ID: 1150285498

View in Genome Browser
Species Human (GRCh38)
Location 17:63951621-63951643
Sequence GAAGAAGGAGCCGCCCGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150285498_1150285503 -10 Left 1150285498 17:63951621-63951643 CCTCCTCGGGCGGCTCCTTCTTC 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1150285503 17:63951634-63951656 CTCCTTCTTCTCATCCTCGGGGG 0: 1
1: 0
2: 3
3: 36
4: 413
1150285498_1150285508 20 Left 1150285498 17:63951621-63951643 CCTCCTCGGGCGGCTCCTTCTTC 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1150285508 17:63951664-63951686 CCCCGCCTCTCCAGCCTCCCCGG 0: 1
1: 0
2: 9
3: 83
4: 829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150285498 Original CRISPR GAAGAAGGAGCCGCCCGAGG AGG (reversed) Exonic
900117283 1:1034054-1034076 GAAGAAAGCGCCGCCTGCGGAGG - Intronic
900176301 1:1292918-1292940 GGAGAAGGTGCCTCCGGAGGAGG + Exonic
900991577 1:6100558-6100580 GAAGAGGGACCAGCGCGAGGTGG + Exonic
901628391 1:10636207-10636229 GAGGAAGGAGCCGAGGGAGGAGG + Intergenic
903205966 1:21782891-21782913 GGAGACGGTGCGGCCCGAGGAGG - Exonic
905146846 1:35893679-35893701 GAAGAAGGAGCGGCCCACAGGGG - Exonic
905319036 1:37102744-37102766 GAAGAAGGAGCAGGAGGAGGAGG + Intergenic
908022781 1:59915564-59915586 GAAGAAGCAGCAGCAGGAGGAGG + Intronic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG + Intronic
921367049 1:214383817-214383839 GGAGCAGGGACCGCCCGAGGAGG - Exonic
922817982 1:228464563-228464585 GAAGCCGGAGCCGCCCGCGATGG + Intergenic
1064583475 10:16817021-16817043 GGAGAAGAACCAGCCCGAGGTGG - Exonic
1065036303 10:21642367-21642389 GAAGAAGTAGCCGGGCGCGGTGG + Intronic
1073073248 10:100807980-100808002 AAAGGAGGAGCTGGCCGAGGCGG + Intronic
1074057778 10:109938349-109938371 GAAGAAAGAGCTGCCCTGGGTGG + Intergenic
1074924829 10:118057410-118057432 GAAGAAGGAGCATTACGAGGAGG - Intergenic
1076000803 10:126911580-126911602 AAATGAGGAGGCGCCCGAGGAGG + Intronic
1077136547 11:1002304-1002326 ACAGGAGGAGCCGGCCGAGGCGG - Intronic
1078646069 11:13142251-13142273 GGAAAAGCAGCCGCCCGAGGTGG - Intergenic
1079128438 11:17734596-17734618 GCAGCAGGAGCCGCGCGGGGCGG + Intergenic
1080478345 11:32619734-32619756 GAAGAAGGAGCAGAAGGAGGAGG + Intronic
1080866827 11:36202821-36202843 GAAGAAGGACACGGCAGAGGGGG + Intronic
1083365337 11:62138719-62138741 GCAGAAGGAACCCCCCGAGGAGG + Exonic
1083804572 11:65066343-65066365 GAAGGAGCGGCCTCCCGAGGAGG + Intronic
1084363090 11:68681810-68681832 GAAGAAGGAGGAGGACGAGGAGG - Intergenic
1085684576 11:78610095-78610117 GAAGAAGGAGAAGGACGAGGAGG - Intergenic
1091177708 11:133576544-133576566 GGAGAAGGAGCGCCCCTAGGAGG + Intergenic
1091451595 12:575594-575616 GCAGAAGGAGCCGTCTCAGGAGG - Intronic
1091908037 12:4205284-4205306 GAACAAGGAGCTGACAGAGGTGG + Intergenic
1093990725 12:25587082-25587104 GAAGAAGGAGCCATCCAAGATGG - Intronic
