ID: 1150283202

View in Genome Browser
Species Human (GRCh38)
Location 17:63941172-63941194
Sequence TCTCCTCCATGGTCTGCTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150283199_1150283202 4 Left 1150283199 17:63941145-63941167 CCTTGGAGGGGTTGGCTGCCATG 0: 1
1: 0
2: 2
3: 23
4: 305
Right 1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150283202 Original CRISPR TCTCCTCCATGGTCTGCTTG AGG Exonic
900521877 1:3109906-3109928 GCTCCTCCATGTCCTGCGTGTGG + Intronic
900651705 1:3733031-3733053 CCTCCTTGATGGGCTGCTTGCGG - Exonic
900711497 1:4117450-4117472 TCTCAGCCATGGTGTGCGTGAGG + Intergenic
900833948 1:4985554-4985576 TCCCTTCCATGGTCTTCCTGTGG + Intergenic
901416396 1:9119725-9119747 TCTCCTCCATGAGCTGGTGGAGG - Intronic
901928259 1:12580615-12580637 TCTCCTCCGTCGTCTCCTTCAGG + Exonic
902751699 1:18518033-18518055 TCTCCTGAATGATCTGCCTGGGG + Intergenic
902882176 1:19379436-19379458 TCTCCTCCCTGATTTGCTGGAGG + Intronic
903763370 1:25715336-25715358 CCTAGTCCATGTTCTGCTTGAGG - Intronic
903970002 1:27112537-27112559 TTTCCTCCAGGGTCTGCACGTGG - Intronic
905937155 1:41833814-41833836 TTTCCACCATGGTCAGCTTGTGG - Intronic
906380904 1:45331736-45331758 TCTCCTCCCTGGGGGGCTTGCGG + Exonic
906680690 1:47723760-47723782 TCTCCCCCACGGCCTTCTTGTGG - Intergenic
907246973 1:53114807-53114829 TCTGCTCCGTGGTCTCCTTCTGG + Exonic
907403280 1:54238753-54238775 TCTCCTCCTGGGTCTGTTTCTGG - Intronic
908386617 1:63648584-63648606 TGTCCTCCACACTCTGCTTGCGG - Exonic
911010797 1:93278979-93279001 TCTTCTCCATTGTCTCCTTTTGG + Intergenic
912788655 1:112629165-112629187 TCTCCTACATGTTCTTCTTCTGG + Intronic
913179899 1:116311280-116311302 TCTCCTCCATGCTCTGCATTCGG - Intergenic
913564363 1:120057464-120057486 TCTCCTCTGGGCTCTGCTTGGGG - Intronic
913633765 1:120736100-120736122 TCTCCTCTGGGCTCTGCTTGGGG + Intergenic
914284950 1:146216813-146216835 TCTCCTCTGGGCTCTGCTTGGGG - Intronic
914545981 1:148667552-148667574 TCTCCTCTGGGCTCTGCTTGGGG - Intronic
914620583 1:149403114-149403136 TCTCCTCTGGGCTCTGCTTGGGG + Intergenic
915834623 1:159166062-159166084 TCTCCTCCATGTGCTCTTTGAGG - Intergenic
918119344 1:181524180-181524202 TCTCTTTCATAGTCTGGTTGAGG - Intronic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
918765592 1:188479051-188479073 TCTGCTGAAAGGTCTGCTTGTGG + Intergenic
919853487 1:201689867-201689889 TTTCCTCCATGGCCTGTCTGTGG + Intronic
919853515 1:201690048-201690070 TTTCCTCCATGGCCTGTCTGTGG + Intronic
919853560 1:201690374-201690396 TTTCCTCCATGGCCTGTCTGTGG + Intronic
919853588 1:201690557-201690579 TTTCCTCCATGGCCTGTCTGTGG + Intronic
919872742 1:201835286-201835308 TATCCTCCATGCTCTCCTTTGGG + Intronic
919879513 1:201892447-201892469 AGTCCGCCTTGGTCTGCTTGTGG - Intergenic
921064974 1:211616348-211616370 TCTCCTCCATCCTCTGCTCAGGG - Intergenic
