ID: 1150286524

View in Genome Browser
Species Human (GRCh38)
Location 17:63957512-63957534
Sequence CCTCCCTGCTTGGCAGCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 387}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150286524_1150286532 -1 Left 1150286524 17:63957512-63957534 CCCGCAGCTGCCAAGCAGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 387
Right 1150286532 17:63957534-63957556 GGCAAGGGTGAATGAGGCCCAGG 0: 1
1: 0
2: 0
3: 26
4: 246
1150286524_1150286531 -7 Left 1150286524 17:63957512-63957534 CCCGCAGCTGCCAAGCAGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 387
Right 1150286531 17:63957528-63957550 AGGGAGGGCAAGGGTGAATGAGG 0: 1
1: 0
2: 4
3: 68
4: 683
1150286524_1150286534 14 Left 1150286524 17:63957512-63957534 CCCGCAGCTGCCAAGCAGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 387
Right 1150286534 17:63957549-63957571 GGCCCAGGGACCACCACCCAAGG 0: 1
1: 0
2: 1
3: 32
4: 309
1150286524_1150286533 0 Left 1150286524 17:63957512-63957534 CCCGCAGCTGCCAAGCAGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 387
Right 1150286533 17:63957535-63957557 GCAAGGGTGAATGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 219
1150286524_1150286540 30 Left 1150286524 17:63957512-63957534 CCCGCAGCTGCCAAGCAGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 387
Right 1150286540 17:63957565-63957587 CCCAAGGCAGCCCCAGCCTTAGG 0: 1
1: 0
2: 4
3: 50
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150286524 Original CRISPR CCTCCCTGCTTGGCAGCTGC GGG (reversed) Exonic
900101053 1:962274-962296 CCTCCCTCCTAGGCATCTTCAGG + Intronic
900120920 1:1048321-1048343 CCTGCCTGCCGGGCAGCTGCAGG - Exonic
900709926 1:4107301-4107323 CCTCCTTGGGAGGCAGCTGCTGG + Intergenic
900972373 1:5998675-5998697 GCTGCCTCCTTGGCAGCAGCTGG - Intronic
901452627 1:9345211-9345233 CCTGCCTTCTGGGGAGCTGCTGG + Intronic
901534043 1:9871262-9871284 CCTCGCTGGCTGTCAGCTGCAGG + Exonic
901868447 1:12123395-12123417 TCTCTCTGTTTGGCTGCTGCAGG + Intronic
901899702 1:12349219-12349241 CCTCACTTCTTGGCGGCTACAGG + Exonic
902171212 1:14612808-14612830 ATTCCCTGCTTGGGATCTGCTGG + Intronic
902565542 1:17308810-17308832 CCTCCTTGCTAGCCAGCAGCAGG - Intronic
902628807 1:17692616-17692638 CTTCCCACCTGGGCAGCTGCGGG + Intronic
903502138 1:23806519-23806541 CCTCCCTGCTAGGGATCCGCAGG + Intronic
904001603 1:27342008-27342030 CCTCCGTGTGGGGCAGCTGCTGG + Intronic
904260530 1:29285102-29285124 CCTCCCTGGATGGCAGCACCTGG - Intronic
904783902 1:32971252-32971274 CCTCGCTTCTTGGCAAATGCTGG + Intergenic
905928769 1:41771534-41771556 CCTCCTTGCTGGGCTGCCGCTGG + Intronic
906102565 1:43272624-43272646 GCCACCTGCTTGGCAGCTACAGG - Exonic
906196827 1:43934883-43934905 CCACCCTGCTTGGAATCTGCAGG + Intronic
906258264 1:44367191-44367213 CCTCCCTGCTTGTAAGCAGGAGG - Intergenic
907517893 1:55004882-55004904 CCTCCCTGCTTGACAGGAGAGGG - Intronic
910032707 1:82749769-82749791 CCTCCCTGCTTTGCTCATGCTGG + Intergenic
910665709 1:89724033-89724055 CCTCCCAGCATGACAGCTGCAGG + Intronic
912078840 1:105911170-105911192 CCTCCCTGCTTCATAGGTGCAGG + Intergenic
914755241 1:150558571-150558593 CCTCTCTGCTGGGGGGCTGCGGG - Exonic
914802589 1:150972302-150972324 CCTCCCTGCTGGGGAGATGGGGG - Intronic
917200326 1:172507986-172508008 CCTCCCAGCTAGGCAGTTACTGG + Intergenic
919453524 1:197798766-197798788 CCTCCCAGCTTGGAAACAGCAGG + Intergenic
919661114 1:200248716-200248738 CCTCCCTGCTTCACAGCTCCTGG + Intergenic
920698372 1:208199177-208199199 CCTCCCTGCTGGGCAGGTTCTGG + Intronic
922452799 1:225750452-225750474 TCTCCCTGCATGGAAGCTCCAGG - Intergenic
922460468 1:225811189-225811211 CCTCCCTCCCTGGCAGATGTCGG + Intronic
923135208 1:231111248-231111270 GCTTCCTGCTTGGCTTCTGCAGG - Intergenic
924229561 1:241952140-241952162 CCTCCCTTCATGCCAGCTCCTGG + Intergenic
924453369 1:244198903-244198925 GCTGTCTGCTGGGCAGCTGCTGG - Intergenic
924634555 1:245773548-245773570 CCTGCCTGCCTGGAAGATGCTGG - Intronic
1063068551 10:2635815-2635837 TCCTCCTGCTTGGCACCTGCAGG + Intergenic
