ID: 1150271737

View in Genome Browser
Species Human (GRCh38)
Location 17:63871262-63871284
Sequence CCATCAGGACTGAAGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150271737_1150271749 10 Left 1150271737 17:63871262-63871284 CCGTGTCCCTTCAGTCCTGATGG No data
Right 1150271749 17:63871295-63871317 GGTGGGTCCCACCTCAGCAGGGG No data
1150271737_1150271746 -7 Left 1150271737 17:63871262-63871284 CCGTGTCCCTTCAGTCCTGATGG No data
Right 1150271746 17:63871278-63871300 CTGATGGTGACAGGCTGGGTGGG No data
1150271737_1150271748 9 Left 1150271737 17:63871262-63871284 CCGTGTCCCTTCAGTCCTGATGG No data
Right 1150271748 17:63871294-63871316 GGGTGGGTCCCACCTCAGCAGGG No data
1150271737_1150271747 8 Left 1150271737 17:63871262-63871284 CCGTGTCCCTTCAGTCCTGATGG No data
Right 1150271747 17:63871293-63871315 TGGGTGGGTCCCACCTCAGCAGG No data
1150271737_1150271745 -8 Left 1150271737 17:63871262-63871284 CCGTGTCCCTTCAGTCCTGATGG No data
Right 1150271745 17:63871277-63871299 CCTGATGGTGACAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150271737 Original CRISPR CCATCAGGACTGAAGGGACA CGG (reversed) Intergenic
No off target data available for this crispr