1063872270 10:10431005-10431027 TCTTCTCCCACGTCTGCTTGTGG + Intergenic
1064323595 10:14328807-14328829 TATCCTCCATCGTCTACCTGTGG - Intronic
1067404884 10:46012888-46012910 TGTTCTCCAAGGTCTGCTTTTGG + Exonic
1073428242 10:103469398-103469420 TCTCCTCCCTGGCCTGCCTCTGG + Intergenic
1073929123 10:108554416-108554438 TTTCCTCCATGCTCTTCTTGTGG + Intergenic
1074011120 10:109481087-109481109 TCTTCTCCATTGTTTGCTTGAGG - Intergenic
1074164424 10:110862436-110862458 TCTTCCCCATGATCTGCCTGTGG + Intergenic
1076038763 10:127225350-127225372 TCTCCTCCGTGCTTTGCTTCAGG - Intronic
1076180556 10:128404043-128404065 TCTTTCCCATGGTCTTCTTGGGG - Intergenic
1077211729 11:1374222-1374244 TCCCCTCCATGGACTTCTGGGGG - Intergenic
1077318324 11:1928978-1929000 TCTTCTCCAGGGTGTGCCTGCGG - Intronic
1077490581 11:2859154-2859176 TCTCCTCCACGAGGTGCTTGGGG - Intergenic
1077863692 11:6205547-6205569 TCACCTCCCTGGGCTGCCTGGGG + Exonic
1078609964 11:12811528-12811550 TCTTCTCCAAGGTCTGTGTGAGG + Intronic
1079121696 11:17689811-17689833 TCTCCTCCTTGCTCTGCTCCAGG + Intergenic
1079875300 11:25848767-25848789 TCTCCTCAGTGTTCTGCATGGGG - Intergenic
1083486700 11:62987590-62987612 CCTCCTCCTTGTTCTGCTGGAGG + Intergenic
1084120378 11:67065753-67065775 CCTCCTCCTTGGCCTGCCTGGGG - Intronic
1084784096 11:71431583-71431605 CCTCCTCCTTGGCCTGCTTAGGG + Intronic
1089286125 11:117409285-117409307 TCTCTTCCAGGGCCTCCTTGAGG + Intronic
1090586812 11:128222014-128222036 TCTCCTGTATTGTCTCCTTGAGG + Intergenic
1092821275 12:12355865-12355887 ACTCCTCCATGGTCAGCAGGTGG - Intergenic
1093974768 12:25409308-25409330 TCTTCTCCATTGTCTCCTTTTGG + Intronic
1095531024 12:43186576-43186598 TATCCTCCAGGGTCTACTTTAGG - Intergenic
1096775685 12:53962094-53962116 TCTTTTCCATGCTCTGCATGTGG - Intergenic
1097762342 12:63482214-63482236 TCTCCTCCCTGCTCTGTGTGTGG - Intergenic
1102407428 12:112685921-112685943 ACTCCTCCATGCTCTGCATTTGG - Intronic
1104683354 12:130767427-130767449 ACCACTCCATGGTCAGCTTGGGG + Intergenic
1105529099 13:21202057-21202079 TTTCCCCCATGCTCTTCTTGTGG - Intergenic
1106083800 13:26522610-26522632 TATCCTCCATGGCTTTCTTGTGG - Intergenic
1108497074 13:51035648-51035670 TCTGCCCCATGGTCTGGCTGTGG - Intergenic
1109317385 13:60766305-60766327 CCTCCGCCATGGTCTGACTGGGG + Intergenic
1109319958 13:60798548-60798570 CCTCTGCCATGGTCTGCCTGGGG - Intergenic
1114671824 14:24415568-24415590 CCTCCTCCAGGGCCTGCTGGGGG + Exonic
1115142820 14:30193408-30193430 TTTCCTCCATTGTCAGGTTGGGG - Intergenic
1117284605 14:54274953-54274975 TCTACTACATGGCCAGCTTGGGG - Intergenic
1117564550 14:56979540-56979562 TCTCCTCCATGGTCTGCAAGCGG - Intergenic
1117571651 14:57055089-57055111 TCGCCTCCATGGGCTACTTCTGG + Intergenic
1117814399 14:59582194-59582216 CCTCCTCGATGGTCTGCAAGAGG + Intergenic
1118234832 14:63992821-63992843 TCTCCTCCAAGGCCTCCTTGAGG - Intronic
