ID: 1150281878

View in Genome Browser
Species Human (GRCh38)
Location 17:63933609-63933631
Sequence AAGGTGGGGGCCACTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150281867_1150281878 12 Left 1150281867 17:63933574-63933596 CCTCTTTAGATCTTGGCCTAGGC No data
Right 1150281878 17:63933609-63933631 AAGGTGGGGGCCACTCTCAAGGG No data
1150281865_1150281878 13 Left 1150281865 17:63933573-63933595 CCCTCTTTAGATCTTGGCCTAGG No data
Right 1150281878 17:63933609-63933631 AAGGTGGGGGCCACTCTCAAGGG No data
1150281869_1150281878 -4 Left 1150281869 17:63933590-63933612 CCTAGGCCTCGGACCTGATAAGG No data
Right 1150281878 17:63933609-63933631 AAGGTGGGGGCCACTCTCAAGGG No data
1150281874_1150281878 -10 Left 1150281874 17:63933596-63933618 CCTCGGACCTGATAAGGTGGGGG No data
Right 1150281878 17:63933609-63933631 AAGGTGGGGGCCACTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150281878 Original CRISPR AAGGTGGGGGCCACTCTCAA GGG Intergenic
No off target data available for this crispr