1094041137 12:26122698-26122720 CAAGCAGGAGCCTCCCGGGGAGG - Exonic
1095956470 12:47809177-47809199 GGAGAAGGAGCCGCCCCTAGAGG - Intronic
1096886192 12:54721481-54721503 GAAGGAGGAGGCGGCGGAGGAGG - Intergenic
1100372169 12:93978446-93978468 GAAGAAAGAGCCGGGCGCGGTGG - Intergenic
1101032156 12:100671398-100671420 TAAGAAGTAGCCACCCCAGGTGG + Intergenic
1102152520 12:110698681-110698703 GAGGAAGGAGACGCAGGAGGAGG - Intronic
1104359631 12:128120645-128120667 GAAGGAGAAGCCGCTGGAGGTGG - Intergenic
1104893796 12:132152299-132152321 GAAGAAGAAGGGGCCCGAGCCGG + Exonic
1105472467 13:20705126-20705148 GCAGGAGGAGCTGCCCTAGGGGG + Intronic
1105943562 13:25171241-25171263 GAAGGAGGAGCCGCGCGGCGGGG - Exonic
1106546973 13:30739095-30739117 GAAGAAGCAGCCGGTGGAGGCGG - Intronic
1107020367 13:35744913-35744935 CAAGAAGGAGACGAGCGAGGGGG + Intergenic
1107603974 13:42040651-42040673 GAAGGAGGAGGCGGCGGAGGAGG + Intronic
1115597190 14:34920740-34920762 GAAGAAGGAGGCGGCAGCGGTGG - Intergenic
1117315139 14:54566093-54566115 GAGGACTGAGCCGCCCGAGCCGG - Intergenic
1118717681 14:68571920-68571942 GAAGAAGGAGCTACAAGAGGCGG + Intronic
1118766760 14:68915241-68915263 GAAGAAGGAGCAGGGGGAGGAGG - Intronic
1120397665 14:83988394-83988416 GAAGAAGGAGCACCCCCAGGAGG - Intergenic
1120403238 14:84060120-84060142 GAAGGAGGAGCAGCAGGAGGAGG + Intergenic
1122094534 14:99361565-99361587 GAAGAAGGGGACGGCCGGGGAGG + Intergenic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1122600309 14:102918045-102918067 GAGGAAGGAGCCGCCACTGGGGG - Intergenic
1124884306 15:33670519-33670541 GAAGGAGCAGCCGACGGAGGAGG + Exonic
1126595768 15:50383100-50383122 GAAGAGGTAGCCGGGCGAGGTGG - Intergenic
1128474918 15:67989068-67989090 GAAAAAGGAGATGCCCGAGGTGG - Intergenic
1129691834 15:77718144-77718166 GAAGAAGGTGGCTCCCTAGGTGG - Intronic
1136069964 16:27781811-27781833 GAAGACCGAGCCGGGCGAGGTGG - Intergenic
1137978824 16:53053177-53053199 GAAGAAGGAGCAGAAGGAGGAGG - Intergenic
1141158844 16:81616009-81616031 GCAGAAGGAGCCGGGCGCGGTGG + Intronic
1142009085 16:87704591-87704613 GGAGAAGGAGGCGCCTGGGGAGG + Intronic
1144494873 17:15739727-15739749 GATGAAGGAGCCGCTCTGGGAGG + Intronic
1144560339 17:16315981-16316003 GAAAAAGGAGCCGGGCGCGGTGG - Intronic
1144905382 17:18636945-18636967 GATGAAGGAGCCGCTCTGGGAGG - Intronic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146842642 17:36166407-36166429 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146854954 17:36254366-36254388 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146865666 17:36334010-36334032 GAAGAACGAGGTGCCCGTGGCGG - Exonic
1146870854 17:36378258-36378280 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146878213 17:36429340-36429362 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146882162 17:36450486-36450508 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147068535 17:37934622-37934644 GAAGAACGAGGTGCCCGTGGCGG - Exonic
