ID: 1150276487

View in Genome Browser
Species Human (GRCh38)
Location 17:63901057-63901079
Sequence CTTCTGTGCTTGGGCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150276482_1150276487 30 Left 1150276482 17:63901004-63901026 CCTGGTGGGCTGGGGTGGGTGAT No data
Right 1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150276487 Original CRISPR CTTCTGTGCTTGGGCAGGAC TGG Intergenic
No off target data available for this crispr