ID: 1150283188

View in Genome Browser
Species Human (GRCh38)
Location 17:63941101-63941123
Sequence CTCGTGCTTCCTCTTGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150283183_1150283188 4 Left 1150283183 17:63941074-63941096 CCTCTGGATCTTGATGGCGCACA 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1150283180_1150283188 16 Left 1150283180 17:63941062-63941084 CCGGCGGTAGGCCCTCTGGATCT 0: 1
1: 0
2: 0
3: 8
4: 42
Right 1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1150283182_1150283188 5 Left 1150283182 17:63941073-63941095 CCCTCTGGATCTTGATGGCGCAC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150283188 Original CRISPR CTCGTGCTTCCTCTTGAGGG TGG Exonic
905276073 1:36819096-36819118 CTCTTACATCCTCTGGAGGGAGG - Intronic
905342467 1:37288632-37288654 ATCCTGCTGCCTCTTGAGGAGGG - Intergenic
907158030 1:52352360-52352382 CTGTGGCTTCCTCTTGAGAGAGG - Exonic
912389216 1:109290319-109290341 GTCCTGCTTCCACTGGAGGGAGG + Intergenic
913972153 1:143423641-143423663 CCAGTGCTTCCTCCTGAGTGAGG - Intergenic
914066534 1:144249254-144249276 CCAGTGCTTCCTCCTGAGTGAGG - Intergenic
914112619 1:144717100-144717122 CCAGTGCTTCCTCCTGAGTGAGG + Intergenic
915082327 1:153360759-153360781 CTCGTGCATCTTCTCGTGGGAGG - Exonic
916167043 1:161973654-161973676 CTCGTTCTTCCTCTAGTGGAAGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
917966927 1:180184749-180184771 CTCGTGCATCCCCTTGTGAGGGG - Intronic
920494544 1:206445376-206445398 CTCGGGCTTCCTCTGGATGCAGG - Intronic
922799937 1:228360539-228360561 CACCTCCTTCCTCTTGCGGGAGG + Intronic
923880151 1:238095058-238095080 CTTGTCATTCCCCTTGAGGGTGG + Intergenic
1064176386 10:13079252-13079274 CGCGTGCCTCCTCATGAGAGAGG - Intronic
1068632480 10:59311948-59311970 CTTGAGGTTCCTCTTGAAGGTGG - Intronic
1070699197 10:78587102-78587124 ATACTGCTTCTTCTTGAGGGTGG - Intergenic
1071205423 10:83270479-83270501 CTCCTGCTTCCAGTTTAGGGAGG - Intergenic
1075795177 10:125115095-125115117 CTGCTGCCTCCTCTTGAGGCTGG + Intronic
1077043331 11:534076-534098 CTCCTGCTTCCTCTAGAGGAGGG - Intronic
1077068784 11:657738-657760 CTTGTGCTTTCTCGTGGGGGTGG - Intronic
1077307708 11:1875392-1875414 CCAGTGCTTCCTCCTGAGTGAGG + Intronic
1083136247 11:60679272-60679294 CTCCTGCTTCCTTTTGAAGAAGG - Intergenic
1084383047 11:68825721-68825743 CAGGTGCTTCCTCTTCAGGCAGG + Intronic
1091016968 11:132059931-132059953 CTCCTGCAGCCTTTTGAGGGAGG + Intronic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1094568223 12:31618961-31618983 CTCCTGCTTTCTCTTGAGACAGG - Intergenic
1094616398 12:32040112-32040134 GGCGGGCTTCCTCCTGAGGGAGG + Intergenic
1100464684 12:94834616-94834638 CTCATGCTTCTTCTTCAGGTAGG - Intergenic
1102473613 12:113174747-113174769 CTCCTTCTTCCTCGTGCGGGAGG - Exonic
1118736008 14:68702460-68702482 GTCCTGCTTGCTCTTGAGGTTGG + Intronic
1119101997 14:71888481-71888503 CTCCTGCTTCCTATTGATTGAGG + Intergenic