1118449054 14:65880714-65880736 TATTCTCCAAGGTCTGCTTTTGG + Intergenic
1118845408 14:69544260-69544282 TCTCCTAAGTGGTCTCCTTGTGG + Intergenic
1119148516 14:72337410-72337432 TCTTCTCCTTCCTCTGCTTGTGG - Intronic
1120130955 14:80807435-80807457 TCTCCTCGATGTTCTATTTGAGG - Intronic
1120516593 14:85478134-85478156 TCTCCTCCATGTTCTCCCAGTGG - Intergenic
1120647091 14:87087064-87087086 TCTTGTCCATAGACTGCTTGAGG + Intergenic
1121296770 14:92833199-92833221 TCTCCAGCATGGTCTGTTTCTGG - Exonic
1121530602 14:94650003-94650025 TCTCTGCCATGGGCTCCTTGAGG - Intergenic
1122039375 14:98972938-98972960 TCTCCTCCATGGTCTGGAAGCGG + Intergenic
1128745928 15:70114065-70114087 TCCTCTCCATGATCTGTTTGTGG - Intergenic
1129269250 15:74410869-74410891 TCTGCTCCACGTTCTCCTTGTGG + Exonic
1129908262 15:79205173-79205195 TCTCCTCCCTGGTCTCCATCCGG - Intergenic
1130261233 15:82355594-82355616 TCTCCCGCATTGTCTGCTTGGGG + Intergenic
1130280002 15:82513424-82513446 TCTCCCGCATTGTCTGCTTGGGG - Intergenic
1130471377 15:84229610-84229632 TCTCCCGCATTGTCTGCTTGGGG - Intergenic
1130478871 15:84344181-84344203 TCTCCCGCATTGTCTGCTTGGGG - Intergenic
1130492899 15:84443950-84443972 TCTCCCGCATTGTCTGCTTGGGG + Intergenic
1130593671 15:85234237-85234259 TCTCCCGCATTGTCTGCTTGGGG - Intergenic
1130613386 15:85381013-85381035 TCTCCCGCATTGTCTGCTTGGGG + Intronic
1130832028 15:87610613-87610635 TTTCCTGCATGGGCTGCTTCTGG + Intergenic
1132639628 16:971649-971671 CCTCCTTCATGTTCTGTTTGGGG - Intronic
1137395150 16:48111826-48111848 TCTCCTCCATTAACTCCTTGTGG + Exonic
1138269897 16:55688060-55688082 TCCTCTCCATGGACTGCCTGTGG - Intronic
1138595159 16:58025867-58025889 CCTCCTCCCGGGACTGCTTGGGG + Exonic
1140318725 16:73926928-73926950 TCTCCTCCTCGTTCTGCTAGTGG + Intergenic
1140668265 16:77248008-77248030 CCTTCTTCATGGACTGCTTGAGG + Intronic
1141207697 16:81946153-81946175 TTTCCTCCTTGTTCTGCTTCAGG + Exonic
1143281272 17:5756365-5756387 GCTCCTCCATTCTTTGCTTGTGG + Intergenic
1143417084 17:6758179-6758201 GCTCCTCCATGGTTTCCTTGGGG - Exonic
1143531745 17:7509147-7509169 TCTGCTCCATGGTGAGCTTCCGG - Exonic
1144656673 17:17041740-17041762 TTTCCCCCATGATGTGCTTGAGG - Intergenic
1146436594 17:32855153-32855175 TTTCCTCCATGATTTCCTTGAGG + Intronic
1150122527 17:62616156-62616178 TCTCTTCAAAGGTCTGCATGTGG - Intergenic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1151123107 17:71814872-71814894 TCACCTCCATGGTCTGGAAGAGG - Intergenic
1151537491 17:74747193-74747215 CCTCCTCCCTGCTCTGCCTGAGG - Exonic
1152154196 17:78622290-78622312 GCTCCTCCTGGGTCTGCTTCTGG + Intergenic
1152154475 17:78623721-78623743 GCTCCTCCTGGGTCTGCTTCTGG + Intergenic
1152228358 17:79102884-79102906 GCTCCTCCAGTGTCTGGTTGGGG + Intronic
1153294638 18:3534054-3534076 TCTCCTGCATGTTCTGGTTTGGG + Intronic
1153741070 18:8128425-8128447 TCTCTTTCAAGGGCTGCTTGAGG + Intronic