1063092212 10:2875232-2875254 CCACCCTGCTTGGGACCTGATGG - Intergenic
1064697331 10:17981317-17981339 CTTCTCTGCTAGGCAGCTGGTGG + Exonic
1065315771 10:24462536-24462558 CCTCACTGCTTAGCAGCTATGGG + Intronic
1065784018 10:29196377-29196399 CCTCTTTGCTTGGCAGGTCCTGG - Intergenic
1066185409 10:33005717-33005739 CCTCCGGGCTTGGGGGCTGCAGG + Intronic
1067142061 10:43666508-43666530 CCTCCCAGCTTGGCAGCAGGAGG - Intergenic
1067415590 10:46099236-46099258 CCTCCCAGCATGGCAGCTTCAGG + Intergenic
1067435642 10:46274338-46274360 CCTCCCAGCATGGCAGCTTCAGG + Intergenic
1067437121 10:46286331-46286353 CCTCCCAGCATGGCAGCTTCAGG - Intronic
1069708917 10:70476847-70476869 CCTCCCTGCCCAGCAGATGCTGG - Intergenic
1069792137 10:71029705-71029727 CCACCCAGCCAGGCAGCTGCAGG + Intergenic
1070562503 10:77578502-77578524 CCTCCCTCGTTGGGGGCTGCAGG - Intronic
1071477433 10:86036680-86036702 CCTTCCTGCTTATCAGCTGGTGG - Intronic
1071590535 10:86868572-86868594 CCTCCCCGCCAGGCAGCTCCAGG - Intronic
1072416305 10:95249478-95249500 CCTCCCAGCTTTACAGATGCAGG + Intronic
1072573776 10:96681117-96681139 CCTCCCTGCTTGGTTGCAGATGG + Intronic
1073012283 10:100370856-100370878 CCTCCCTGGGTGGCAGTGGCAGG + Intergenic
1073117157 10:101097691-101097713 CCTTCCTTCTTCCCAGCTGCTGG + Intronic
1073305055 10:102496378-102496400 CATTCCTGCTTGGCCTCTGCAGG + Intronic
1074432713 10:113407397-113407419 CCTCCCTGCCTGGGGACTGCAGG + Intergenic
1074857340 10:117483160-117483182 CCTCCCTGTCTTGCAGCTGTCGG - Intergenic
1075579267 10:123604492-123604514 CCTCACTGCTTGTCTGCCGCTGG + Intergenic
1075676151 10:124296958-124296980 CCTCCCAGCATGGCAGCCTCAGG + Intergenic
1076208701 10:128623613-128623635 CCTCCCTGTTTGCCAGTGGCTGG + Intergenic
1076919260 10:133442788-133442810 GCTCCATACTTGGCAGCAGCTGG - Intergenic
1077068651 11:657054-657076 CGTCCCTGCTCTGCAGCTGAGGG + Intronic
1077252581 11:1567141-1567163 CCTGACTGCCTGGCAGCTGTGGG - Intronic
1077297952 11:1834825-1834847 CCTGCCTGCTTGGCTGGGGCTGG + Intronic
1077351273 11:2094340-2094362 CCTCCATGCCTGGCAGCTCGGGG - Intergenic
1078335446 11:10459526-10459548 TCTCCCTGCTGGACAGCAGCAGG + Intronic
1078354394 11:10623368-10623390 CTGCCCTGCTGGGTAGCTGCAGG - Intronic
1078508307 11:11967926-11967948 TCTCCCTGCCTGGGGGCTGCCGG + Intronic
1079898102 11:26148310-26148332 CCTCCCTGCTTCACAGGTGCAGG - Intergenic
1080643710 11:34173433-34173455 GCTCCCTGCTGGGCAGCAGAGGG + Intronic
1083263010 11:61533218-61533240 CCGCCGGGCATGGCAGCTGCTGG - Intronic
1083267062 11:61551635-61551657 GCTCCCCGGTTGGCAGCTCCTGG + Intronic
1083365635 11:62140101-62140123 GCTCCCTTCCTGGCAGCTCCGGG - Intronic
1083571135 11:63762925-63762947 GCTCCCGGCTTGGGGGCTGCTGG - Exonic
1083607280 11:63986567-63986589 CCTCCCTCCTCGGGAGCAGCTGG - Intronic
1084040875 11:66542016-66542038 CCTCCCTGCTTGGAGGCCTCAGG - Intronic
1084272284 11:68035712-68035734 CTTGCCTGTTTGTCAGCTGCTGG - Intronic
1084460355 11:69293575-69293597 CCTCACAGCTGGGCAGCTGGGGG - Intergenic
1084737264 11:71113616-71113638 CCTCCCAGCTTCTCACCTGCAGG - Intronic
1084962757 11:72725948-72725970 CCTCCCTTCCTGCCATCTGCTGG - Intronic
1089167203 11:116486354-116486376 CCCCCTTGGTTGGCAGCTGCAGG + Intergenic
1089384941 11:118061207-118061229 CCTCCCTTCTTGGAAGAGGCGGG - Intergenic
1090441003 11:126725693-126725715 CCTCGCTGCAAGGCTGCTGCTGG + Intronic
1090926893 11:131257754-131257776 CTTCCCGGCTTAGCAGCTGAAGG - Intergenic
1091056139 11:132420809-132420831 CCTCCTTCCTTAGCTGCTGCAGG - Intronic
1091287288 11:134414693-134414715 TCTTCCTGCTTGGCCTCTGCAGG + Intergenic
1091448741 12:559780-559802 GCTCCCCGCTCGGCAGCTGACGG - Intronic
1091476088 12:774255-774277 TCACCCTCCTTGGGAGCTGCAGG - Intronic
1091929358 12:4382559-4382581 CCATCATGCTTGGCAGGTGCTGG - Intergenic
1092154497 12:6273698-6273720 ACTCCCTGCTGGGCTGCTGGTGG - Intergenic
1092822545 12:12366039-12366061 TCTGCCTGCTGGGCTGCTGCAGG + Intronic
1093978898 12:25453208-25453230 CCTCTCTGCAGGGCAGCTGCTGG - Intronic
1095976559 12:47944067-47944089 GCTCCCTGCTTCCCAGCTCCTGG - Intergenic