1147073738 17:37978882-37978904 GAAGAACGAGGTGCCCGTGGCGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147080058 17:38014159-38014181 GAAGAACGAGGTGCCCGTGGCGG - Intronic
1147085259 17:38058420-38058442 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147096007 17:38138119-38138141 GAAGAACGAGGTGCCCGTGGCGG - Intergenic
1147101206 17:38182386-38182408 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147952854 17:44116642-44116664 GTGGAAGGAGACACCCGAGGAGG + Intronic
1149330401 17:55575650-55575672 GAGGAAGGAGACACCAGAGGGGG + Intergenic
1149634678 17:58157160-58157182 GGACAAGAAGCCGCCCAAGGAGG + Intergenic
1149845804 17:60008892-60008914 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150084152 17:62265472-62265494 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1150419264 17:65016511-65016533 AAAGAAGTAGCCGGCCGTGGTGG - Intronic
1151612109 17:75182925-75182947 GAAGAAGGAGGCGGCAGCGGTGG + Intergenic
1151703949 17:75757139-75757161 GAAGGAGGCACGGCCCGAGGAGG - Intronic
1151980660 17:77506590-77506612 CAAGAAGGAGCCCCCCGGGGCGG + Intergenic
1152596337 17:81239480-81239502 GCAGGAGGAGCCGCGCGGGGAGG + Intronic
1153308337 18:3652970-3652992 GAAGGAGGGGCCACCCGAGCTGG - Intronic
1154134716 18:11766061-11766083 GTAGAAGGAGCAGAGCGAGGAGG + Intronic
1154231386 18:12559139-12559161 GCAGATGGAGCCTCCCCAGGGGG - Intronic
1156291824 18:35754534-35754556 GATGAAGGAGCTGGCTGAGGTGG + Intergenic
1157977083 18:52340031-52340053 GAAAAAAGAGCGGACCGAGGAGG - Intergenic
1158411005 18:57206149-57206171 GAAGAAAGAGCTGCCCGATCAGG - Intergenic
1160543523 18:79638315-79638337 GCAGAAGGAGCCGCTCCCGGGGG + Intergenic
1160809919 19:1008898-1008920 GAAGGAGGAGACGGCAGAGGCGG + Exonic
1161042744 19:2118687-2118709 GCAGAAGGAGCAGGCCGGGGAGG - Exonic
1161590872 19:5128638-5128660 GAAGCTGGAGCAGCCCGGGGAGG - Intronic
1161795018 19:6381419-6381441 GGAGGAGAAGCCGCCTGAGGAGG - Exonic
1162049662 19:8025285-8025307 GAAGAAGGGGCCGGGCGCGGTGG - Intronic
1162905866 19:13823535-13823557 GAAGAAGGAGATGACAGAGGAGG - Intronic
1163469440 19:17487919-17487941 GGAGCAGGAGGAGCCCGAGGAGG - Intronic
1163693332 19:18749550-18749572 CAAAAAGCAGCCGCGCGAGGTGG - Intronic
1164655114 19:29915389-29915411 AAAGAAGGAGCAGCCTCAGGTGG + Intergenic
1164872995 19:31662223-31662245 CAAAAATGAGCCGCCCGTGGTGG + Intergenic
1165080060 19:33301913-33301935 CAAGCAGGAGCCCCGCGAGGAGG - Exonic