1153827554 18:8890004-8890026 TCTTCTCAATGGTCAGCTTTTGG - Intergenic
1155788249 18:29929889-29929911 TTTCCCCCATGGTATTCTTGTGG + Intergenic
1160130457 18:76220806-76220828 TACCCTCCATCGCCTGCTTGGGG - Intergenic
1163261098 19:16190555-16190577 TCACCTCCACTCTCTGCTTGTGG - Exonic
1165450480 19:35879348-35879370 GCTCCTCCAGGGTCAGCATGGGG - Exonic
1165699262 19:37925219-37925241 TCAGCTCCATGGTCGTCTTGTGG + Intronic
1166265656 19:41682666-41682688 TCTGCTCCCTGCTCTGCTTCCGG - Intronic
1166521957 19:43486632-43486654 TCTCCGCCATGGCCTGCTGCAGG + Exonic
925044994 2:766430-766452 TCTCCTCCGTGGCCTGCTCCAGG - Intergenic
927444767 2:23149431-23149453 TCTCCTTCATGGCCTCCCTGGGG + Intergenic
928936936 2:36688544-36688566 TGCCCTCCATGGGCTCCTTGCGG + Intergenic
929442803 2:41978673-41978695 TTTCCTCCATGATATTCTTGTGG - Intergenic
930276915 2:49322383-49322405 TCTCCTACAGTGTCTGCCTGAGG - Intergenic
930891650 2:56396212-56396234 TCTCCTCTATTTTCAGCTTGAGG + Intergenic
932713892 2:74087835-74087857 TCTCCTCCAGCGTGTGCCTGCGG - Exonic
933355126 2:81200378-81200400 TCCCCTCCTTGTTCAGCTTGGGG + Intergenic
934107052 2:88704493-88704515 TTTCCTCCATACTCTTCTTGTGG - Intronic
935644493 2:105323027-105323049 TCACCACCATGGTTTGCTTTTGG - Intronic
936906862 2:117546351-117546373 TTTCCTCCATGCTTTTCTTGTGG + Intergenic
939957618 2:148540014-148540036 TCTCCTCCATGGACGGCTGTCGG - Intergenic
940023978 2:149185548-149185570 TCTCCTCCCTAGTCAGTTTGGGG + Intronic
940888091 2:159007850-159007872 CCTCCACCCTGGTCTGTTTGGGG - Intronic
942223236 2:173791593-173791615 TTTCCTCCTTGTTGTGCTTGGGG + Intergenic
945307921 2:208276800-208276822 TCCCCTCCATGATTTCCTTGAGG - Exonic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
946452063 2:219788737-219788759 TATCCTCCATACTCTTCTTGTGG + Intergenic
948318812 2:237052677-237052699 TCTCCTCTCTGTTCTTCTTGTGG - Intergenic
948882843 2:240869160-240869182 TCTCGTCCATGATCTGCATGCGG - Exonic
1170829187 20:19824941-19824963 TCTTCTCCAAGGCCTGCTCGAGG + Intergenic
1172188101 20:33044089-33044111 TCTCCTCCATGGGGTGCAGGTGG - Intergenic
1176151110 20:63591386-63591408 TTTCCTCCATGCTCCTCTTGGGG - Intronic
1177972134 21:27803161-27803183 TCTCTTCTATGCTCTGCTTTGGG - Intergenic
1178845219 21:36169029-36169051 TCTCCTCCATGGTCTGGAAGCGG + Intronic
1179461200 21:41536499-41536521 TCTCTTCCCTGGTCAGCCTGCGG + Intergenic
1179802311 21:43816745-43816767 TCTCCTGCATGGCCTGCAGGAGG + Intergenic
1180784535 22:18539464-18539486 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1181128112 22:20713517-20713539 GCTCCTCCTTGGCCTCCTTGGGG - Intronic
1181241438 22:21478821-21478843 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1181439796 22:22929893-22929915 TCTCCTACATGGTCATCTTGAGG + Intergenic
1182143230 22:27980615-27980637 TCTGCTCCATGTGCTGCTGGTGG + Exonic
1183186596 22:36295027-36295049 CCTCCTCCAGGGTCTTCTTCAGG + Exonic