1096557941 12:52415229-52415251 CCTCCCTGCTGGGCCGCCTCTGG + Intergenic
1096620043 12:52858757-52858779 CCTGCCTGCTGGGCTGCAGCAGG + Intergenic
1096775455 12:53961006-53961028 CCTCTCTGCATGGCACCTGGAGG + Intergenic
1101552293 12:105773996-105774018 CCACCCCACTGGGCAGCTGCTGG + Intergenic
1101831734 12:108263175-108263197 CCTCCCTGCAGGGCAGCTGTAGG + Intergenic
1101877246 12:108603889-108603911 CCTCCCTGCATGCCAGCCTCTGG + Intergenic
1102787953 12:115619485-115619507 CCTGTCTGCATTGCAGCTGCTGG - Intergenic
1103968237 12:124653445-124653467 CCTCCCTGCTGGGTCGCTGCAGG + Intergenic
1104735004 12:131131193-131131215 CCTCCTTGCTGGGAAACTGCTGG - Intronic
1104918250 12:132277614-132277636 CCTCACAGCCTGGCAGCTCCAGG + Intronic
1105593916 13:21818181-21818203 CCTCCCTGCGGGGCAGGGGCTGG + Intergenic
1112585446 13:100715262-100715284 CCTGCCTCCTTTGCAGCTGGAGG - Intergenic
1113205021 13:107907283-107907305 CCTCTCGGCTGGGGAGCTGCAGG - Intergenic
1113364491 13:109663559-109663581 CCTCCTGGGTTGGCAGCTGATGG - Intergenic
1113527402 13:110991831-110991853 CATCCATGCTTGGCTGATGCTGG - Intergenic
1113664529 13:112132011-112132033 CCTCCCTGCGTGAGAGCTGCCGG - Intergenic
1113799023 13:113077072-113077094 CCTCCATGCTTGCCTGCTTCTGG - Exonic
1113954562 13:114090482-114090504 CCTCCCTGCGTGGCAGCAAAAGG + Intronic
1114160837 14:20165303-20165325 CATGTCTGCTTGGCAGTTGCAGG + Intergenic
1116617362 14:47155541-47155563 GCTCCCTGCTAGGCCGCAGCTGG - Intronic
1121087091 14:91154972-91154994 CCTCCCTGCCTTGCTCCTGCTGG + Intronic
1121187053 14:91982709-91982731 CATTCCTGCATGGCAGCAGCTGG + Intronic
1121332347 14:93057673-93057695 CCTCCCTGCATGGCCTCGGCCGG - Intronic
1121660972 14:95634846-95634868 ACTCCCTGCTGGGCTGCTTCTGG + Intergenic
1121719135 14:96097141-96097163 CCTCCCTGTGTGGCTCCTGCAGG + Intergenic
1122176697 14:99926026-99926048 CCTCACTCCTTCGCAGCAGCTGG - Intronic
1122609486 14:102971996-102972018 CCTCCTTGTCTCGCAGCTGCCGG + Exonic
1122742764 14:103881565-103881587 CCTCCCTGTCTGAAAGCTGCTGG - Intergenic
1122855014 14:104555896-104555918 CCTGCCTGCTGTGCAGCTGTGGG + Intronic
1123999154 15:25740473-25740495 CCTGCCTGGCTGGCAGGTGCTGG - Intronic
1124636121 15:31366184-31366206 CCCCTCTGCTTGGCACCTGTAGG + Intronic
1124686649 15:31788656-31788678 CATCACTGGGTGGCAGCTGCAGG + Intronic
1125086872 15:35740348-35740370 CCTCCATGCTTGGGAACTGATGG - Intergenic
1125593607 15:40870978-40871000 CACACCTGCTAGGCAGCTGCTGG - Intergenic
1125735165 15:41919705-41919727 GCTCTCTCCCTGGCAGCTGCTGG - Intronic
1126371609 15:47953039-47953061 CCTCCCCTCTTGGCAACTTCAGG - Intergenic
1126943416 15:53791091-53791113 CTTTCCAGCTTGGCAGCTTCAGG + Intergenic
1127023811 15:54781332-54781354 CCTCCCAGACGGGCAGCTGCCGG + Intergenic
1127426700 15:58865251-58865273 CCTCCCAGCTTAGCGGCTGACGG - Intronic
1128223207 15:65982924-65982946 CCTCTCTTCTTGGGACCTGCGGG + Intronic
1128572181 15:68741791-68741813 CCTCCCTGGTGGTCAGCTGGGGG - Intergenic
1129189309 15:73927986-73928008 GCTCCGTGCTTAGCAGCTCCGGG - Intronic
1131112927 15:89776682-89776704 CCTCCCTCCTTGGCGCCGGCCGG + Exonic
1131215875 15:90534816-90534838 ATTCCCTGCTTGGCAGCTGTAGG + Intronic
1132315983 15:100890958-100890980 AGTCCCTGAGTGGCAGCTGCTGG + Intronic
1132826214 16:1906987-1907009 CCTCCCTGCATAGCTTCTGCAGG + Intergenic
1132845494 16:1999211-1999233 CTTCCCTGCAGGGCAGGTGCAGG + Intronic
1133255676 16:4514347-4514369 CTTCCCTGTTTGGAAGCTGAAGG + Intronic
1134096300 16:11421057-11421079 CCTGCCTGCTAGGCCTCTGCTGG + Intronic
1134100854 16:11450376-11450398 CATCCCTGCTCGGCAGATGACGG - Intronic
1134537782 16:15040577-15040599 CCTCCCTGCTTGGCAGCCCCAGG - Intronic
1135518689 16:23156729-23156751 CTTCCCTACTTTCCAGCTGCTGG - Intergenic
1136508915 16:30723892-30723914 CCTCCCTCCTTGGCACCATCTGG + Exonic
1136540240 16:30924413-30924435 TCTCCCTTCTCGGCAGCTCCCGG - Intronic
1136682433 16:31976099-31976121 CCTCCCTTCTAGGCAGGGGCAGG - Intergenic
1136782692 16:32917267-32917289 CCTCCCTTCTAGGCAGGGGCCGG - Intergenic
1136887104 16:33936583-33936605 CCTCCCTTCTAGGCAGGGGCAGG + Intergenic
