ID: 1150270715

View in Genome Browser
Species Human (GRCh38)
Location 17:63862708-63862730
Sequence CTTCTGTGCTTGGGCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150270710_1150270715 7 Left 1150270710 17:63862678-63862700 CCTTGTACTCTCAGACTTTCCTA No data
Right 1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG No data
1150270709_1150270715 30 Left 1150270709 17:63862655-63862677 CCTGGTGGGCTGGGGTGGGTGAT No data
Right 1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150270715 Original CRISPR CTTCTGTGCTTGGGCAGGAC TGG Intergenic
No off target data available for this crispr