ID: 1150284645

View in Genome Browser
Species Human (GRCh38)
Location 17:63948065-63948087
Sequence TGGGGGCACCAGCACCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150284636_1150284645 8 Left 1150284636 17:63948034-63948056 CCGCTGCTCAATGTAGATGTCCT 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG 0: 1
1: 0
2: 2
3: 32
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150284645 Original CRISPR TGGGGGCACCAGCACCACCA GGG Intronic
900274835 1:1818195-1818217 TGAGGGCACAGGCAGCACCAGGG - Intronic
900572531 1:3365549-3365571 TGGGGGCACCACCAACCCCATGG - Intronic
900597851 1:3490618-3490640 TGGGAGCACCCGCCCCACCCTGG - Intronic
900713573 1:4129941-4129963 TGGTGACACCAACACCACGAGGG - Intergenic
902283754 1:15393033-15393055 TGGGGGCAGCATCACCCCCGAGG + Intronic
903916890 1:26771334-26771356 TGGGGTCAGCGGCCCCACCAAGG + Intronic
904001214 1:27339850-27339872 TGGGGGCGCCAGGACCAGGATGG + Intergenic
904557231 1:31373180-31373202 TGGGCGCACCAGCCCCTCCTGGG - Intronic
905242211 1:36588586-36588608 CAGGAGCACCAGCCCCACCAGGG - Intergenic
905626848 1:39495085-39495107 TGGTGGCCCCAGAGCCACCATGG + Intronic
905798952 1:40831204-40831226 TGAGGCCACCAGCCCCACCAAGG + Exonic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906149500 1:43579343-43579365 GGTGGGCTCCAGAACCACCATGG + Intronic
906483423 1:46216390-46216412 TGGGTGCAGTGGCACCACCATGG + Intronic
907393943 1:54176839-54176861 TGGTGGCAGCAGAACCATCAAGG + Intronic
909348793 1:74624321-74624343 TAGGGCCACCAGCATCAACATGG - Intronic
910317801 1:85907218-85907240 TGGGGGCAAGAGGACCACCTGGG - Exonic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
913269112 1:117075576-117075598 AGGCTGCACCAGCAGCACCAGGG + Exonic
913290408 1:117266698-117266720 TAGGAGCATCAGCATCACCAGGG + Intergenic
914512352 1:148345285-148345307 AGGGGGCAGCAGCAACTCCAAGG - Intergenic
914993433 1:152517816-152517838 TGGAGGTACCACCACCATCAGGG - Intronic
916611258 1:166394033-166394055 TGGGGAAACCATCACCTCCAAGG - Intergenic
917800250 1:178563281-178563303 TGGGGGTACCTGCATCCCCAGGG + Intergenic
920440953 1:205980024-205980046 TGGGGGCACCACCATCATCAAGG - Intronic
921187430 1:212682752-212682774 TGTGGTCAACACCACCACCACGG - Intergenic
921948404 1:220904905-220904927 TGGGCTCACCAGCACTACCACGG - Intergenic
922242339 1:223763997-223764019 TGGGGACAGCAGCCCCAACATGG + Intronic
1062926221 10:1317636-1317658 TGGATGCACCAGCAACATCAGGG - Intronic
1062996928 10:1874770-1874792 GGGGGGCCCCAGCAGCCCCAAGG + Intergenic
1063678731 10:8165497-8165519 TGGGTGCAACAGCACGACCTCGG + Intergenic
1064090053 10:12375556-12375578 TTGGAGTACCAGCAGCACCAAGG - Intronic
1065434326 10:25691749-25691771 TGGGGGCACCATTGCCTCCAAGG + Intergenic
1067478038 10:46579039-46579061 GCTGGGCACCAGCAGCACCACGG + Intronic
1067616702 10:47762748-47762770 GCTGGGCACCAGCAGCACCACGG - Intergenic
1068951176 10:62779134-62779156 TGGGTGCTTCAGCACCACAAGGG + Intergenic
