ID: 1150278338

View in Genome Browser
Species Human (GRCh38)
Location 17:63914029-63914051
Sequence CTCCAATGTCAGCTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 3, 1: 1, 2: 2, 3: 20, 4: 178}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150278326_1150278338 -1 Left 1150278326 17:63914007-63914029 CCTGCCTCCCCCACCATCCTTCC 0: 2
1: 0
2: 13
3: 187
4: 1697
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278327_1150278338 -5 Left 1150278327 17:63914011-63914033 CCTCCCCCACCATCCTTCCTCCA 0: 3
1: 0
2: 17
3: 162
4: 1569
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278322_1150278338 24 Left 1150278322 17:63913982-63914004 CCTGAGCTCCAAGTAGAAGAAGG 0: 1
1: 2
2: 2
3: 13
4: 175
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278321_1150278338 25 Left 1150278321 17:63913981-63914003 CCCTGAGCTCCAAGTAGAAGAAG 0: 1
1: 2
2: 2
3: 20
4: 240
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278328_1150278338 -8 Left 1150278328 17:63914014-63914036 CCCCCACCATCCTTCCTCCAATG 0: 3
1: 1
2: 4
3: 33
4: 422
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278330_1150278338 -10 Left 1150278330 17:63914016-63914038 CCCACCATCCTTCCTCCAATGTC 0: 3
1: 0
2: 0
3: 37
4: 444
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278324_1150278338 16 Left 1150278324 17:63913990-63914012 CCAAGTAGAAGAAGGTCCCTGCC 0: 1
1: 2
2: 0
3: 5
4: 129
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278325_1150278338 0 Left 1150278325 17:63914006-63914028 CCCTGCCTCCCCCACCATCCTTC 0: 2
1: 1
2: 8
3: 150
4: 1342
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178
1150278329_1150278338 -9 Left 1150278329 17:63914015-63914037 CCCCACCATCCTTCCTCCAATGT 0: 3
1: 1
2: 3
3: 25
4: 332
Right 1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG 0: 3
1: 1
2: 2
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150278338 Original CRISPR CTCCAATGTCAGCTGGGACA GGG Intronic
903188730 1:21644385-21644407 CTCCAATCTCAGCTTTGCCAAGG + Intronic
904236402 1:29120410-29120432 CTCCACTGCCATCTGGGACGGGG - Exonic
904276356 1:29387283-29387305 CTGCAAGTTTAGCTGGGACATGG + Intergenic
904289104 1:29472146-29472168 CTTCAATGTCAGCTGGAAGATGG - Intergenic
908140021 1:61174520-61174542 CTCCAATGCCAGATGAGACCAGG - Intronic
912195269 1:107390287-107390309 CTCCAACTTCAGCTGGACCAGGG + Intronic
912644901 1:111383322-111383344 CCCAGATGTGAGCTGGGACACGG + Intergenic
912694921 1:111834162-111834184 CTCCAAGGTGAGTTGGAACAGGG - Intronic
913049288 1:115102732-115102754 CTGCAAAGTCACCTGGGAAAGGG - Intergenic
913259702 1:116987073-116987095 CTCTAATCTCAGGTGGGACTTGG + Exonic
913349036 1:117837663-117837685 CTCCAATGTCAGCTGGCTTCTGG + Intergenic
913588913 1:120303641-120303663 CTCCAAAGTCGGCTGGGCCTAGG - Intergenic
913619272 1:120594728-120594750 CTCCAAAGTCGGCTGGGCCTAGG + Intergenic
914570938 1:148915524-148915546 CTCCAAAGTCGGCTGGGCCTAGG - Intronic
914601894 1:149214747-149214769 CTCCAAAGTCGGCTGGGCCTAGG + Intergenic
917246761 1:173011484-173011506 CTCACATTTCAGCTGAGACAAGG + Intergenic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
918716751 1:187798376-187798398 ATCCAATGGCTGCTGTGACATGG - Intergenic
