ID: 1150276122

View in Genome Browser
Species Human (GRCh38)
Location 17:63899023-63899045
Sequence CAGTAATGCTTCAGGAATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150276122_1150276125 7 Left 1150276122 17:63899023-63899045 CCGTCATTCCTGAAGCATTACTG No data
Right 1150276125 17:63899053-63899075 ACCCCAGACTCATCATCTGCTGG No data
1150276122_1150276130 11 Left 1150276122 17:63899023-63899045 CCGTCATTCCTGAAGCATTACTG No data
Right 1150276130 17:63899057-63899079 CAGACTCATCATCTGCTGGGAGG No data
1150276122_1150276127 8 Left 1150276122 17:63899023-63899045 CCGTCATTCCTGAAGCATTACTG No data
Right 1150276127 17:63899054-63899076 CCCCAGACTCATCATCTGCTGGG No data
1150276122_1150276131 12 Left 1150276122 17:63899023-63899045 CCGTCATTCCTGAAGCATTACTG No data
Right 1150276131 17:63899058-63899080 AGACTCATCATCTGCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150276122 Original CRISPR CAGTAATGCTTCAGGAATGA CGG (reversed) Intergenic
No off target data available for this crispr