1165511477 19:36268930-36268952 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165512025 19:36271453-36271475 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165512573 19:36273952-36273974 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165513124 19:36276495-36276517 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165513679 19:36279048-36279070 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165514228 19:36281582-36281604 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165514782 19:36284121-36284143 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165515334 19:36286652-36286674 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165515884 19:36289190-36289212 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165516435 19:36291725-36291747 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165516987 19:36294253-36294275 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165517540 19:36296776-36296798 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165518092 19:36299311-36299333 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165518643 19:36301846-36301868 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165519191 19:36304376-36304398 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165519740 19:36306891-36306913 GGCGAAGGCGCAGCCCGAGGCGG - Intergenic
1165637406 19:37353159-37353181 GAAAAAGGAGCCGGGCGCGGTGG - Intronic
1167625085 19:50582735-50582757 GAAAAGGGAGCCGCATGAGGTGG + Intergenic
1168317198 19:55489504-55489526 GAAGAAGGCGCCTCCCGGGGCGG - Exonic
1168724334 19:58572553-58572575 GCAGAAGGAACAGCGCGAGGAGG - Intronic
924998849 2:388020-388042 GAAGAAGGAGCTGCAAGAGGTGG - Intergenic
925971136 2:9107436-9107458 GAAGAAGGATGGGCCCAAGGAGG + Intergenic
930364624 2:50424116-50424138 GAAGAAGGAGGCGGAGGAGGAGG + Intronic
930561654 2:52967141-52967163 AAAGAACGAGCGGCCCGACGCGG + Intergenic
934724786 2:96608956-96608978 GAAGAAGAAGCCCCGCGATGTGG - Exonic
946173006 2:217906363-217906385 GGAGAAGGAGCCTCCCGGGGTGG - Exonic
946306627 2:218860058-218860080 GCAGCAGCAGCAGCCCGAGGCGG - Exonic
946322022 2:218959895-218959917 GAAGAAGGCGCCGCCCGCGGGGG + Exonic
1169781170 20:9312220-9312242 GAAGAAGGGGTAGCCCGAGCTGG - Intronic
1172061453 20:32189924-32189946 CAAGAAGGAGCCAGCGGAGGAGG - Intergenic
1172629510 20:36368468-36368490 GAACAAGGAGCTGCCCGCTGGGG + Intronic
1173166672 20:40690742-40690764 GAAGAAGGTGACGCGGGAGGCGG - Intergenic
1174399176 20:50266859-50266881 TAAGCAGGAGATGCCCGAGGCGG + Intergenic
1175073394 20:56353620-56353642 GAAGCAGGAGCAGCAGGAGGGGG - Intergenic
1175164792 20:57035833-57035855 AGAGAAGGAGCAGCCCGGGGAGG - Intergenic
1175315519 20:58044151-58044173 GAAGAAAGAGCCATCTGAGGAGG + Intergenic
1176112872 20:63418473-63418495 GATGAAGGGGCCTCCCGTGGGGG + Intronic
1179541963 21:42088775-42088797 GAAGGAGAAGCCTGCCGAGGGGG - Intronic
1179586186 21:42375455-42375477 GAAGAAGGAGCCTCACGACATGG - Intronic
1179882143 21:44297318-44297340 CCTGAAGGAGCCACCCGAGGAGG + Intronic