919758750 1:201083311-201083333 CTCCAATGTCGGCTGAGGGAGGG + Exonic
920511392 1:206554919-206554941 ATTCACTGACAGCTGGGACAGGG + Intronic
920664456 1:207951368-207951390 CTACCATGTCACCTGGGGCAAGG - Intergenic
1069800086 10:71076561-71076583 CTGCAGTGACAGCTGAGACAGGG - Intergenic
1070190979 10:74111980-74112002 CTTCCATGTCAGGGGGGACAGGG - Exonic
1070826648 10:79394136-79394158 CTCCCATTTCAGATGAGACAAGG + Intronic
1072050035 10:91694198-91694220 CTCCAATGTCAGCAGGGAGCTGG + Intergenic
1074114277 10:110443915-110443937 CTCCAGTATCATCTGGGACCAGG - Intergenic
1074957961 10:118410979-118411001 CTCCGATGCCAGCTTGGACTCGG - Intergenic
1075904886 10:126072485-126072507 CTCTAATCTCAGCTGGCAGATGG - Intronic
1076034657 10:127188982-127189004 CTCCACTGTGAGCTGGGTCAGGG + Intronic
1076100219 10:127771411-127771433 CTCCAATTTCACCTGGGTCTGGG + Intergenic
1076178101 10:128384289-128384311 CTCCACTGTCAGCTGCGGCGGGG - Intergenic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080371275 11:31647274-31647296 GTCGTCTGTCAGCTGGGACAAGG - Intronic
1081569228 11:44279272-44279294 TCCCAATGTCCGCAGGGACAGGG - Intronic
1082683429 11:56208155-56208177 CTCCAATGTGAGATGGGATCAGG + Intergenic
1085170609 11:74446658-74446680 CTCACAAGTCAGCTGGGACAGGG + Intergenic
1085472891 11:76769376-76769398 CTCAAATCTCAGCCGGGCCAGGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089257386 11:117201014-117201036 CCCCCAAGTCAGCTGGGACCAGG - Intronic
1091611563 12:2014858-2014880 CTCCAAGGCCAGTGGGGACAAGG - Intronic
1093669002 12:21850075-21850097 CTCAAATGTCAACTGTGTCAAGG - Intronic
1094080521 12:26529611-26529633 TTCTAATGCCAGCTGGGTCATGG + Intronic
1095946007 12:47753758-47753780 CTCCAATGGGAGTTGGGGCAGGG - Intronic
1097081284 12:56433034-56433056 GATCAAGGTCAGCTGGGACATGG + Exonic
1097501448 12:60409376-60409398 CTGCAATCTCATCTGAGACAAGG + Intergenic
1101097218 12:101354947-101354969 CTCCAGAGTCAGCTGGATCAGGG - Exonic
1102386321 12:112513583-112513605 CTCACATGGCAGCTGAGACAAGG - Intergenic
1106881448 13:34136135-34136157 CTCATTTGTCAGCTGGGTCATGG + Intergenic
1110555342 13:76853259-76853281 CACCAAGGTCAGAGGGGACAAGG + Intergenic
1110589444 13:77238300-77238322 CTCCCATGTAAGCCAGGACATGG + Intronic
1111523487 13:89435247-89435269 CTCCAATGTCAGTTTTGGCAGGG + Intergenic
1111646431 13:91037660-91037682 CTCCAATGTCATCAGATACAGGG - Intergenic
1113813410 13:113155471-113155493 TTCTAATGTCAGCCTGGACAAGG - Intergenic
1118686380 14:68295536-68295558 CTCCTATCTTAGCTGGAACAAGG - Intronic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1120189910 14:81431249-81431271 CTCAAATCTCAACTGGAACAAGG + Intronic
1120970780 14:90205163-90205185 CTGAAATCTCAGCTCGGACAGGG + Intergenic
1125890897 15:43266584-43266606 CTCCATAGCCAGGTGGGACAGGG - Intronic
1126706520 15:51410951-51410973 CACAAATATCACCTGGGACAAGG + Intergenic
1126875911 15:53041116-53041138 CTCCAATCCCAGCTGATACAAGG + Intergenic
1128752870 15:70161483-70161505 CTCCCCAGTCACCTGGGACAGGG + Intergenic
1129306239 15:74665468-74665490 CACCATTTTCAGCTGTGACATGG + Intronic
1131662889 15:94537729-94537751 CTCCAAAGTCAACTGTGACCTGG - Intergenic
1134141967 16:11728039-11728061 CTCCAACGTCAACTGCGCCAAGG + Intronic
1134331878 16:13259019-13259041 GTCCAAAGTCATCTGAGACAAGG + Intergenic
