ID: 1150274025

View in Genome Browser
Species Human (GRCh38)
Location 17:63884495-63884517
Sequence CTCCAATGTCAGCTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150274015_1150274025 -8 Left 1150274015 17:63884480-63884502 CCCCCACCATCCTTCCTCCAATG No data
Right 1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG No data
1150274016_1150274025 -9 Left 1150274016 17:63884481-63884503 CCCCACCATCCTTCCTCCAATGT No data
Right 1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG No data
1150274011_1150274025 19 Left 1150274011 17:63884453-63884475 CCCTGAGCTCCATGTAGCTTTCT No data
Right 1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG No data
1150274013_1150274025 10 Left 1150274013 17:63884462-63884484 CCATGTAGCTTTCTGCCTCCCCC No data
Right 1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG No data
1150274014_1150274025 -5 Left 1150274014 17:63884477-63884499 CCTCCCCCACCATCCTTCCTCCA No data
Right 1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG No data
1150274017_1150274025 -10 Left 1150274017 17:63884482-63884504 CCCACCATCCTTCCTCCAATGTC No data
Right 1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG No data
1150274012_1150274025 18 Left 1150274012 17:63884454-63884476 CCTGAGCTCCATGTAGCTTTCTG No data
Right 1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150274025 Original CRISPR CTCCAATGTCAGCTGGGACA GGG Intergenic
No off target data available for this crispr