1180631652 22:17234160-17234182 GAGGAAGGAGACTCCAGAGGAGG + Intergenic
1182098571 22:27642187-27642209 GAGGAAGGAGCCGCCTGCTGGGG - Intergenic
1183398963 22:37589901-37589923 GCAGGAGGAGCTGGCCGAGGGGG - Intergenic
1184256200 22:43288486-43288508 GAAGCGGGAGGAGCCCGAGGCGG - Intronic
1185070163 22:48651730-48651752 GAAGAAGGGGCACCACGAGGGGG + Intronic
953568140 3:44050874-44050896 GAAGAAGAAGCCGGGAGAGGAGG + Intergenic
954339293 3:49940190-49940212 GAAGGAGGAGCGGGCCGTGGAGG + Exonic
963439892 3:145325769-145325791 GAAGAAGGAGCAGGAAGAGGAGG + Intergenic
968025857 3:195442424-195442446 GAAGGAAGAGCAGCCAGAGGAGG + Intronic
968534039 4:1112858-1112880 GAGGAAGGGGACGCCAGAGGAGG - Intronic
968965491 4:3767244-3767266 GAAGAAGGAGCCGATGCAGGAGG - Exonic
969360508 4:6660430-6660452 GAAGAAGGAGGAGGCGGAGGAGG + Intergenic
976391051 4:84503921-84503943 GAATAAGGAGCTGCACAAGGAGG - Intergenic
978387430 4:108190241-108190263 GGAGAAGGAGCAGACAGAGGAGG - Intergenic
979198654 4:117950472-117950494 GAAGAAAGAGTCCGCCGAGGCGG + Intergenic
984799400 4:183699752-183699774 GAGGAAGGAGCCACATGAGGAGG - Intronic
985639555 5:1057319-1057341 GAACAGGGAGCCGCCTGAGTGGG - Intronic
987474526 5:18374565-18374587 GATGAAGGAGCCGGGCGCGGTGG - Intergenic
987700934 5:21397294-21397316 GAAGAAGGAGGAGGACGAGGAGG + Intergenic
988255778 5:28818418-28818440 GAAGAAGGAGGAGGCGGAGGAGG + Intergenic
988255790 5:28818457-28818479 GAAGAAGGAGGAGGCGGAGGAGG + Intergenic
988632073 5:32942296-32942318 GAAGAAGGAGGAGGACGAGGGGG + Intergenic
992796545 5:80258873-80258895 AAAGAAGTAGCCGGGCGAGGTGG + Intergenic
996624435 5:125553018-125553040 GAAGAAGGAGCAGCTAGAAGAGG - Intergenic
997347062 5:133199653-133199675 GAAGAAGTAGCCGCCCAGGTGGG + Exonic
997388888 5:133497193-133497215 GAAGAAGGAGCCTTCCCTGGAGG + Intronic
997416555 5:133732827-133732849 GATGAAGGGGCCACCTGAGGTGG + Intergenic
998219336 5:140263732-140263754 GTAGAAGGAGCCGGGCGTGGTGG + Intronic
1001027447 5:168236184-168236206 CAAGAAGGAGGCTCCCGATGAGG - Intronic
1002586722 5:180253254-180253276 GAAGGGGGAGCAGCCAGAGGAGG - Intronic
1003682362 6:8268709-8268731 CAAGAAGGACCCGCCGGAGCTGG + Intergenic
1003901431 6:10659293-10659315 GAAGGAGGGGCCGGGCGAGGTGG + Intergenic
1005640455 6:27791565-27791587 GAAGAAACAGAAGCCCGAGGGGG - Intergenic
1006091431 6:31631316-31631338 CAAGAAGGAGCCCCCTAAGGAGG + Exonic
1006950740 6:37819684-37819706 GAAGAAGGAGGGAGCCGAGGAGG - Exonic
1007339933 6:41184951-41184973 GAATAAGGACCCGCCTGATGAGG + Intergenic
1007425364 6:41742994-41743016 GAAGAAGGAGACGGGTGAGGAGG - Intronic
1008886231 6:56433402-56433424 GAAGAAGGCGGCGGCGGAGGCGG - Intergenic
1011643185 6:89433574-89433596 GAAGAGGGAGGCGCCCCGGGGGG - Intronic
1015705546 6:136083784-136083806 GAAGAAGGAGCAGAGAGAGGAGG - Intronic
1015786552 6:136924444-136924466 GATGGAGGAGCTGCCCGGGGAGG + Exonic