1135329058 16:21546050-21546072 CTCCAAGATCAGCTGAGAAAAGG - Intergenic
1136339404 16:29632027-29632049 CTCCAAGATCAGCTGAGAAAAGG - Intergenic
1137025982 16:35475069-35475091 CTTCAATGGCAGAAGGGACAAGG - Intergenic
1138379653 16:56591036-56591058 CTCCAAGGTCAGCAGGGGAAGGG - Exonic
1139485682 16:67255483-67255505 CTCCAATGCCAGCTGGGAGCGGG - Intronic
1140630730 16:76848977-76848999 TGGCAATGTCAGCTGTGACATGG - Intergenic
1142042070 16:87900614-87900636 CTCCAAGATCAGCTGAGAAAAGG - Intronic
1143118518 17:4593661-4593683 CTCCACTGTCTGCTGAGGCAGGG + Intronic
1145102889 17:20091428-20091450 CTACAATGTCAGCAGTGCCACGG - Intronic
1146151541 17:30477404-30477426 GTCCAACGTCAGCCGGGATAGGG - Exonic
1146902201 17:36596012-36596034 CTCCAATGTCCCCTGGGGCCAGG + Intronic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1148042119 17:44716224-44716246 CTTCATTGTAAGCTGGGACCTGG + Intronic
1149030332 17:52075558-52075580 CTTGAATGTCTGTTGGGACATGG + Intronic
1149448526 17:56732341-56732363 CTCCAAGGTCCTATGGGACAGGG + Intergenic
1149591146 17:57830853-57830875 CTCCATTTTCAGATGGGAAAAGG - Intergenic
1150272689 17:63876752-63876774 TTCCAATGTCAGCTGGGACAGGG + Intronic
1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG + Intergenic
1150276185 17:63899300-63899322 CTCCAATGTCAGCTGGGACAGGG + Intergenic
1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG + Intronic
1150279437 17:63920661-63920683 CTCCAATCTCAACTGGGGCAGGG + Intergenic
1151715713 17:75830117-75830139 CTCCAAGGTCAGCTGGACAAAGG + Exonic
1151927592 17:77210362-77210384 CTCCCTTCTCAGCTAGGACAAGG + Intronic
1152553914 17:81043586-81043608 CTCCAGTGTGAGCAGTGACAGGG - Intronic
1152845251 17:82595805-82595827 CTCCAGTCTGAGCTGGCACATGG - Intronic
1152900199 17:82936812-82936834 CTTCAGTGGCAGCAGGGACAAGG - Intronic
1157669733 18:49518178-49518200 CTCCAAAGTCAGCTCTGCCACGG - Intergenic
1159894660 18:73984820-73984842 CTCCAATGTCATCTGGAACAGGG + Intergenic
1160363438 18:78304008-78304030 CTCCAGTGCCTGCTGGGCCATGG - Intergenic
1161288780 19:3481904-3481926 CTCCCGTGTCAGCTGGGGCGGGG - Intergenic
1161669187 19:5595284-5595306 CTCCAAGTACAGCTGGGAGAAGG + Intronic
1161784775 19:6317410-6317432 GTCCAAGGACAGATGGGACAGGG + Intronic
1162656020 19:12130277-12130299 CTTCTATGTCTGCTGGGACTGGG + Intronic
1165160275 19:33811934-33811956 CTCCCAGGTCAGCAGGGAGAGGG - Intronic
1166041445 19:40205199-40205221 CTCCAGTGGCATCTGGAACAGGG - Exonic
927990907 2:27446244-27446266 TGCCAAGGTGAGCTGGGACAAGG - Exonic
930008931 2:46919904-46919926 CTCCCCTGTCAGCTGGGATGGGG + Intronic
933847331 2:86336903-86336925 CGGCAAAGGCAGCTGGGACATGG - Intronic
934925417 2:98378915-98378937 TTCCAATATCAGCTGGCACAAGG + Intronic
937244207 2:120482128-120482150 CTCCAGTGTCTGGTGGAACAGGG - Intergenic
938682761 2:133708924-133708946 CTCAAAGGTCAGTTGGGACAAGG + Intergenic
939167515 2:138655326-138655348 CTCCGATGTCAACTGGGAAATGG - Intergenic
944604790 2:201343004-201343026 GACCACTGTCAGCTAGGACAAGG + Intronic
945664630 2:212725455-212725477 CTCGAATGTCAGAAGGGACAGGG + Intergenic
946177075 2:217928555-217928577 CTCCAAAGACAGTGGGGACAGGG + Intronic
948655899 2:239476530-239476552 GTCCAAGGTCAGCAGGGAGACGG + Intergenic