1136924508 16:34359551-34359573 TCTCCCTGCCTGCCAGCTGCAGG + Intergenic
1136980065 16:35052255-35052277 TCTCCCTGCCTGCCAGCTGCAGG - Intergenic
1138351681 16:56349308-56349330 GCTCTCTGTTAGGCAGCTGCAGG + Intronic
1138573388 16:57890707-57890729 GCTCCCTGCTTTGCAGATGGGGG - Intronic
1139051529 16:63129962-63129984 GCCCCCTGCTCCGCAGCTGCCGG + Intergenic
1139631635 16:68235213-68235235 TCGGCCTGCTTGGGAGCTGCTGG - Intronic
1139655619 16:68385508-68385530 CCTCCCTCCCTGCGAGCTGCTGG + Intronic
1141622123 16:85241904-85241926 CCTCCCTTCATGGTGGCTGCCGG + Intergenic
1142108127 16:88317183-88317205 CCACCCTGCCTGACAGCTGAGGG - Intergenic
1142135210 16:88448803-88448825 CTTCCCTGCTTTGCTGCTTCAGG + Intergenic
1142265146 16:89061030-89061052 CCGCCCAGCTGGGCTGCTGCTGG - Intergenic
1142291531 16:89195581-89195603 CCACCCTGCTTGGCTGGGGCAGG + Intergenic
1142474677 17:181693-181715 TCACCCTGCTTGGTTGCTGCCGG - Intergenic
1142495727 17:305377-305399 GGTGCCTGCCTGGCAGCTGCGGG + Intronic
1143544682 17:7589143-7589165 CCTACCTGCCTGGCAGCTATGGG - Exonic
1144993650 17:19251328-19251350 CCTCCAGGCTTGGGAGCTGAAGG - Intronic
1145260738 17:21352920-21352942 TCTCCCTGTTTGGCCTCTGCAGG + Intergenic
1146093418 17:29905380-29905402 CCTCCCTGCTGGGCAAGTGATGG - Intronic
1146185220 17:30720165-30720187 TCTCCCTTCTTGGCAGCAGCCGG - Intergenic
1147138432 17:38448162-38448184 CCTCCCTGCTTGGGAGGAACTGG + Intronic
1147142954 17:38469437-38469459 CCTCCCTTCTGGGCAGGGGCAGG - Intronic
1147166105 17:38594240-38594262 CCCCCATCCTTGGCTGCTGCCGG - Intronic
1147911219 17:43857383-43857405 CCACCCTGCCTGGCACCTGGCGG - Intronic
1148054642 17:44786851-44786873 CCTGCCCGCTTGGCAGCCTCAGG + Intergenic
1148148377 17:45380391-45380413 CCTCCCTGCCAGGAAGCTGCAGG + Intergenic
1148581990 17:48750526-48750548 CCTTCCATCTTGGAAGCTGCTGG - Intergenic
1150286524 17:63957512-63957534 CCTCCCTGCTTGGCAGCTGCGGG - Exonic
1150617321 17:66782498-66782520 CCTCCCTCCTTCCCAGCTGCTGG - Intronic
1151402355 17:73864162-73864184 GCTCCCTGCTGGGCAGTGGCTGG + Intergenic
1151747450 17:76018994-76019016 CATCCCGGCTTCGCCGCTGCAGG + Exonic
1152214801 17:79025730-79025752 CCTCCCCGGTTGGCAGGTGCTGG - Intronic
1152535589 17:80948815-80948837 CCTCCCTGCCTGTCTGCTGGAGG + Intronic
1152635144 17:81427735-81427757 CCTCTCTGCGTGCCAGCCGCGGG - Intronic
1152684135 17:81685526-81685548 CACCCCAGCTTGGCAGCAGCTGG - Intronic
1153761180 18:8334135-8334157 GCTCCCTGCCAGGCAGGTGCTGG - Intronic
1154140643 18:11821695-11821717 CCTCCAAGCTGGGGAGCTGCGGG + Intronic
1154353254 18:13604889-13604911 CCTGCCTGCCTGGTGGCTGCTGG - Intronic
1158286761 18:55892705-55892727 CCTCCCAGCTAGGCTGCTGGGGG + Intergenic
1159880597 18:73855177-73855199 CCTGGCTGCCTGGCAGCTACTGG - Intergenic
1160073147 18:75645768-75645790 CCTGGCTGCTTGGGAGGTGCCGG - Intergenic
1160135243 18:76266052-76266074 CCGCCCTGCCTGAGAGCTGCTGG - Intergenic
1160549494 18:79684481-79684503 CCACCCTGCCTGGCTGGTGCTGG - Intronic
1161615272 19:5266737-5266759 CCTGCCTGCTTGCCCGCTGCTGG + Intronic
1161637897 19:5400729-5400751 CCTCTCTGCTTGGAAACTCCTGG - Intergenic
1161683934 19:5693979-5694001 CCTCTGTGGCTGGCAGCTGCTGG - Intronic
1161849811 19:6732442-6732464 CCACTCTGCTGGGCAGCTGGGGG - Intronic
1162307722 19:9885504-9885526 CCGCCGTGCTCAGCAGCTGCAGG - Intronic
1162381866 19:10335926-10335948 CCTGCCTCCTTGGCAGCCGGTGG - Exonic
1162421799 19:10569636-10569658 CCTTCCCACGTGGCAGCTGCAGG - Intergenic
1162973559 19:14195524-14195546 CCTCCCTTCCTGGCAGCAGCCGG + Intronic
1163321015 19:16574797-16574819 TCTCCCTGCATTGCAGCTGTTGG + Intronic
1163377873 19:16944804-16944826 CCTCCCTGCTGGGATCCTGCTGG - Intronic
1163609624 19:18294210-18294232 CCTCCCTGCTTAGGATCTGGAGG - Intergenic
1163834923 19:19567455-19567477 CCTCCCTACTTTGCAGTTGGAGG - Intronic
1164158717 19:22612403-22612425 CCTCCTTACTGGGCAGATGCTGG + Intergenic
1165310610 19:35027515-35027537 CCTCCCTGCTGGGTAGCCTCGGG - Intergenic
1167015452 19:46838334-46838356 CCTTCCTCCTAGGCAGCTGAGGG + Exonic
1167530895 19:50015731-50015753 CCTGCCAGCTTGGCACCTGCAGG - Intronic