1121726606 14:96156898-96156920 CTTGTCCTTCCACTTGAGGAGGG - Intergenic
1122378892 14:101287513-101287535 CTCTTCCTTCATCTTCAGGGTGG - Intergenic
1122616412 14:103020957-103020979 CTCGTGATTCCTGATGAGAGGGG - Intronic
1124303704 15:28564032-28564054 CCCGTGCTTCCTCCTGGGAGAGG + Intergenic
1127574881 15:60281700-60281722 CAGGTGCATCCTCTTAAGGGTGG - Intergenic
1135942226 16:26832047-26832069 CTCTTGCTTCCAATAGAGGGAGG + Intergenic
1135959161 16:26981424-26981446 CTCGTGCCTCCTGCTGAGGTGGG + Intergenic
1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG + Intronic
1143330147 17:6128459-6128481 CTGGTGCTTCCTACTGAGAGTGG - Intergenic
1144625749 17:16843667-16843689 CTCGTGGTTCTTCTTCAGGTAGG + Intergenic
1144725595 17:17500456-17500478 CTCCTGCTTCTTCTTGAAGTTGG + Intergenic
1144880684 17:18429053-18429075 CTCGTGGTTCTTCTTCAGGTAGG - Intergenic
1145151553 17:20515334-20515356 CTCGTGGTTCTTCTTCAGGTAGG + Intergenic
1146162903 17:30569592-30569614 CTCGTGGTTCTTCTTCAGGTAGG + Intergenic
1147573235 17:41584260-41584282 CTCGTGGTTCTTCTTCAGGTAGG + Exonic
1147579904 17:41622358-41622380 CTCGTGGTTCTTCTTCAGGTAGG + Exonic
1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG + Exonic
1151747102 17:76017668-76017690 CTGGTGCTCACACTTGAGGGAGG - Intronic
1152303141 17:79507007-79507029 CTCCAGCTGCCTCCTGAGGGTGG - Intronic
1152673657 17:81625001-81625023 CTCTAGCTTCCTCTTCAGTGTGG - Intronic
1155097380 18:22570954-22570976 CTCCTGTCTCCTGTTGAGGGTGG + Intergenic
1155492525 18:26414356-26414378 TCCTTGCTTCCCCTTGAGGGAGG + Intergenic
1157012328 18:43665806-43665828 CTCTTGCCTCGTCTTGACGGAGG - Intergenic
1163207604 19:15815016-15815038 CTCCTGCTGCCTCATGAGGTAGG - Intergenic
1164916295 19:32054877-32054899 CTGCTGCATCCTCTGGAGGGAGG + Intergenic
1166994348 19:46712783-46712805 CCCTTGGTCCCTCTTGAGGGTGG - Intronic
927153309 2:20207985-20208007 CTTGAGCTTTCTCTTGGGGGAGG - Intronic
934287157 2:91658938-91658960 CCAGTGCTTCCTCCTGAGTGAGG - Intergenic
938014250 2:127854416-127854438 CTGTTGCTTCCTCTTCAGTGTGG - Intronic
946310801 2:218881413-218881435 CTTGTGCTTACTCCTGAGGTGGG - Intronic
948464494 2:238145723-238145745 CTGGTGCTTCCCCCTGAAGGAGG + Exonic
948482389 2:238258352-238258374 CTCGCATTTCCTCTTCAGGGTGG + Exonic
1169923280 20:10757530-10757552 CTCATGTATGCTCTTGAGGGGGG - Intergenic
1170535106 20:17333444-17333466 CTCTTGTTTCCTTTGGAGGGAGG - Intronic
1170666618 20:18392391-18392413 CTCCTGATTCCTCTGGAGGCAGG - Intronic
1172760610 20:37318612-37318634 CTGGTTCCTCCTCTTGAGAGGGG + Intergenic
1173250200 20:41360380-41360402 CTCTTCCTTCCACTTGGGGGTGG - Exonic
1173878720 20:46394297-46394319 CTCGTTCTTACTCTTGATGCCGG + Intronic
1176104953 20:63381588-63381610 CTCCTGCCTCCTCTTGAGTCAGG + Intergenic
1178083718 21:29092315-29092337 CTCTTGCCTCCTCTTTAGAGAGG - Intronic