948926755 2:241103820-241103842 ATAAAATGACAGCTGGGACATGG + Intergenic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169864046 20:10181011-10181033 CAGCAATGTCAGCTGGGACATGG + Intergenic
1172838611 20:37888576-37888598 CTCCACTGACAGTAGGGACAAGG - Intergenic
1173392199 20:42645326-42645348 ATCCAATGTCGGCTGGGAATGGG + Intronic
1173970512 20:47148714-47148736 CTGAAATGTCACCTGGGTCATGG + Intronic
1174190400 20:48736397-48736419 CACCAATGTCAGCATGCACATGG + Intronic
1174637274 20:52012492-52012514 CTAAAATGTCAGCTCTGACAAGG - Intergenic
1177282894 21:19007428-19007450 GTGCAATGTCAGCTGAGATATGG + Intergenic
1178221933 21:30669798-30669820 TTCCAATCTCATCTGAGACAAGG - Intergenic
1179071012 21:38071095-38071117 CTCGAATGTCAACTGTGCCATGG - Intronic
949869009 3:8571056-8571078 CTCCCATGTCAGCAGGAAGAGGG + Intergenic
950316163 3:12004078-12004100 CCTCCATTTCAGCTGGGACACGG + Intergenic
953023945 3:39134207-39134229 CTCCAGCATCACCTGGGACAAGG - Exonic
953440678 3:42914189-42914211 TGCCATTTTCAGCTGGGACAGGG + Intronic
954682139 3:52351521-52351543 CCCCTATGTCAGCTGGGCAAAGG + Intronic
954711262 3:52506159-52506181 CTCAACGGTCAGCTGGGGCAAGG - Exonic
954905234 3:54056626-54056648 CTCCACTGTTGGTTGGGACAGGG + Intergenic
954991641 3:54845858-54845880 CTCCTGTGTAGGCTGGGACAGGG + Intronic
955231065 3:57099008-57099030 CTCCAAAGTGAGCTGGGAGATGG + Intronic
956880067 3:73501293-73501315 TTCCACTGTCAACTGGGACACGG + Intronic
957190158 3:76997849-76997871 TTGCCATGTCAGCTGGGAAATGG + Intronic
960721769 3:120631630-120631652 CTTCAAAGTCAGCTGGGATGGGG - Intronic
962419213 3:135213626-135213648 CACCAATGTCAGCTGATAAAAGG - Intronic
964010203 3:151884295-151884317 GTGCAATGGCAGCTGGCACATGG - Exonic
965147849 3:164928707-164928729 CTCCAGTGTCTCCTGGGAAAGGG - Intergenic
966828072 3:183982195-183982217 CTCCTATGTCAAGTGGGACAGGG + Intronic
967271416 3:187736619-187736641 GTCCACTGTCAGCTGGGCCTTGG + Intronic
968286135 3:197509976-197509998 CTCCTGGGGCAGCTGGGACAGGG + Exonic
969106640 4:4811480-4811502 ATCCAATGGCAGCTAGGACCAGG - Intergenic
972629440 4:40830447-40830469 CTCCAAGGTAAGGTGGGTCAGGG - Exonic
975437553 4:74370934-74370956 CCCTAATGTCAACTGAGACAAGG - Intronic
975547197 4:75571800-75571822 CTCTCACTTCAGCTGGGACAGGG + Intergenic
975752411 4:77537681-77537703 CTCAAATGGATGCTGGGACATGG - Intronic
976045854 4:80946298-80946320 CTCCACAGTCATCTGGGCCAGGG + Intronic
976647938 4:87404892-87404914 CTCCAATGCCTGTTTGGACAAGG + Intergenic
980911106 4:138995340-138995362 CTCCTATGACAGCTGTGACCTGG + Intergenic
980982523 4:139666717-139666739 CTACAATGTCAGCTGGGGAAAGG + Intronic
985275940 4:188237890-188237912 CTGGAATGACAGCTGGGATAAGG - Intergenic
985421076 4:189785730-189785752 CACCTCTGTCAGCTGAGACATGG + Intergenic
987724050 5:21674672-21674694 CTCCTACCTCAGCTGGGACTAGG + Intergenic
989444181 5:41509390-41509412 CAACAATGACAGCTGGGACACGG - Intronic
990312396 5:54552568-54552590 CTCCAATGTGTGCTGGCACTGGG - Intergenic
996774452 5:127118977-127118999 CATAAATGTGAGCTGGGACAGGG - Intergenic
997690417 5:135824316-135824338 CTCCAATGTAGGCAGGGACTGGG + Intergenic
999422867 5:151459850-151459872 CTGCACTGTCTGCTGGTACAGGG + Intronic
1001530645 5:172459139-172459161 CCAGAATGACAGCTGGGACAAGG - Intergenic
