ID: 1150274344

View in Genome Browser
Species Human (GRCh38)
Location 17:63886229-63886251
Sequence CTTCTGTGCTTGGGCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150274339_1150274344 7 Left 1150274339 17:63886199-63886221 CCTTGTACTCTCAGACTTTCCTA No data
Right 1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG No data
1150274338_1150274344 30 Left 1150274338 17:63886176-63886198 CCTGGTGGGCTGGGGTGGGTGAT No data
Right 1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150274344 Original CRISPR CTTCTGTGCTTGGGCAGGAC TGG Intergenic
No off target data available for this crispr