1069898277 10:71692301-71692323 TCGGGGCTCCAGCTCCACCTGGG + Intronic
1069917906 10:71798525-71798547 TGGGGGCACCAGGTCCAGCAGGG - Exonic
1070774796 10:79103368-79103390 TGGGGGCAACAGCCCCTCCTTGG - Intronic
1072523613 10:96252370-96252392 TGGTAGCATCAGCACCACCTGGG - Intronic
1072618019 10:97062657-97062679 TGGGGGCACCTGCACCAGGAAGG + Intronic
1072737498 10:97889088-97889110 CTGGGGCACCAGCAATACCAGGG + Intronic
1073859464 10:107721163-107721185 TGGGGGAAACAGCAGCACCTGGG - Intergenic
1075597297 10:123741477-123741499 TGGGGGGATCAGCACCACCCTGG - Intronic
1076437879 10:130459174-130459196 TGCGGGGACAAGCACCAGCAAGG - Intergenic
1077124563 11:926478-926500 GGGGGGCTGCGGCACCACCAAGG + Intronic
1077159783 11:1107469-1107491 TCGGGCCTCCAGCACCTCCAAGG - Intergenic
1077298480 11:1836817-1836839 TCGAGCCTCCAGCACCACCACGG - Exonic
1078923499 11:15853307-15853329 TGGTGGCATCAGCATCACCTGGG - Intergenic
1079066571 11:17299310-17299332 TGGAAGCATCAGCATCACCAGGG - Intronic
1080609724 11:33893296-33893318 TCAGGCCACCACCACCACCATGG - Intergenic
1081002165 11:37688513-37688535 TAGCAGCACCAGCAGCACCAGGG + Intergenic
1081038224 11:38176982-38177004 TGGGGTCGCAAGCACCACAATGG + Intergenic
1081584322 11:44374051-44374073 AGTGGCCACCAGCAGCACCAGGG + Intergenic
1081659959 11:44882073-44882095 TGGTGACTCCAGGACCACCAGGG - Intronic
1083148293 11:60774484-60774506 TGGGTGCACCAGCACCCACAGGG + Intronic
1084113375 11:67027663-67027685 CGGGGGCCCCATCACCTCCATGG - Intronic
1084701076 11:70786402-70786424 TGGGAACACCAGCACCACCAAGG - Intronic
1084939050 11:72602536-72602558 TGGGGGGACCAGAGCCACAAAGG + Intronic
1085816437 11:79742174-79742196 TGGGGGCTGCTGCACCACCCAGG + Intergenic
1088775997 11:113083755-113083777 TGGGGCCACCAGCACTACATTGG - Intronic
1089124616 11:116167993-116168015 TGGGGGCACCAGCAGCATGCAGG + Intergenic
1091372000 11:135068709-135068731 AGGGGGCACCAGGATCTCCAAGG + Intergenic
1091913400 12:4250274-4250296 TGGGGGCACCAGGACCAACTGGG + Intergenic
1093147680 12:15586321-15586343 TGGGGGCATGAACAGCACCATGG + Intronic
1098435443 12:70463906-70463928 TGGGGCCAGCAGCAGCAGCAGGG + Intergenic
1099470864 12:83046333-83046355 TGGCAGCATCAGCATCACCAGGG + Intronic
1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG + Intergenic
1101691392 12:107085741-107085763 TGGGTGCAGCAAAACCACCATGG + Intronic
1102577662 12:113866610-113866632 TGGTAGCATCAGCATCACCAGGG + Intronic
1102584503 12:113913825-113913847 TCGGGGGACCTGCAGCACCATGG - Intronic
1102976945 12:117213572-117213594 TGGGGGCACCAAGACCCCAAAGG - Exonic
1104289801 12:127456377-127456399 TGGGGGCTCCAGCCTCTCCAAGG + Intergenic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1104988263 12:132609783-132609805 CAGGGGCAACAGCACCTCCAGGG - Intronic
1107038870 13:35928222-35928244 TAAGGGCACCATCCCCACCAAGG - Intronic
1107826440 13:44332730-44332752 TGGAGGCAGCAGCAGCAGCAGGG - Intergenic
1108074917 13:46670013-46670035 TGGGGCCACCCGGAGCACCACGG + Intronic