1168353762 19:55690109-55690131 CCTCCCTGCTGGGCTGAGGCCGG + Intronic
1168412222 19:56147157-56147179 CCTCCCCGCTCTGCGGCTGCCGG - Exonic
925913159 2:8586544-8586566 GCCCCCTGCTTGGGAGCTCCTGG - Intergenic
926757088 2:16244898-16244920 CCTCCCAGCAAGGCAGCTGTGGG + Intergenic
927051269 2:19331654-19331676 ACTCCCTTATTGGCAGCAGCAGG - Intergenic
927755010 2:25701647-25701669 GGGCCCTGTTTGGCAGCTGCTGG - Intergenic
928987694 2:37196953-37196975 CCTCCCAGCTTAGCGTCTGCAGG - Intronic
929000804 2:37345145-37345167 CCTCCCGGCTCAGCAGCCGCCGG - Intronic
930152301 2:48070977-48070999 CCTCCCTACTCCGCAGCTCCTGG + Intergenic
930861639 2:56080300-56080322 ACTCCCTGCTTGCCAGTTGTTGG - Intergenic
932638307 2:73412946-73412968 CCTGCATTCTTGGCAGCTGTTGG + Intronic
932803537 2:74764098-74764120 CCTCCCTGCTGGGTAGCTCTGGG - Intergenic
932803571 2:74764259-74764281 CCTCCCTGCTGGGTAGCTCTGGG - Intergenic
932803886 2:74766770-74766792 CCTGCTTGCATGGCAGCTGAGGG - Intergenic
933365625 2:81349949-81349971 GCTCTCTGCTTGCCTGCTGCTGG - Intergenic
934746515 2:96762991-96763013 GCTCCCAGCTTGGGAGCTACAGG + Intronic
935658343 2:105443910-105443932 CCACCCAGCTTGACTGCTGCTGG + Intergenic
936143805 2:109965317-109965339 GCTCCCTGCTTGCTATCTGCTGG + Intergenic
936180487 2:110263280-110263302 GCTCCCTGCTTGCTATCTGCTGG + Intergenic
936200882 2:110406151-110406173 GCTCCCTGCTTGCTATCTGCTGG - Intronic
939358514 2:141136742-141136764 CCTCCCTAATTGGCAGTTTCAGG - Intronic
941517235 2:166494440-166494462 CCTCCCTTCCCGGCAGCTGCTGG - Intergenic
941918326 2:170826669-170826691 CCTTCCCTCTGGGCAGCTGCAGG - Intronic
943259714 2:185643649-185643671 CCTCCCACCTTTCCAGCTGCAGG + Intergenic
944270952 2:197785340-197785362 GCTCCCTGATTGGCTGCTGGCGG + Intronic
944666741 2:201965212-201965234 CCTCCCTGCCTAGCCGCTGGGGG - Intergenic
945213385 2:207407527-207407549 CATCCCTGCTTGGTAGCTTCCGG - Intergenic
946280052 2:218659947-218659969 CCTCCCTGCATGCCAGGCGCAGG + Exonic
946362603 2:219228467-219228489 CCTCGATGCTCTGCAGCTGCTGG + Exonic
946530832 2:220568596-220568618 CCTTCCTGCTCTGCAGCTGGTGG - Intergenic
948197670 2:236107374-236107396 CCTCCCTGCCGGGCTGCTGTGGG + Intronic
948217273 2:236240965-236240987 CCTCCCTGGCTGCCAGATGCAGG + Intronic
948353553 2:237360006-237360028 CCTCCCTCCCTGGCAGCATCTGG + Intronic
948738952 2:240030431-240030453 CCTCTGTGCTTGGGAGCTGCAGG + Exonic
948741027 2:240046074-240046096 CCTCTGTGCTTGGGAGCTGCAGG + Intergenic
1168788820 20:562504-562526 CCCTCCTGCTTGGTAGCTGTTGG + Intergenic
1168862620 20:1056756-1056778 CCTCCCACCTTGGCAACTGCAGG + Intergenic
1169135501 20:3194775-3194797 GCTCCCTGCCTGGCATGTGCAGG - Intronic
1169147704 20:3264280-3264302 CCTGCCTGTCCGGCAGCTGCTGG - Intronic
1169295503 20:4393901-4393923 CTTCCCTGCCTGGCAGCTGAGGG + Intergenic
1171361210 20:24587553-24587575 ACTCTCTCCTTGGCAGCTGCCGG - Intronic
1172948518 20:38706663-38706685 CCTCCCAGCTAGGCAACAGCAGG + Intergenic
1173000192 20:39099857-39099879 CCTACCTGCTTGGGGGCTCCAGG - Intergenic
1173906280 20:46632005-46632027 GCTCCCTGCTGGGCTGCAGCTGG + Intronic
1174123990 20:48289269-48289291 CCTCCCATCATGCCAGCTGCTGG - Intergenic
1174295481 20:49542367-49542389 CCCCCTGGCTTGGCAGCTGTAGG - Intronic
1174872988 20:54200810-54200832 TCTGCCTGATGGGCAGCTGCTGG - Intergenic
1175847833 20:62067903-62067925 CCGTCCAGCCTGGCAGCTGCAGG + Intergenic
1176304502 21:5116059-5116081 CCTCCCTGTGTGTCAGGTGCTGG - Intergenic
1176727386 21:10450381-10450403 ACTCCCTGAATGGCAGCTTCAGG - Intergenic
1178519850 21:33280136-33280158 CCTCCCTGAAGGGCAGCTGCAGG + Intronic
1178940686 21:36902536-36902558 CCACCCTGCTCCACAGCTGCAGG + Intronic
1179174262 21:38995956-38995978 CCTCCCTGCTTGCTTGCTTCAGG + Intergenic
1179852554 21:44145971-44145993 CCTCCCTGTGTGTCAGGTGCTGG + Intergenic
1180622020 22:17168727-17168749 CCTCCCTGCTTGGTACCTGGTGG + Intergenic
1180693696 22:17738693-17738715 CCTGCGTTCTAGGCAGCTGCTGG + Intronic
1180942176 22:19666539-19666561 CCCCCCAGCTTGGCGCCTGCAGG - Intergenic
