + Intergenic
968576508 4:1368765-1368787 GCTGAGCCTGGGGCCTGAGCTGG - Intronic
969052899 4:4385802-4385824 GCTGTGCCTGGGGCTCAAGGCGG + Intronic
969338817 4:6527857-6527879 GCAGGGCCTGGGGCCCCAGCAGG + Intronic
969612750 4:8236325-8236347 GCTGCGGCTGTGCAACAAGCTGG + Exonic
970860176 4:20693411-20693433 GCTGCTCCGGAGGCAGAAGCAGG + Intergenic
981758424 4:148167187-148167209 GCCGCTCCTGGGTCACAAGGTGG + Intronic
982476084 4:155852750-155852772 GGTGTGCATGGGACACAAGCTGG + Intronic
985692801 5:1323055-1323077 GCTGAGCCTGGTTCTCAAGCTGG + Intronic
986716188 5:10525364-10525386 GCCGAGTCTGGGGCACAAGGTGG + Intergenic
988264303 5:28928812-28928834 GCTGCACCTAGGGCACGGGCTGG + Intergenic
988651983 5:33162534-33162556 GCTGCCCCTGGGCCGCAAGAAGG + Intergenic
998148616 5:139744681-139744703 GCTGGGTCTGGGGCAGGAGCGGG - Intergenic
999238861 5:150115840-150115862 GCTCCACCTGGAGCTCAAGCTGG + Exonic
999252812 5:150192639-150192661 CCTGCCCCTGGAGCAGAAGCAGG + Intronic
1000254084 5:159521283-159521305 GCTGACCCTGGGGCAGAACCCGG + Intergenic
1000358266 5:160421959-160421981 GCTGCGGCTGGGGCTGAAGCTGG + Exonic
1001159576 5:169301079-169301101 GCTGCGGCTGGGGCACGGGGCGG + Intronic
1002474981 5:179459832-179459854 TCAGCGGCTGGGGCACCAGCAGG - Intergenic
1002711774 5:181199243-181199265 GCTGCCCCTGAGGCCCACGCAGG - Intronic
1003603809 6:7542010-7542032 GCGGCGGCGGGGGCACCAGCAGG + Exonic
1005883173 6:30075278-30075300 GCTGAGCCTGGGGCCCGTGCGGG - Exonic
1010047110 6:71458134-71458156 GCAGCACCTGGGGCAGCAGCTGG - Intergenic
1011099637 6:83708165-83708187 GCTGCGACTGGAGCCCACGCTGG - Intronic
1015261527 6:131243097-131243119 GCTGAGCGTGGGGCACTAGGAGG + Intronic
1019341549 7:511073-511095 GCTGGGCCTGGGGGGCAACCAGG + Intronic
1019970618 7:4537868-4537890 GCCCCGCCTGGGACCCAAGCCGG + Intergenic
1020151362 7:5684394-5684416 ACTGCGCCTGGCCCACAAGCTGG + Intronic
1020959615 7:14786683-14786705 GCTGAGCCTGTGTCACAACCTGG + Intronic
1021558551 7:21945909-21945931 GCTCCGCCCGGAGCACAGGCGGG + Exonic
1024043936 7:45574882-45574904 GCTGCAGCTGGGGCACCTGCAGG - Exonic
1025148700 7:56527535-56527557 GCTGGGCCTGAGGAACAGGCTGG + Intergenic
1026828171 7:73596663-73596685 GCTCCGCTTTGGGGACAAGCAGG + Exonic
1027173302 7:75888052-75888074 GCTGCGTCTGGGACACAGGGTGG - Exonic
1031977655 7:128104141-128104163 GCTGCGCTGGGGGCCGAAGCGGG - Intergenic
1032257084 7:130305987-130306009 GCTGGGCCTGGGGCACGAGGTGG + Intronic
1033214494 7:139483602-139483624 GCTGCGCCCGGAGGCCAAGCCGG - Exonic
1036663946 8:10726583-10726605 GCTGCGCCTGCAGCACATGCAGG - Exonic
1038013920 8:23497400-23497422 GCTGAGCCTGGGTCCCAGGCAGG + Intergenic
1039527659 8:38231297-38231319 GCTGCTCCTGGCGCACTAGTAGG + Intronic
1041107845 8:54459119-54459141 GCTGCGCGTGCAGCACATGCAGG + Exonic
1041220725 8:55648562-55648584 GCTGGGCCTGGAGCTCTAGCCGG + Intergenic
1042099726 8:65262017-65262039 GTTGCTCCTGGGGCAATAGCAGG + Intergenic
1044560075 8:93604184-93604206 GCTATGCCTGGGGAAGAAGCTGG - Intergenic
1045295929 8:100871756-100871778 GCTGAGCTTAGGGCTCAAGCCGG + Intergenic
1048533701 8:135273537-135273559 GCTGCGGTTGGGGCACAGGTAGG - Intergenic
1049201604 8:141343305-141343327 GCTGGGGCTGGGGCACAAGGGGG - Intergenic
1049597612 8:143491969-143491991 GCTGCGCCTGGTGCACCAGGTGG - Intronic
1049619798 8:143592936-143592958 GCAGGCCCTGGGGGACAAGCAGG + Intronic
1049883970 9:15769-15791 GCTTCCCCTAGGGCACATGCTGG - Intergenic
1053715734 9:40885363-40885385 GCTGCACCTAGGGCACGGGCTGG + Intergenic
1054076815 9:60545375-60545397 GCTGCACCTTGGGCACGGGCTGG - Intergenic
1058687048 9:107488714-107488736 GAGCCGCCTGGGGCGCAAGCCGG - Intronic
1059335949 9:113568592-113568614 GAGGCGCCTGGGGAACAGGCTGG - Intronic
1059677025 9:116549465-116549487 CCTGGGCCTGGGGCCCCAGCTGG - Intronic
1060582283 9:124760198-124760220 GCTGCTCCAGGGGCTGAAGCAGG + Intronic
1061580182 9:131531417-131531439 GCTGCGCCCGGGCCTCGAGCCGG + Intergenic
1062040276 9:134401380-134401402 GCTGGGCCTGCGGCAGACGCAGG - Intronic
1062285013 9:135768937-135768959 GGTGCGTCTGGGGCACACGTGGG + Exonic
1062291058 9:135794554-135794576 GCTCCGCCTGGAGCTCATGCGGG + Intergenic
1185877170 X:3711340-3711362 GCTGCCTCTGGGGACCAAGCTGG - Intronic
1186514190 X:10153992-10154014 GAGGCGCCTGGGGAAGAAGCTGG + Intergenic
1192553101 X:72069501-72069523 TCTGTGCCAGGGGCACAAGTGGG + Intergenic
1193450468 X:81658629-81658651 GCTGGTACTGGGGTACAAGCTGG - Intergenic
1195777943 X:108428259-108428281 GCGGCCCTTGGGGCACAAGTTGG + Intronic
1197262439 X:124333256-124333278 GCTGCGCCTGGAGCATGAGGTGG + Intronic
1197345070 X:125320458-125320480 GCTGCGCCTGGAGCATGAGGAGG + Intergenic
1199134787 X:144236557-144236579 GCTAAGACTGGGGCAGAAGCTGG - Intergenic
1199975599 X:152893396-152893418 GCTGCTTCTGGGGCAGCAGCAGG + Intergenic
1200401838 X:156024390-156024412 GCTTCCCCTAGGGCACATGCTGG + Intergenic
1201575304 Y:15456080-15456102 GCTGCGGCTGGGGCAAGGGCGGG + Intergenic