1183237037 22:36626680-36626702 TCTCTTCAATGGTTTGCTTTTGG + Intronic
1183678517 22:39313205-39313227 TCTCCTCCATGGTCTGGAAGCGG + Exonic
950649719 3:14399711-14399733 TCTCCTCCTTTCTCTCCTTGGGG + Intergenic
954136035 3:48582641-48582663 TCTCCTCCAGGGGCTGCCAGGGG - Exonic
956742930 3:72289158-72289180 CCTCCTCCCTGGGCTGCTGGGGG + Intergenic
957606291 3:82403611-82403633 TTTCCTCCATGCTCTTCTTGTGG + Intergenic
959351383 3:105269016-105269038 TTTCCTCCATGCTGTTCTTGTGG + Intergenic
959846039 3:111035232-111035254 TCTCCTAGATGTTCTGTTTGTGG - Intergenic
960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG + Exonic
961929876 3:130522004-130522026 TCTTGTCCAGGGTCTGCTTTTGG + Intergenic
964391867 3:156206204-156206226 TCTCCTCCATTGTCAGGTTATGG + Intronic
965758393 3:172049189-172049211 ACTCCCCCTTGGTCTGCTTCAGG + Intronic
966993532 3:185257817-185257839 TCTCCTCCAGGCTTTGCTTGTGG - Intronic
967557362 3:190875662-190875684 TCTCCTCCATGGTCAGAGTCTGG + Intronic
968262202 3:197334593-197334615 TCTTCTCTAGGGTCTGCTTCAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969979050 4:11135239-11135261 ACACCTCAATGGTCTTCTTGGGG - Intergenic
972609764 4:40645680-40645702 TATCCTCTGTGGTGTGCTTGAGG - Intergenic
980423524 4:132594621-132594643 TCTCCTCCATTCTCAGCTTTTGG + Intergenic
984119256 4:175722296-175722318 TCTCTTCGGTGGTCTGTTTGAGG - Intronic
985950933 5:3220835-3220857 TCTTCCCCTTGCTCTGCTTGTGG - Intergenic
986686248 5:10277833-10277855 TATCCTTCATGGTGAGCTTGGGG - Intronic
989121335 5:38007562-38007584 TTACCTCCATGCTCTTCTTGTGG - Intergenic
990094422 5:52094351-52094373 TTTCCTCCATGCTGTTCTTGTGG + Intergenic
990995446 5:61728399-61728421 TCCTCTCCCTGCTCTGCTTGAGG - Intronic
991488634 5:67163568-67163590 TCACCTCCAGGCTGTGCTTGCGG - Exonic
992994229 5:82316676-82316698 TCTCCTTCAGGATCTGCTTTGGG + Intronic
993606360 5:89995015-89995037 TCTCCTCTCTGGTGTGATTGAGG + Intergenic
995945853 5:117644970-117644992 TCTCCTCCAGGCTCAGATTGAGG - Intergenic
996646888 5:125827603-125827625 TCTTCTCCCTAGACTGCTTGAGG - Intergenic
998110125 5:139494941-139494963 TATTCTCCAAGGTCTGCTTTTGG - Intergenic
998983230 5:147727101-147727123 TCTCCTCCATGAACTACTTCTGG + Intronic
999355673 5:150928493-150928515 TATCCTCAATGTTCTGTTTGGGG + Intergenic
999652645 5:153782807-153782829 ACTCCTGTATGGTATGCTTGCGG - Intronic
1000453635 5:161421185-161421207 TGTCCTTCAGGGTCTGCTTCTGG - Intronic
1001227253 5:169955465-169955487 TCTCCTCCAAGGCCAGTTTGCGG + Intronic
1006044326 6:31281438-31281460 TCTCCTCCATGGTCTGGAAGCGG - Intronic
1006168701 6:32081000-32081022 GCTCCTTCATGGTCTGGTTTGGG - Intronic
1008007319 6:46424642-46424664 TCTGCTCCATTGGCTCCTTGAGG - Intronic
1011970194 6:93212632-93212654 TTTCCTCCATTGTCTGTTTGTGG - Intergenic
1015316897 6:131827059-131827081 TCACCTCCAGGGTCTGCTCCAGG + Intronic