1180965183 22:19784480-19784502 CCTCCCTGCGTGTTACCTGCAGG - Exonic
1180984314 22:19895476-19895498 GCTCCCTGATGGCCAGCTGCAGG - Exonic
1181166486 22:20986095-20986117 GTGCCCAGCTTGGCAGCTGCAGG - Intronic
1181496443 22:23289808-23289830 TCTCCCTGAGTGGCTGCTGCTGG + Intronic
1182012770 22:27014450-27014472 CTTCCCAGCATGGCAGCTTCAGG - Intergenic
1182081026 22:27528868-27528890 TTTCCCTGCTTGGCAGCTTATGG - Intergenic
1182352713 22:29707753-29707775 CCTCCTTCCCTGGCAGCAGCAGG - Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184038346 22:41929015-41929037 CCTTCCTGCCTGGGAGCTGCTGG - Intergenic
1184169894 22:42752569-42752591 CCTCCCTGCTGTCCAGCTGGGGG + Intergenic
1184216553 22:43071202-43071224 CCACCGTGCTTGGCAACGGCAGG + Intronic
1184806212 22:46796396-46796418 CCTCCTTGCTCAGCGGCTGCTGG + Intronic
1185383745 22:50522230-50522252 CCTCCCTCCTCTGCAGCTTCCGG - Exonic
952317755 3:32246347-32246369 CCTCCCTGCTGGGTCTCTGCTGG + Intronic
952753373 3:36843824-36843846 CCTCCCTGCTCGCCCTCTGCTGG + Intronic
952832465 3:37576581-37576603 CCTCCATGCTTGGCTGTGGCAGG - Intronic
953491338 3:43354519-43354541 CGTCCCTGCTGAGCAGCTGTAGG - Intronic
953757227 3:45657131-45657153 CCTCCCTGCTTCTCAGCACCAGG + Intronic
954369463 3:50162633-50162655 CCTCCCTCCGTGGCAGCAGCAGG + Intronic
954415719 3:50392375-50392397 CCTCCCTCCTTCCCAGCTGCTGG - Intronic
954700255 3:52447115-52447137 CCCCCCTGCTTGCCAGCTGCAGG + Intergenic
954775267 3:53011521-53011543 CCTTCCTGCTGGTCTGCTGCTGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955317154 3:57948442-57948464 CCTCCCTGCCTGCCAGCTTCAGG - Intergenic
957025815 3:75180427-75180449 CATACCTACTTGGCAGCTGGTGG + Intergenic
957624690 3:82642684-82642706 CCTCCCTGCTTCACAGGTGAAGG + Intergenic
960620257 3:119630338-119630360 CCTCCCTGCGGGGTTGCTGCTGG - Intergenic
961343461 3:126245897-126245919 CCTCCCTGCTTCACAGGTGCAGG - Intergenic
961383353 3:126510026-126510048 CCTCCGGGCCTGGCACCTGCTGG - Intronic
961386541 3:126526240-126526262 CCTCCCTGTGTGCCACCTGCAGG - Intronic
961726320 3:128933302-128933324 CATCCCTGATGGGCAGCTGGTGG - Intronic
961774266 3:129272725-129272747 CCTGCCTGCTTGTCCCCTGCAGG + Intronic
962452491 3:135532183-135532205 CCAGCCTGATTGGGAGCTGCTGG + Intergenic
963088548 3:141460935-141460957 CACCCCTGCTTCCCAGCTGCTGG + Intergenic
963913049 3:150831112-150831134 CTTCCTTCCTTTGCAGCTGCTGG + Intergenic
964484568 3:157174643-157174665 CCTCCCTGCTTGACCTCTGATGG - Intergenic
964771303 3:160226205-160226227 CCTCGTAGCTGGGCAGCTGCAGG - Exonic
965493324 3:169366728-169366750 CCTCACTGGTTGGCAGCCACAGG - Intronic
966940993 3:184746923-184746945 CCTCCCTGCTTGGCTGGGGCAGG + Intergenic
968144105 3:196283772-196283794 CTTATCTGCTTGGCAGCTTCTGG - Intronic
968156552 3:196385726-196385748 CCTCCCTGATGGGCGGCTGCCGG - Intronic
970262737 4:14245501-14245523 CCTTGCTGGTTGTCAGCTGCAGG - Intergenic
970959768 4:21857991-21858013 CCTCCCTGTGAGGCTGCTGCTGG - Intronic
971008325 4:22401425-22401447 ACTTACTGCTTGGCAGATGCTGG + Exonic
972651659 4:41023532-41023554 GCTCCCTGCTTGGCTGTTGTTGG - Intronic
973186859 4:47340196-47340218 CTTCCTTGCTTGGGTGCTGCAGG - Intronic
974052976 4:56958358-56958380 CCTCCATGTTAGTCAGCTGCAGG + Intergenic
974082591 4:57228183-57228205 CTTCCCAGCATGGCAGCTTCAGG - Intergenic
974877180 4:67714812-67714834 CCTCCCTATTTCCCAGCTGCTGG + Intergenic
977492946 4:97736931-97736953 CCTCCCTGTTAGGCTGCTGGGGG - Intronic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
981419958 4:144538059-144538081 CCTCCCTGCTTTGCAGCACTGGG + Intergenic
981529339 4:145736523-145736545 CCTCCCTGCTCCACAGCTGATGG - Intronic
981837833 4:149076226-149076248 CCTCCCTGCTAGGTTGCTGAGGG - Intergenic
982049827 4:151489591-151489613 CAGCCCTGCTTGCCAGCTGCTGG + Intronic
982779505 4:159476220-159476242 CCTCCCTTCTTGGAAAGTGCTGG + Intergenic
985208069 4:187561946-187561968 CCTCCATGCTTGCCATGTGCAGG - Intergenic
985498190 5:222881-222903 CTCCCCTGCCTGGCTGCTGCTGG - Intronic
986220039 5:5760584-5760606 CCTCACTGGTTGGCAGGTGGGGG - Intergenic