1108455318 13:50607727-50607749 CAGTGGCCCCAGCACCACCATGG - Intronic
1111796620 13:92928687-92928709 TGGGTGCAGCAAAACCACCATGG + Intergenic
1113560145 13:111272337-111272359 CGGGGACACCAGAACCATCAAGG - Intronic
1116162555 14:41288479-41288501 AGGAGACACCAGGACCACCAAGG + Intergenic
1117013521 14:51494658-51494680 TGGGGGCAGCCTCACCCCCATGG + Intronic
1118318946 14:64742201-64742223 TGGGGCCACCAGCTCCCCCTGGG - Exonic
1120009865 14:79401360-79401382 AGGCAGCACCAGCATCACCAGGG + Intronic
1121081874 14:91114908-91114930 TGGGAGCATCAACACCAACATGG + Intronic
1122388065 14:101362386-101362408 TGGGGGCACAGGCATCACTAAGG + Intergenic
1123144608 14:106116566-106116588 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123156814 14:106234993-106235015 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123207585 14:106728094-106728116 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123212596 14:106775088-106775110 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1124203573 15:27698674-27698696 TGGCTGCACCAGCCCCACCGTGG - Intergenic
1125540843 15:40469148-40469170 TGGTGGCACAGACACCACCATGG + Intergenic
1125833477 15:42731792-42731814 CGGTGCCCCCAGCACCACCAGGG + Exonic
1126792634 15:52234892-52234914 TGGGGGCAGCAGGAACACGAGGG - Intronic
1128498501 15:68211366-68211388 TTGGGGCCCCAGCACCTCCCTGG - Intronic
1129619218 15:77128529-77128551 GGGTGGCACCATCACCACCATGG - Intronic
1129653882 15:77510128-77510150 TAGGGTCACAAGCCCCACCAAGG - Intergenic
1129897428 15:79118799-79118821 TGGGGGCAGCATCTCCCCCATGG - Intergenic
1131050350 15:89343490-89343512 TGGGGGCTCCAGCCTGACCATGG - Intergenic
1132150349 15:99454319-99454341 CGGCAGCACCAGCACCACCTGGG - Intergenic
1132299619 15:100767872-100767894 TGGGGCCAAAACCACCACCATGG - Intergenic
1132299655 15:100767972-100767994 TGGGGCCAAAACCACCACCACGG - Intergenic
1132299669 15:100768012-100768034 TGGGGCCAAAACCACCACCACGG - Intergenic
1132299689 15:100768072-100768094 TGGGGCCAAAACCACCACCACGG - Intergenic
1132299757 15:100768252-100768274 TGGGGCCAAAACCACCACCATGG - Intergenic
1132618492 16:853573-853595 TGGGGGCACGGCCACCGCCAAGG + Intergenic
1132907796 16:2292156-2292178 TGGGGCATCCATCACCACCATGG - Exonic
1132976599 16:2714174-2714196 TGGTGCCTCCAGCTCCACCAGGG + Exonic
1133400862 16:5485790-5485812 TGGGAGCACAAGAACGACCATGG + Intergenic
1133759324 16:8785789-8785811 TGGCGGCTCCATCACCAGCATGG - Intronic
1134023093 16:10934826-10934848 TGAGGGCACCAGCACCATCTGGG + Intronic
1134267288 16:12703111-12703133 AGGCGGCATGAGCACCACCATGG - Intronic
1136067028 16:27766315-27766337 TGATGGCACCAACATCACCATGG + Exonic
1136222226 16:28835994-28836016 TGGGTGCAGCAGCATCACCTGGG - Exonic
1136281935 16:29218372-29218394 TGGGGCCACCAGAGCCTCCAGGG + Intergenic
1136383990 16:29911419-29911441 TGGGGACACCAGGACCCCCGGGG - Intronic
1137343757 16:47636307-47636329 TGGGGACACCAGCTGCAGCAGGG + Intronic