1018767796 6:166947406-166947428 TCTCCTCCCTGGCCTCTTTGGGG - Intronic
1018943962 6:168332367-168332389 GCTTCTCCATGGGCTGCTTGTGG + Intergenic
1019780839 7:2938750-2938772 TGTCCTCCAGGGCCTCCTTGCGG + Exonic
1021804051 7:24337618-24337640 TCTCTTCCACAGTCCGCTTGGGG - Intergenic
1021841224 7:24723306-24723328 TCTCCCCCTGGGGCTGCTTGGGG - Intronic
1022387171 7:29912443-29912465 TCTCTTCCAGGCTCTGCTTTAGG - Intronic
1022498707 7:30869160-30869182 TCTCCTCCATGTCCTCCTGGGGG - Intronic
1023613437 7:41994323-41994345 TTTCCTCCTTAATCTGCTTGTGG + Intronic
1023629100 7:42145868-42145890 CCTGCTCCATGGTGTTCTTGTGG - Intronic
1023811961 7:43918791-43918813 ACTCCTCCATGGTGCCCTTGGGG - Intronic
1024976977 7:55122397-55122419 TGTCCTCAATGGGCTGCTGGTGG + Intronic
1026398016 7:69978405-69978427 TTTCCTCCATGATCTTCTTCTGG - Intronic
1026879577 7:73900236-73900258 TCTCCACCCTGGTCTGCTACTGG - Intergenic
1029154352 7:98504388-98504410 TCTCCTCCTTGTTCTGCCTGGGG - Intergenic
1030473473 7:109998479-109998501 TCTCCTCCATGGTCTGGAAGTGG + Intergenic
1030601701 7:111600694-111600716 TCTCCTCCACGGCCTACTTTAGG + Intergenic
1031756297 7:125647406-125647428 TATCTTCAATGGTCTGCTTCGGG + Intergenic
1033071836 7:138209943-138209965 TTTCCTCCATGCTGTTCTTGTGG - Intergenic
1033784169 7:144710254-144710276 TCTAGTCTGTGGTCTGCTTGAGG - Intronic
1034235292 7:149562194-149562216 TCTCCTTTACGGTCTTCTTGTGG - Intergenic
1034429979 7:151036371-151036393 ACGCCTCCATGGCCTCCTTGAGG - Intronic
1034923694 7:155103811-155103833 TCTCCTCCTGGGACTGCTTTTGG + Intergenic
1035095429 7:156350727-156350749 TGTCCTTCATTTTCTGCTTGTGG - Intergenic
1035662212 8:1356577-1356599 TCTCCGTCATGTTCTGCCTGGGG - Intergenic
1035917384 8:3639558-3639580 TCTTCTGGATGGTCTGGTTGAGG - Intronic
1037619988 8:20555231-20555253 TCTGCTCCTTGGCTTGCTTGTGG + Intergenic
1043346781 8:79307240-79307262 TCTCCTTCATGTGCTGCCTGGGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045390000 8:101705727-101705749 TCTCCTCCATGGTGGCTTTGGGG - Intronic
1047225531 8:122952839-122952861 TCTGCTCCTTTGTCTTCTTGCGG - Exonic
1047628562 8:126681354-126681376 TGTTCTCCATGGTCTTCTGGAGG + Intergenic
1048482117 8:134807673-134807695 TCTGCTCCATGGTCGGTTTCTGG - Intergenic
1049670669 8:143868372-143868394 CCTCCTCCACGGTCAGCTTCCGG + Exonic
1058634357 9:107022034-107022056 TCTACTCCATGGCCTGCTAGAGG + Intergenic
1062400298 9:136369863-136369885 TCTCCTCCATGCACTGCAGGGGG + Exonic
1186156074 X:6728197-6728219 TTTCCTCCATGTTGTTCTTGTGG - Intergenic
1188823843 X:34805776-34805798 TCTCCACCATGTGCTGCTGGGGG + Intergenic
1189626572 X:42903451-42903473 TCTTCTCCGTGGTCTCTTTGGGG + Intergenic
1190404980 X:50078046-50078068 TCTCCTCCAAGGACTGAGTGAGG + Intronic
1192200640 X:69064500-69064522 TCTCCCCGATAGTCTGCTTTTGG - Intergenic
1197056054 X:122120615-122120637 ACTCATCCAAGGTCTGCTTGGGG - Intergenic