ID: 1150276193

View in Genome Browser
Species Human (GRCh38)
Location 17:63899334-63899356
Sequence CAGGGTCTTTTAGCCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150276178_1150276193 23 Left 1150276178 17:63899288-63899310 CCACCATCCTTCCTCCAATGTCA No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276179_1150276193 20 Left 1150276179 17:63899291-63899313 CCATCCTTCCTCCAATGTCAGCT No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276174_1150276193 29 Left 1150276174 17:63899282-63899304 CCTCCCCCACCATCCTTCCTCCA No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276182_1150276193 16 Left 1150276182 17:63899295-63899317 CCTTCCTCCAATGTCAGCTGGGA No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276186_1150276193 9 Left 1150276186 17:63899302-63899324 CCAATGTCAGCTGGGACAGGGAG No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276176_1150276193 25 Left 1150276176 17:63899286-63899308 CCCCACCATCCTTCCTCCAATGT No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276177_1150276193 24 Left 1150276177 17:63899287-63899309 CCCACCATCCTTCCTCCAATGTC No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276183_1150276193 12 Left 1150276183 17:63899299-63899321 CCTCCAATGTCAGCTGGGACAGG No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data
1150276175_1150276193 26 Left 1150276175 17:63899285-63899307 CCCCCACCATCCTTCCTCCAATG No data
Right 1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150276193 Original CRISPR CAGGGTCTTTTAGCCAGTGC TGG Intergenic
No off target data available for this crispr