1139592793 16:67942770-67942792 TGGGGGGACCAGCAGCACCGGGG + Intronic
1139650451 16:68359595-68359617 TCAGGGCACCAGCACCAGGAGGG + Exonic
1140320821 16:73950369-73950391 TGGCAGCATCAGTACCACCATGG + Intergenic
1141569033 16:84923052-84923074 TGGGGGCACCAGTGCCAACAAGG + Intergenic
1142086311 16:88184288-88184310 TGGGGCCACCAGAGCCTCCAGGG + Intergenic
1142408781 16:89905689-89905711 TGGGGGCACCAGCGCCTCTTGGG - Intronic
1143621944 17:8085899-8085921 AGGGGGGCCCAGCCCCACCAGGG - Intronic
1144009620 17:11134255-11134277 TGGAGGCACCAGCAGCACCCTGG - Intergenic
1144718887 17:17454102-17454124 TGGGAGCACCAGCTCCATAAGGG + Intergenic
1145779426 17:27552595-27552617 TGGGGGCACCAACTCTCCCAGGG - Intronic
1147262742 17:39218051-39218073 TGGGGGCGTCAGCAGCACCTCGG + Exonic
1148147899 17:45377551-45377573 GGGGGGCACCAGCACTGGCAGGG - Intergenic
1149432896 17:56608578-56608600 TGGTAGCACCACCACCAGCATGG - Intergenic
1149637989 17:58185573-58185595 TGTGGCCAGCAGCTCCACCATGG + Intergenic
1149866856 17:60156033-60156055 TCGGGGAACCAGCTCCTCCAGGG + Intronic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1150287258 17:63961380-63961402 TGGGCGCACTTGTACCACCATGG + Exonic
1150448165 17:65243773-65243795 TGAGGGCACCAGCAGCCTCAAGG - Intergenic
1152701070 17:81819974-81819996 TGGGGCCTCCAGCAACACCGTGG + Intergenic
1153280266 18:3408298-3408320 TGAGAGCACCAGCATCACCCAGG + Intergenic
1154325993 18:13390763-13390785 TGGGTGCGCCAGCACCTGCAGGG + Intronic
1154437960 18:14361069-14361091 TGGGGGCACCAGTGCCTGCACGG + Intergenic
1160268194 18:77359023-77359045 GAGGGGCCCCAGCACCCCCAAGG - Intergenic
1160996161 19:1882979-1883001 TGGGGACACCCTCACTACCAAGG + Intronic
1161299884 19:3537540-3537562 GGGAGGCACCAGCACCCCCTGGG - Intronic
1161584510 19:5097908-5097930 TGGGGGCCCCAGGTCCACGACGG - Intronic
1161746599 19:6063877-6063899 TGGGGGCAGGACCACCCCCATGG + Intronic
1162224227 19:9206240-9206262 CGGGGGGACCACCACCACCAAGG - Intergenic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163648270 19:18502478-18502500 AGCGGGCACCCCCACCACCAGGG + Intronic
1163756262 19:19108094-19108116 TGGGGACAGCAGCTCCACCTGGG + Intronic
1164463039 19:28464614-28464636 TGGGGGCACCAGCTTCACCCTGG - Intergenic
1166379871 19:42350314-42350336 GGTAGGCACCAGCACCAGCAGGG - Exonic
1166808114 19:45498966-45498988 CGGGGAGACCAGCAACACCACGG - Exonic
1167432283 19:49461625-49461647 CGGGGGCACGAGGGCCACCACGG - Exonic
1168353693 19:55689841-55689863 TTGGGGCACGGGCACGACCAGGG - Intronic
925158278 2:1663452-1663474 TGGGGGCACAAGCACAATGACGG + Intronic
925187772 2:1860926-1860948 CGGAGGATCCAGCACCACCACGG + Intronic
926141553 2:10371261-10371283 TGGGGGCACAGTCACCTCCAAGG - Intronic
926332963 2:11840255-11840277 TGGGGGTGCCAGGACCACCCGGG + Intergenic
926801415 2:16664164-16664186 AGGGGGCAGCAGCAGCATCACGG - Intronic
927212921 2:20649753-20649775 TGAGGGCACCAGCACACCCAAGG - Intronic
927683718 2:25156642-25156664 TGGAGGCTCCTGCACCCCCAAGG + Exonic