1002269181 5:178058525-178058547 CTCCAATGTCAAGTGGCCCAGGG + Intergenic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1003157816 6:3611111-3611133 CTCGAATGTCAGCTGCGGGACGG - Intergenic
1003360426 6:5420391-5420413 CTCAAATCTCATCTGAGACAGGG + Intronic
1005380477 6:25229270-25229292 CTCCAATGGGAGAAGGGACAAGG - Intergenic
1008073966 6:47126755-47126777 CCCCACTCTCAGGTGGGACAGGG + Intergenic
1010061334 6:71626076-71626098 CTAAAATGTCATCTGAGACAAGG - Intergenic
1011507446 6:88061952-88061974 CTGCAATGTTAGCTGAGAGAGGG - Intronic
1013615189 6:111836301-111836323 CTCGAATCTCAGCTGAGATATGG + Intronic
1015241121 6:131024749-131024771 CTCTAAGGTTAGTTGGGACAGGG - Intronic
1017693903 6:156994933-156994955 CTCCCCTGTCAGCTGGGGCTGGG + Intronic
1024136392 7:46413128-46413150 CCCCATAGTCAGCTGGGAGAAGG - Intergenic
1025964490 7:66255348-66255370 CCCAAATGTCAGCTGTGCCAAGG + Intronic
1026863044 7:73806029-73806051 ATCCAATATCACCTGGGGCATGG - Intronic
1027571852 7:79878616-79878638 CTTCAATATCAGCTTGGACTTGG - Intergenic
1028189261 7:87825989-87826011 GTCCAATGTCATCTGAGACAAGG - Intronic
1031185635 7:118476375-118476397 CTCTAATTTGAGCTGTGACAGGG + Intergenic
1033432607 7:141302900-141302922 CTCAAATGCCAGCTTGGAAAAGG + Intronic
1033737191 7:144234177-144234199 CTCCAATGACAGCTGGACCAGGG - Intergenic
1033745866 7:144316769-144316791 CTCCAATGACAGCTGGACCAGGG + Intergenic
1037823376 8:22146676-22146698 CCCCAAGGTCAGCTGGGGCTGGG - Intergenic
1040907315 8:52481606-52481628 GCCCAATGTGAGCTGGGAGACGG - Intergenic
1041897960 8:62947873-62947895 ATGCAATGTTAGCTGGGGCACGG - Intronic
1043170714 8:76962454-76962476 CTGCAATGGAAGCTGGGTCAAGG - Intergenic
1043779345 8:84312438-84312460 CCACAATTTCATCTGGGACAAGG + Intronic
1044596021 8:93959387-93959409 CTCCACGGTCACCAGGGACATGG + Intergenic
1047881938 8:129204326-129204348 CTACAATGTTACCTGGCACATGG - Intergenic
1047916404 8:129588493-129588515 TTCAAATTTCAGCTGGGGCATGG + Intergenic
1050445814 9:5721597-5721619 CACCAGTTTCATCTGGGACAAGG + Intronic
1050498510 9:6269053-6269075 CTCCAATGTCACATGCGACCTGG - Intergenic
1051253222 9:15183760-15183782 CTCTCATGTGAGCTGGGAGAGGG + Intronic
1051958925 9:22734627-22734649 CTCCACTGTCAGGTGGGAAGAGG + Intergenic
1052901733 9:33799281-33799303 CTCCAATCTCAGGTCAGACAGGG + Intergenic
1054999407 9:71431667-71431689 AACCAAGGTCAGCTGGGAAAAGG - Intronic
1056913859 9:90728330-90728352 CTGCAGTCTCAGCTGGGACCTGG - Intergenic
1057210106 9:93196402-93196424 CAGCAACATCAGCTGGGACATGG + Intronic
1061557757 9:131382392-131382414 CTCCAGTGTCTGATGGGAAATGG + Intergenic
1061945737 9:133907441-133907463 CACCAAGGTCAGCTGGGGCGTGG - Intronic
1062512675 9:136915952-136915974 CTGCCATGTCACCTGGGAAATGG + Intronic
1185543646 X:924167-924189 CCCAAATGTCAGCTGTGCCAGGG - Intergenic
1185625702 X:1480508-1480530 CTCCTGTGTAAGCTGGGACATGG + Intronic
1187679999 X:21758269-21758291 CTCAAATGTCAGCCGGGAGGTGG + Intergenic
1191895172 X:65985079-65985101 CCCCCATGTCATCTGGAACAGGG - Intergenic
1192935216 X:75851443-75851465 CTCCAATGACTCCTGGGAAAAGG - Intergenic
1196663938 X:118296880-118296902 CTCCAATGTTTCCTTGGACAGGG + Intergenic
1198506236 X:137303880-137303902 CTCCAATGACTGCTGGCAGAAGG - Intergenic