987299092 5:16581007-16581029 ACCACCTGCCTGGCAGCTGCAGG + Intronic
988681446 5:33488242-33488264 TCTCCCTGCTTGGGAAGTGCAGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989523073 5:42423722-42423744 GCGCCCTGCTTGGCAGCTCGCGG - Intergenic
991096666 5:62747046-62747068 CCTGCCTGCTTACCAGGTGCAGG + Intergenic
994107248 5:95961437-95961459 CTGCCCTGCCTGGCCGCTGCGGG + Intronic
999370093 5:151049646-151049668 CCTCCATGCTTAGAGGCTGCTGG - Intronic
1001562004 5:172675974-172675996 CCTCCTTCCTAGGCAGCTCCAGG + Intronic
1001781171 5:174370291-174370313 CCTCACGGCCTGGCATCTGCAGG + Intergenic
1001929917 5:175665499-175665521 CATCCCTGCTTGGCATCAGAGGG + Intronic
1001999712 5:176190956-176190978 CCTCCCTGCCCCCCAGCTGCTGG + Intergenic
1002095848 5:176830248-176830270 CCACCCTGCTTGGGAGCTCCTGG - Intronic
1002204683 5:177554344-177554366 CCTCCAGGCTTGGCGGCGGCGGG + Exonic
1002649491 5:180681156-180681178 CCTCCCTGCCCCCCAGCTGCTGG - Intergenic
1003280924 6:4690658-4690680 GCACCCTGCTTGGCAGGTGAAGG - Intergenic
1004838415 6:19555054-19555076 CCTGTCTGCTTGGCAGCCACAGG - Intergenic
1006397536 6:33796962-33796984 GCTCCCTGCTCACCAGCTGCTGG + Intronic
1007176909 6:39903312-39903334 CCTTCCTCCTTGGCACCTTCAGG - Exonic
1007241546 6:40430208-40430230 TCCCCTTACTTGGCAGCTGCTGG - Intronic
1007731737 6:43951604-43951626 CCCCTCTGCCTGGCTGCTGCAGG + Intergenic
1008626984 6:53326518-53326540 TTTCCCTGCTTGGGAGCTGCCGG - Intronic
1012393748 6:98772025-98772047 GCTCCCTGATTGGCAGGTGAGGG - Intergenic
1013369285 6:109455718-109455740 CCTCCCGGCTTCGGAGCCGCCGG - Exonic
1013452267 6:110295452-110295474 CCTCCCTGCCTGTCAGCTCAGGG - Intronic
1016398997 6:143657847-143657869 CTTCCCTGCCTGAAAGCTGCAGG - Intronic
1018974592 6:168555431-168555453 CTTCCCTGCTTGGCCCCTGGTGG - Intronic
1019271122 7:149833-149855 CCTCCCTGCCTGGCCTCGGCGGG + Intergenic
1019433631 7:1010952-1010974 CCTCCCTTCCTGGAAGCTCCCGG - Intronic
1019588698 7:1818166-1818188 CACCCCTGCCCGGCAGCTGCAGG - Intronic
1020567342 7:9814503-9814525 ACACCCTGCTTGCAAGCTGCTGG - Intergenic
1022340092 7:29459750-29459772 CCTCCCTGCATGGCAGGCTCAGG + Intronic
1022519217 7:30995116-30995138 CCTCCCAGCTGGGCGGCTGAAGG - Intergenic
1022606093 7:31815647-31815669 CCTGCCTGCCTGCCAGCTGGGGG - Intronic
1023237551 7:38106404-38106426 TATCCCTGCTTGGCCCCTGCAGG + Intergenic
1023879094 7:44308487-44308509 CTTCCCTGATTGGGAGCTGCTGG + Intronic
1024529616 7:50380480-50380502 CTTCCGTGCTGGGCAGGTGCTGG - Intronic
1025971093 7:66326029-66326051 CCTCCCTGATTGCAACCTGCTGG - Intronic
1026231892 7:68491097-68491119 CATCTCTGCTTTGCAGCTGTTGG - Intergenic
1028656415 7:93213086-93213108 CCGCCCTGCTTGGGAGCAGATGG + Intronic
1028785624 7:94789782-94789804 GCTCCCAGCTTGGCTGCTGTTGG + Intergenic
1029237399 7:99132352-99132374 CAACACTGCTTGGCACCTGCTGG - Intronic
1032194543 7:129781449-129781471 CCTCCCGGCTCGGCAGGAGCTGG - Intergenic
1032458015 7:132088178-132088200 TCTCCCTCCTTGACAGGTGCTGG + Intergenic
1032591095 7:133193191-133193213 GCTCCCTGCGAGGCTGCTGCTGG + Intergenic
1032804120 7:135338974-135338996 CCTCCCTGGGTGGTAGCTGGGGG - Intergenic
1033353810 7:140583503-140583525 CCTCGCTGGTTGGCACCTGTGGG + Intronic
1034602720 7:152277606-152277628 ACTCCCTGAATGGCAGCTTCAGG + Intronic
1034864342 7:154628052-154628074 CCTGCTTGCCTGGGAGCTGCAGG + Intronic
1035038001 7:155907958-155907980 CCCCTCTGCTTTGCAGCTCCTGG + Intergenic
1035549067 8:506300-506322 CCTCCCAGCTCGGCAGCGGGGGG + Intronic
1035654473 8:1295352-1295374 AGTCCCAGCGTGGCAGCTGCAGG + Intergenic
1036286688 8:7449082-7449104 CCTCCCTGCCAGGGTGCTGCAGG - Intronic
1036307320 8:7611633-7611655 CCTTCCTGCCTGGCAGCGGCGGG - Intergenic
1036334790 8:7862441-7862463 CCTCCCTGCCAGGGTGCTGCAGG + Intronic
1036358164 8:8059617-8059639 CCTTCCTGCCCGGCAGCGGCGGG - Intergenic
1036484094 8:9164103-9164125 CCTCCCCGAATGGCTGCTGCAGG + Intronic
1036802520 8:11802942-11802964 CCTCCCTGCTTGCCCGGGGCGGG + Intronic
1037801884 8:22040447-22040469 CCTTCCTGTTGGGCACCTGCAGG - Intergenic
1038625400 8:29187918-29187940 TCTCTCTGCTGGCCAGCTGCAGG + Intronic