929968348 2:46552276-46552298 TGGGGCCATCAGCGCCACCTCGG - Intronic
930341266 2:50118289-50118311 TGGCGGCATCAGCATCACCTGGG - Intronic
930658446 2:54030157-54030179 TGGGGGCCCCAGGACCTTCAAGG + Intronic
933777433 2:85779510-85779532 TGGGAGGCCCAGCACCCCCAGGG - Intronic
934572170 2:95379670-95379692 TGTAGGGACCAGCACCCCCAGGG + Intronic
934943631 2:98520383-98520405 TGGTGGCAGGGGCACCACCAGGG + Intronic
934980111 2:98832465-98832487 TGGGGCCACCACCTCCTCCAGGG - Exonic
935213867 2:100960694-100960716 ACGGGCCACCAGCAGCACCAAGG + Intronic
936063658 2:109314199-109314221 TGGGGGCACCAGAACCATGTGGG + Intronic
937370973 2:121296839-121296861 TGGGGACACCAGCTGCAGCAGGG - Intergenic
937907679 2:127060333-127060355 TGGTGGCCCGGGCACCACCAGGG + Intronic
942172911 2:173304904-173304926 TTGGGGCCCCAGAACCACTAAGG - Intergenic
943573076 2:189597231-189597253 TCTCAGCACCAGCACCACCAAGG + Intergenic
944709039 2:202319329-202319351 CAGGGTCACCAGCAGCACCATGG + Intergenic
945250996 2:207766874-207766896 AGGGGGCAACAGCACCATGAAGG + Exonic
945284207 2:208065889-208065911 CGGGGGGACCAGAACAACCAGGG - Intergenic
947151523 2:227121128-227121150 AGGGTCCACCAGGACCACCAGGG - Exonic
947715565 2:232337385-232337407 TGGGTGCCCCGGCAGCACCAAGG + Intronic
948426947 2:237894513-237894535 TGGGGCAGCCAGGACCACCAGGG + Intronic
948454444 2:238098268-238098290 CGTGGGCCGCAGCACCACCAGGG + Exonic
948601301 2:239108886-239108908 TGGGGGCCCCAGAACCAACTGGG + Intronic
948937978 2:241180783-241180805 TGGGAGGAGCTGCACCACCAGGG - Intronic
1169141711 20:3230425-3230447 TGGGGGCACCCCCACCACCCTGG + Intronic
1171824133 20:29878930-29878952 CTGGGGCTCCAGCACCACCACGG + Intergenic
1173441054 20:43076705-43076727 TGTGGGCAGCAGCACCATCATGG - Intronic
1173444277 20:43103600-43103622 TGGGGGCAATATCACCCCCAAGG + Intronic
1173522192 20:43708565-43708587 TGGGACTACAAGCACCACCATGG + Intronic
1173701422 20:45075191-45075213 TGAGGGCCCCAGCTCCACCCAGG + Exonic
1174357971 20:50010628-50010650 GGGTGGCTCCAGCCCCACCATGG - Intergenic
1174367684 20:50066385-50066407 TGGGGCCACCAACACTACCAAGG + Intergenic
1175403664 20:58714157-58714179 TGGGTGCACCAGCACCCTGAAGG - Intronic
1176063801 20:63183804-63183826 TGGTGCCACAAGCACCACCAAGG + Intergenic
1176143904 20:63557065-63557087 AGGAGGCAGCAGCACCACCGGGG + Intergenic
1176148199 20:63574633-63574655 TTGGGGTCCCAGCAGCACCAGGG - Intergenic
1176408039 21:6432261-6432283 CGGGCCCACCACCACCACCAGGG + Intergenic
1176947772 21:15004572-15004594 TGGGGAAACAAGCCCCACCAAGG + Intronic
1177138621 21:17333416-17333438 TGGGTGCAGCCGCACCAGCATGG + Intergenic
1179683530 21:43040587-43040609 CGGGCCCACCACCACCACCAGGG + Intergenic
1180036547 21:45253232-45253254 TGGGGGCTTCAGCACCAACACGG - Intergenic
1181492638 22:23270016-23270038 TTGTGGCACCTGCACCATCAGGG + Intronic
1181602963 22:23963252-23963274 TGGGAGTATCAGCATCACCAGGG + Intergenic
1181605551 22:23978055-23978077 TGGGAGTATCAGCATCACCAGGG - Intronic