1018704768 6:166455700-166455722 GCACACGGAGCCGCTCGAGGAGG + Intronic
1019527124 7:1485403-1485425 GGAGAAGGAGCCCCCCATGGAGG - Exonic
1021106633 7:16645828-16645850 GGAGGAGGAGCCGCAGGAGGCGG + Intergenic
1023703139 7:42912046-42912068 GATGCAGGAGGTGCCCGAGGCGG - Exonic
1029365218 7:100112224-100112246 GAAGAAGGCGCCGCCCTTGCTGG - Exonic
1034457332 7:151177958-151177980 TAAGAAGGAGCCGGGCGTGGCGG + Intronic
1035722005 8:1799177-1799199 GAAGAAGGAGGAGCAGGAGGAGG - Intergenic
1036651514 8:10646969-10646991 GAAGAAAGCCTCGCCCGAGGCGG + Intronic
1036659823 8:10700750-10700772 GAAGATGGAGCCACCCATGGGGG + Intronic
1037829153 8:22177871-22177893 GAAGATGGAGCCTCAGGAGGTGG + Exonic
1038330360 8:26603456-26603478 GAAGAAAGAGCCGGGCGCGGTGG - Intronic
1039684143 8:39778663-39778685 GAAGAAGGAGGAGGACGAGGAGG + Intronic
1039914727 8:41851521-41851543 GAAGGAGCAGCCTCCAGAGGTGG - Intronic
1040079741 8:43274795-43274817 GAAGAAGGAGGAGCACAAGGAGG - Intergenic
1041104482 8:54427845-54427867 GAAGGAGGAGCCGACAGTGGAGG - Intergenic
1042221238 8:66476856-66476878 GAAGAAGCAGCAACCCCAGGTGG + Intronic
1048261099 8:132945723-132945745 AGAGAAGGAGCAGCCAGAGGGGG + Intronic
1048380676 8:133862397-133862419 CAGGAAGGAGCCGACAGAGGTGG + Intergenic
1048664290 8:136643595-136643617 GAAGAAGAAGCCACCTGAGAGGG - Intergenic
1049098069 8:140560483-140560505 GAAGAAGGAGCGGCCCACGGGGG + Exonic
1049313676 8:141947457-141947479 GAAGAAGCAGCCAACCAAGGGGG - Intergenic
1050137299 9:2479876-2479898 GAAGAAGCAGCAGCAGGAGGAGG + Intergenic
1051954508 9:22674590-22674612 GAAGAAGGAGCAGGAGGAGGAGG + Intergenic
1053669833 9:40348688-40348710 GAGGAAGGAGCGGGCCGTGGTGG + Intergenic
1054514779 9:66027608-66027630 GAGGAAGGAGCGGGCCGTGGTGG - Intergenic
1057217967 9:93239940-93239962 GGAGAAGGAGACGCCGGATGAGG + Exonic
1057272874 9:93660533-93660555 CAAGATGGAGCCGCCCAAGAAGG + Exonic
1057423043 9:94927529-94927551 GAAGGAGGAGTCGGCCGGGGAGG - Intronic
1059403414 9:114084964-114084986 GAGGAAGGAGCCAGCCGAGCTGG + Intergenic
1059889449 9:118785215-118785237 GAAGAAGGAGCCCCCACATGGGG - Intergenic
1061851470 9:133418361-133418383 GAGCAAGGAGCAGCCCAAGGCGG - Intronic
1061854939 9:133436899-133436921 GAAGGAGGCGCCGCCAGGGGAGG - Exonic
1185887115 X:3792717-3792739 GAAGAAGGAGCTGGAGGAGGAGG + Intergenic
1189433341 X:40969009-40969031 GAAGAAGGGGCCGGGCGTGGTGG - Intergenic
1190054887 X:47175712-47175734 GAAGACAGAGCTGCCTGAGGTGG - Intronic
1194666817 X:96685055-96685077 AAAGATGGAGCAGCCCGGGGCGG + Exonic
1194817557 X:98462858-98462880 GAAGAAGGAGAAGCCGGGGGTGG - Intergenic
1198321478 X:135521837-135521859 GAGGAAGGAGGGGCCAGAGGAGG - Intronic
1199045118 X:143161043-143161065 GAAGAAGAAACAGCCCAAGGAGG - Intergenic
1201300221 Y:12498674-12498696 GAAGAAGCAGCAGCAGGAGGAGG - Intergenic