1038927644 8:32158121-32158143 CCTCCCTGCCTGGCTGCAGTGGG + Intronic
1040445813 8:47492312-47492334 CCTGCCTGCTTGCCAGATACTGG - Intronic
1043854113 8:85245423-85245445 CCTCCCAGCCTGGCAGTTCCAGG + Intronic
1047727244 8:127694534-127694556 ACTCCCAGCTTAGCAGCTGTGGG + Intergenic
1048863996 8:138745988-138746010 CCTGCCTGCTTGCCTGCTGGAGG - Intronic
1048980078 8:139698521-139698543 CCACCCTGCTTAGCACATGCAGG - Intronic
1049212724 8:141394176-141394198 TCTCCCTGGTTGGCAGGTCCTGG + Intronic
1049283251 8:141761235-141761257 CCTTCCTCCTGGGCAGCTCCCGG + Intergenic
1049496667 8:142938871-142938893 CCGGGCTGCTTTGCAGCTGCAGG + Intergenic
1049685092 8:143936168-143936190 CTTCCCTGTTGGGAAGCTGCTGG + Intronic
1049693104 8:143971370-143971392 CCTCCATGGTAAGCAGCTGCGGG - Intronic
1050119669 9:2295535-2295557 CCTCTGTGCTTTGCAACTGCAGG + Intergenic
1050282552 9:4066303-4066325 CCTCCCTGCCTGGATGCTTCTGG - Intronic
1051425575 9:16928297-16928319 CCTCCCTGCAAGGCTGCAGCAGG - Intergenic
1052537514 9:29765971-29765993 ATTCCCTGCTTGGTTGCTGCTGG - Intergenic
1053163087 9:35827092-35827114 CCACCGTGCTTGGCCCCTGCTGG + Intronic
1055134901 9:72817380-72817402 CCTCCCTGCTTGGAAAATGTAGG - Intronic
1056114823 9:83431885-83431907 CATGCTTGCTTGCCAGCTGCTGG + Intronic
1056629713 9:88283162-88283184 CCACCCTGCTGAGAAGCTGCTGG + Intergenic
1057885754 9:98828268-98828290 CCTGGCTTCTTGTCAGCTGCAGG + Intronic
1058828354 9:108794478-108794500 CCTCCCTGCTTTACGGGTGCAGG + Intergenic
1058882496 9:109297661-109297683 CCTCGCTGCGTGGCAGCCCCTGG + Intronic
1059417354 9:114170167-114170189 CCTGCCTGCCTGGCACCTGCAGG + Intronic
1059771013 9:117425731-117425753 CCCACCTGCTGGCCAGCTGCTGG - Intergenic
1061404055 9:130383912-130383934 CCACCCAGCTTTGCAGCTGTGGG + Intronic
1061632707 9:131883290-131883312 GCTCCCTGCAGGGCAGCAGCCGG - Intronic
1062030083 9:134358301-134358323 CCTGCCTGCCTGCCTGCTGCCGG - Intronic
1062068318 9:134540730-134540752 CCTGCCTTCTTTGTAGCTGCTGG + Intergenic
1062114819 9:134802677-134802699 GCTCACTGCCTGGCATCTGCTGG - Intronic
1062206888 9:135342372-135342394 GCTCCCTCATTGGCACCTGCGGG + Intergenic
1062305941 9:135907256-135907278 CCTCCCGGCTGGCCGGCTGCGGG - Intergenic
1062519771 9:136952799-136952821 CCGCCCTCCCTGGCAGCTTCTGG - Intronic
1062580576 9:137227601-137227623 CCTCCTTGGTGGGCAGCTCCTGG - Exonic
1187527373 X:20066335-20066357 CCTCCCTCCTGGACAGCAGCAGG - Intronic
1189219334 X:39357693-39357715 CCTCACTTCTTAGAAGCTGCAGG - Intergenic
1189962111 X:46333679-46333701 GCTACCTGCTTCCCAGCTGCAGG - Intergenic
1189968976 X:46398896-46398918 CCTCCCTGGTTCTCAGCTGGGGG + Intergenic
1190342151 X:49305476-49305498 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190344402 X:49323815-49323837 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190345492 X:49333359-49333381 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190346594 X:49342925-49342947 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190347842 X:49533953-49533975 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190348943 X:49543509-49543531 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190350045 X:49553065-49553087 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190351148 X:49562618-49562640 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190352249 X:49572176-49572198 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1190353349 X:49581725-49581747 TCTCCCTTCTGAGCAGCTGCAGG - Exonic
1190355555 X:49600796-49600818 TCTCCCTCCTGAGCAGCTGCAGG - Exonic
1193650147 X:84122192-84122214 CCTCACTGCATGGCTGCTGCTGG - Intronic
1193768153 X:85557210-85557232 GCTCCCTGCTTGTCTGCTGTTGG + Intergenic
1196344649 X:114639464-114639486 CCTCCATGCTTGGAAAATGCAGG + Intronic
1197765684 X:130058200-130058222 CCATCCTGCTTTGCAGCTGTGGG + Intergenic
1197942441 X:131803584-131803606 CCTGCCTTCTTGGGAGCTGTGGG + Intergenic
1199715364 X:150503943-150503965 CCTGCCTGCTTGGCACCTAGTGG + Intronic
1199872218 X:151909686-151909708 CCTACCTGCATCTCAGCTGCTGG - Intergenic