1181729602 22:24835092-24835114 AGGGGGAAACATCACCACCAAGG - Intronic
1182344813 22:29654915-29654937 TGGGGTCACCAGGACTAGCATGG + Intronic
1182667201 22:31968427-31968449 TGGAGGCACTAGCAAAACCATGG - Intergenic
1184015761 22:41784659-41784681 TGAGGGCACCAGGGCTACCAGGG - Exonic
1184279294 22:43427893-43427915 TGGAGGAAACAGCACCTCCAAGG + Intronic
950424149 3:12915548-12915570 GGTGGGCCCCAGCACCACCCGGG - Intronic
952807022 3:37365402-37365424 TGGGGTTACAAGCACCACCACGG + Intronic
953889021 3:46736713-46736735 TGGGGGCACCATCAAGGCCAAGG - Intronic
954133268 3:48570645-48570667 TGGGGCCACCTGGACCACCGGGG - Exonic
954609561 3:51937158-51937180 TGGGGGCTCCAGCCCCACCCAGG + Intronic
955981243 3:64529742-64529764 CAGGGGCATCAGCATCACCAGGG + Intronic
958901538 3:99892950-99892972 TTGGGGGATCAGCACCAACAGGG - Intronic
959605212 3:108234931-108234953 TAGGAGCACTAGCACCACTAAGG - Intergenic
961383315 3:126509814-126509836 TGGGGGCTCCAGAGCCACTAGGG + Intronic
961519562 3:127459048-127459070 TGGGCGGAGCAGCACCCCCAGGG + Intergenic
962905076 3:139794000-139794022 TGGGAGGTCCAGCAACACCAAGG - Intergenic
964178539 3:153855971-153855993 TTGGGGTGTCAGCACCACCAGGG + Intergenic
964624577 3:158747059-158747081 TGGCAGCAACAGCACCACCTGGG - Intronic
964634017 3:158841559-158841581 GCTGGGCACCAGCACCACCTGGG - Intergenic
964802293 3:160569150-160569172 CAGGTGCACCAGCTCCACCAGGG + Intergenic
966750119 3:183313876-183313898 TGGGAGCCCCACCACCACCTTGG + Intronic
968132047 3:196197681-196197703 TGGGGGCTCCTGCAGCAGCAGGG + Exonic
968391910 4:199790-199812 TAGGGGAACAAGCACCATCATGG - Intergenic
969336893 4:6516271-6516293 TGGGGGCTCCAGGACCATCCTGG + Intronic
969699888 4:8762190-8762212 GGGGGCCACCAGCCCAACCATGG - Intergenic
970142362 4:12996437-12996459 AGGAGCCCCCAGCACCACCAGGG + Intergenic
972366462 4:38380095-38380117 TGGGACCACCGGGACCACCATGG + Intergenic
973912194 4:55592391-55592413 TGTCAGCACCAGCACCACAAAGG - Intergenic
975327536 4:73077029-73077051 TGGGTCCTCCAGCACCATCAGGG + Exonic
976687980 4:87837252-87837274 TGGGGGAACTAGGACCACAAAGG + Intronic
976948612 4:90800099-90800121 TATGGGAAACAGCACCACCAAGG - Intronic
977928617 4:102728820-102728842 CAGCCGCACCAGCACCACCAGGG - Intronic
978153972 4:105468715-105468737 CTGGGGCACCAACACCATCAGGG + Intronic
982743729 4:159084774-159084796 TGGGGGCACCTGCCCCAACCAGG - Intergenic
984273849 4:177583488-177583510 TGAGGGCCCCAGCACCACAGTGG - Intergenic
985643239 5:1073445-1073467 TGGGAGCACCAGCCGCACCCCGG - Intronic
986156302 5:5179802-5179824 TGAAGCCATCAGCACCACCATGG - Intronic
986225476 5:5807834-5807856 GGTAGGCACCAGCACCTCCACGG + Intergenic
989730583 5:44642413-44642435 CAGGGACACCAGCTCCACCAGGG - Intergenic
991357032 5:65779258-65779280 TAGGAGCATCAGCATCACCAGGG - Intronic
993075575 5:83226085-83226107 TGGGCACACGAGCACCTCCAGGG - Intronic
993567190 5:89490192-89490214 TAAGGGAACCATCACCACCATGG - Intergenic