1180169298 21:46049656-46049678 CTAATGCTTCCTCCTGGGGGAGG + Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG + Intronic
949690342 3:6629531-6629553 CACGTGCTTCTTCTTTAAGGGGG + Intergenic
965783054 3:172308279-172308301 CTAGTGATGCCTCTTGAGGAAGG - Intronic
966855322 3:184189675-184189697 CTCCTGCTTACTCTTGATGAAGG - Exonic
971420699 4:26471664-26471686 CTATTTCTTCCTCTTGAGGATGG + Intergenic
971440989 4:26685262-26685284 CTGGGGCTTCCTCTTGAGAGAGG - Intronic
971992647 4:33919941-33919963 CTCATGCTTTTTCTTGAGAGGGG + Intergenic
975926155 4:79456207-79456229 CACGTGTTTCCTCATGATGGTGG - Intergenic
977402488 4:96550264-96550286 CTAGTGCTTCCTTTTTAGGAAGG - Intergenic
978407388 4:108394807-108394829 CTCCTGCTTCCAGCTGAGGGTGG + Intergenic
981290626 4:143071126-143071148 CTCTTGCTGCCTCTTGGTGGAGG + Intergenic
989776587 5:45215895-45215917 CTGGTGCTTTCTCTTTAGGAAGG - Intergenic
990122554 5:52472896-52472918 CTCTTACTCCCTCTTGATGGTGG - Intergenic
990836070 5:60021756-60021778 CTCCTGCTTTCTCCTGAGAGAGG - Intronic
993008078 5:82449668-82449690 CTCATGTTTCCTCTTGAGTTTGG + Intergenic
993441286 5:87959933-87959955 CCTGTGCTTCCTCTTAGGGGGGG + Intergenic
997103740 5:130995372-130995394 CTTCGGCTTCCTCTTGACGGTGG - Intergenic
999155140 5:149452461-149452483 CTCCTTCTTCCTCCTGAGTGCGG + Intergenic
1000298016 5:159928933-159928955 CTACTGCTTCCTCTTGATGCCGG - Intronic
1000832543 5:166121067-166121089 CTCATGCTTTCTCTTGAGCATGG + Intergenic
1003309593 6:4957821-4957843 CTCTCCCTTCCTCTAGAGGGCGG - Intergenic
1004247548 6:13994534-13994556 CTAGTGCTTTCTCTTTTGGGAGG + Intergenic
1004606343 6:17198559-17198581 CTCCTGCTTCCTACTGAGGCAGG - Intergenic
1015460654 6:133487469-133487491 GTCTTCCTTCCACTTGAGGGAGG + Intronic
1019109437 6:169698116-169698138 CTGGTGCTTCCTCGTCAAGGTGG - Intronic
1023243917 7:38179795-38179817 CTCGTGTTACCTCCTTAGGGAGG - Intronic
1030123346 7:106132071-106132093 CTTGTGGTTCTTCTTGAGGAGGG - Intergenic
1036246044 8:7117569-7117591 CTCATGCTTCATCTGCAGGGAGG - Intergenic
1036888226 8:12576459-12576481 CTCATGCTTCATCTGCAGGGAGG + Intergenic
1039671099 8:39599484-39599506 CTGGTGCTTCCTGTTGTGGAAGG + Intronic
1047953628 8:129956482-129956504 ATCTTGCTGCCTCTTGAGGCTGG - Intronic
1048871437 8:138802721-138802743 CTAGGGCTTCATCTTGAGGGTGG + Intronic
1049790953 8:144472515-144472537 CCCGTGCTTCCACTTGGGGGCGG + Intronic
1056998225 9:91483734-91483756 CTCATTCTTGCTCTTGCGGGGGG - Intergenic
1057444452 9:95103996-95104018 CTCGTGCTAGGTCCTGAGGGTGG + Intronic
1057715476 9:97491831-97491853 CTCATGCTTCCAGTTGGGGGAGG - Intronic
1061755196 9:132807493-132807515 CTTGGACTTCCTCTGGAGGGTGG - Intronic
1203782849 EBV:110501-110523 CAAGTGCTACATCTTGAGGGGGG - Intergenic
1186353251 X:8761913-8761935 GTCGTGTTTCCTTTTTAGGGTGG - Intergenic
1186794473 X:13031077-13031099 GTCGTGTTTCCTTTTTAGGGTGG - Intergenic
1200152063 X:153956132-153956154 CACGTGCTTCCACTTGTGTGGGG + Intronic