ID: 1150280584

View in Genome Browser
Species Human (GRCh38)
Location 17:63927824-63927846
Sequence TCTCACTAGTTCCCCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150280582_1150280584 8 Left 1150280582 17:63927793-63927815 CCAGAGGGAATCTGGTGAAAATT No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data
1150280579_1150280584 20 Left 1150280579 17:63927781-63927803 CCACCTGGAATTCCAGAGGGAAT No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data
1150280580_1150280584 17 Left 1150280580 17:63927784-63927806 CCTGGAATTCCAGAGGGAATCTG No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data
1150280578_1150280584 21 Left 1150280578 17:63927780-63927802 CCCACCTGGAATTCCAGAGGGAA No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data
1150280572_1150280584 30 Left 1150280572 17:63927771-63927793 CCCACCTGCCCCACCTGGAATTC No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data
1150280574_1150280584 26 Left 1150280574 17:63927775-63927797 CCTGCCCCACCTGGAATTCCAGA No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data
1150280573_1150280584 29 Left 1150280573 17:63927772-63927794 CCACCTGCCCCACCTGGAATTCC No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data
1150280577_1150280584 22 Left 1150280577 17:63927779-63927801 CCCCACCTGGAATTCCAGAGGGA No data
Right 1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150280584 Original CRISPR TCTCACTAGTTCCCCTGTGC TGG Intergenic
No off target data available for this crispr