996892413 5:128437522-128437544 TGGGGGCCTCATAACCACCATGG + Intronic
997250390 5:132384484-132384506 TGGGGTCCCCAGCAGCACAATGG + Intronic
999806502 5:155086312-155086334 TGGCAGCACCAGCATCACCTGGG - Intergenic
999832038 5:155329513-155329535 CGGAGACACCATCACCACCATGG - Intergenic
1000337318 5:160251534-160251556 TGGGGGCAGCAGCAAGACCTCGG - Intergenic
1000895174 5:166846592-166846614 TGGGGCCACCTGCACGACCTAGG + Intergenic
1001328432 5:170745796-170745818 TCGGGGCAGCTGCCCCACCACGG + Intergenic
1002520662 5:179791927-179791949 TGGAGGCACCAGCATCAGGAGGG - Intronic
1003608228 6:7584960-7584982 TGTCGGCACCAGCAGCAGCATGG + Exonic
1005463911 6:26093345-26093367 TGGGGACACCAGCAGCTCCCTGG + Intronic
1007176271 6:39899829-39899851 TGGGGCCAGCAGCATCACCTAGG - Intronic
1007473576 6:42105491-42105513 TGGGGGCTCCTTCACCTCCACGG + Exonic
1013432118 6:110064586-110064608 TGGGTGCCCCAGCCCCAGCAGGG + Intergenic
1013468216 6:110436252-110436274 TGGTGCCACCAGCACTATCAGGG - Intronic
1013601717 6:111711594-111711616 TGTGGCCTCCAGCGCCACCAGGG + Intronic
1015101071 6:129481393-129481415 GAGGGACACCAGCACCACCTAGG + Exonic
1017726914 6:157282654-157282676 TGGGGTCATCAGCCACACCAAGG + Intergenic
1017987313 6:159455643-159455665 TGGGAGCATCACCACCACCCAGG + Intergenic
1017987348 6:159455773-159455795 TGGGAGCATCACCACCACCTGGG + Intergenic
1017987353 6:159455792-159455814 TGGGAGCACCACCACCACCCGGG + Intergenic
1017987406 6:159455975-159455997 TGGGAGCACTACCACCACCAGGG + Intergenic
1017987438 6:159456093-159456115 GGGGAGCACCACCACCACCCGGG + Intergenic
1017987446 6:159456113-159456135 GGGGAGCACCATCACCACCCGGG + Intergenic
1018389827 6:163333664-163333686 TAGGGACACCTGCACCACCGTGG + Intergenic
1018749877 6:166794912-166794934 TGGGTGCAGCAACACCAACATGG + Intronic
1018812620 6:167308607-167308629 TAGGGGCCCCAGCCCCAGCAAGG - Intronic
1019148076 6:169987259-169987281 GGGGGGCCCCTGAACCACCAGGG + Intergenic
1019196347 6:170285364-170285386 TGGAGCCACCTGCACCAACACGG - Exonic
1019938658 7:4272343-4272365 TGGCGGCCTCAGCACCCCCATGG + Intergenic
1020333935 7:7047065-7047087 AGGCAGCACCAGCACCACCTGGG - Intergenic
1021100585 7:16583894-16583916 TGGGTGCAGCAGCATCACCTGGG + Intergenic
1023202230 7:37711272-37711294 TGGCAGCATCAGCATCACCAGGG - Intronic
1024499799 7:50093072-50093094 TGAGGGCACCCGCACCAGGAAGG + Exonic
1025991853 7:66503234-66503256 TGGATGCACCAGCCCCGCCAGGG + Intergenic
1030027444 7:105338381-105338403 GCAGGCCACCAGCACCACCACGG + Intronic
1031912694 7:127534368-127534390 TGGTGGCATCAGCCTCACCAGGG + Intergenic
1032029051 7:128467054-128467076 CTGGGGCACCAGCTGCACCAGGG + Intergenic
1032900335 7:136300172-136300194 TGGGGGTTCCAGGACCCCCATGG - Intergenic
1033118267 7:138645239-138645261 AGGGGGCTCCAGCACCCACACGG + Intronic
1033233634 7:139621014-139621036 CTGGGTCACCAGCACCACCTAGG + Intronic
1033245431 7:139713393-139713415 TAGGGGCACCAGCACCAGGCAGG + Intronic
