ID: 1150281854

View in Genome Browser
Species Human (GRCh38)
Location 17:63933533-63933555
Sequence CCTTCCAACCATGGCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150281854_1150281864 11 Left 1150281854 17:63933533-63933555 CCTCCCATGCCATGGTTGGAAGG No data
Right 1150281864 17:63933567-63933589 GGTGGTCCCTCTTTAGATCTTGG No data
1150281854_1150281863 -7 Left 1150281854 17:63933533-63933555 CCTCCCATGCCATGGTTGGAAGG No data
Right 1150281863 17:63933549-63933571 TGGAAGGCAGAGGGTCTGGGTGG No data
1150281854_1150281862 -10 Left 1150281854 17:63933533-63933555 CCTCCCATGCCATGGTTGGAAGG No data
Right 1150281862 17:63933546-63933568 GGTTGGAAGGCAGAGGGTCTGGG No data
1150281854_1150281866 17 Left 1150281854 17:63933533-63933555 CCTCCCATGCCATGGTTGGAAGG No data
Right 1150281866 17:63933573-63933595 CCCTCTTTAGATCTTGGCCTAGG No data
1150281854_1150281868 23 Left 1150281854 17:63933533-63933555 CCTCCCATGCCATGGTTGGAAGG No data
Right 1150281868 17:63933579-63933601 TTAGATCTTGGCCTAGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150281854 Original CRISPR CCTTCCAACCATGGCATGGG AGG (reversed) Intergenic
No off target data available for this crispr