1034251011 7:149690833-149690855 TGACGGCACCAGAACCACCTGGG - Intergenic
1035326631 7:158070341-158070363 CAGGGGCACCTCCACCACCACGG - Intronic
1035326788 7:158070858-158070880 CATGGGCACCACCACCACCACGG - Intronic
1035395502 7:158532193-158532215 TGGGGGCATGGGCACCACCCAGG - Intronic
1035770079 8:2139995-2140017 TGCAGGCACCACCACCACCCAGG + Intronic
1037163431 8:15798883-15798905 TGCGGGCAGCAGCATCACCATGG - Intergenic
1037819184 8:22127503-22127525 TGGGGCCACCAGCAACACCAAGG - Exonic
1038535018 8:28347541-28347563 TGGAGGCTCCAGAAACACCAAGG + Exonic
1039958216 8:42223443-42223465 TGGGGACACTGGCACAACCAGGG - Intergenic
1042344294 8:67711875-67711897 TTGGGGCAACAGTGCCACCAGGG - Intronic
1042959601 8:74289496-74289518 TGGGGGCACCAGCAGCACTGTGG - Intronic
1048464492 8:134654443-134654465 TGGGTTCACCTGCAACACCACGG + Intronic
1049494722 8:142924344-142924366 TGGGGGCTCCTGGACCACCAGGG - Intergenic
1049755094 8:144307743-144307765 GGAGTGCACCAGCACCAACATGG - Intronic
1049782597 8:144435702-144435724 AGGGAGCCCCAGCACCCCCAGGG - Exonic
1049988859 9:974550-974572 TGGGGGCACTTTCACTACCAAGG - Intergenic
1050076039 9:1865028-1865050 TGGGTGCAGCAAAACCACCATGG + Intergenic
1050261216 9:3842636-3842658 GGGGGGCATCAGCTCCACCTTGG + Intronic
1054337301 9:63818054-63818076 CTGGGGCTCCAGCCCCACCACGG + Intergenic
1055576206 9:77662239-77662261 TGAGGGCATCAGCATCACCTGGG - Intergenic
1060218649 9:121753109-121753131 TGGGGACGCCAGCTCCACCCTGG + Intronic
1060221584 9:121766789-121766811 TGGGGGCAGAAACACCCCCAGGG - Intronic
1061243709 9:129390150-129390172 TGGGGGCTTCAGGACCAACATGG + Intergenic
1061915951 9:133754235-133754257 TGCTGCCACCACCACCACCAAGG - Intergenic
1061957621 9:133971764-133971786 TGGGGCCACCTGCACCACCCGGG + Intronic
1062224959 9:135444778-135444800 TGGGGCCACCTCCACCTCCAAGG - Intergenic
1062582879 9:137236175-137236197 GAGGAGCACCAGCCCCACCAGGG - Exonic
1203782566 EBV:108779-108801 GGGTGTCACCAGCACCGCCACGG + Intergenic
1203364147 Un_KI270442v1:243036-243058 CTGGGGCTCCAGCCCCACCACGG - Intergenic
1203377203 Un_KI270442v1:385375-385397 CTGGGGCTCCAGCCCCACCACGG + Intergenic
1186496718 X:10016440-10016462 TGGGGACACCTGCAGAACCAGGG - Intronic
1189888801 X:45577433-45577455 TGTGGGCACCAGCAGTAGCAAGG + Intergenic
1189904427 X:45743204-45743226 TGGGGGCACTAGCCACACCTAGG - Intergenic
1190597242 X:52062125-52062147 TGGGGGCAACGGCAACAGCATGG - Intronic
1190611582 X:52191948-52191970 TGGGGGCAACGGCAACAGCATGG + Intronic
1190916580 X:54815619-54815641 TGCTGGCACCAGCTCCACCAAGG - Exonic
1195793330 X:108614977-108614999 AGGGACCACCAGGACCACCAGGG + Exonic
1196082103 X:111643847-111643869 TGAGGGCACCGGTACCATCAAGG + Intergenic
1198807100 X:140503766-140503788 GGCGTGCACCAGCACTACCAGGG - Exonic
1200108001 X:153725091-153725113 CAGGGGCCCCAGCACCACCCCGG + Exonic
1200687168 Y:6266998-6267020 TGGAGGCACAAGCCCCACCTAGG + Intergenic
1201705556 Y:16932838-16932860 TGGGTGCACAAAAACCACCATGG + Intergenic