ID: 1150287799

View in Genome Browser
Species Human (GRCh38)
Location 17:63963753-63963775
Sequence TGCCATTGCAGTCTTTGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150287795_1150287799 -2 Left 1150287795 17:63963732-63963754 CCCCTTGCGATGTGTCCAGGCTG 0: 1
1: 0
2: 0
3: 20
4: 100
Right 1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 185
1150287791_1150287799 15 Left 1150287791 17:63963715-63963737 CCTCGGGGCTCCCTTCTCCCCTT 0: 1
1: 0
2: 4
3: 37
4: 377
Right 1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 185
1150287796_1150287799 -3 Left 1150287796 17:63963733-63963755 CCCTTGCGATGTGTCCAGGCTGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 185
1150287797_1150287799 -4 Left 1150287797 17:63963734-63963756 CCTTGCGATGTGTCCAGGCTGCC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 185
1150287792_1150287799 5 Left 1150287792 17:63963725-63963747 CCCTTCTCCCCTTGCGATGTGTC 0: 1
1: 0
2: 0
3: 9
4: 168
Right 1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 185
1150287793_1150287799 4 Left 1150287793 17:63963726-63963748 CCTTCTCCCCTTGCGATGTGTCC 0: 1
1: 0
2: 1
3: 3
4: 171
Right 1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 185
1150287790_1150287799 29 Left 1150287790 17:63963701-63963723 CCGCTGCTGCTCTGCCTCGGGGC 0: 1
1: 0
2: 2
3: 35
4: 287
Right 1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150287799 Original CRISPR TGCCATTGCAGTCTTTGCCA TGG Exonic
900208333 1:1441017-1441039 TCCCACCGCAGTCTCTGCCACGG + Exonic
906091715 1:43185245-43185267 TGCCATTGCAGCCTATTCAAAGG + Exonic
906094544 1:43212892-43212914 TGCCACTGCACTCTTAGCCTGGG + Intronic
906286516 1:44591377-44591399 TGCCCTTGCAGGCCTTGCTAAGG + Intronic
907630985 1:56081496-56081518 TGCCTCTGCAGACTTTTCCATGG - Intergenic
908041242 1:60116016-60116038 TGCCACTGCATTCTCTCCCAGGG - Intergenic
909024637 1:70468244-70468266 TGCCATTGCAGTCAGAGCCTTGG + Intergenic
914894466 1:151656179-151656201 TGCCACTGCACTCTTAGCCTGGG + Intronic
916313617 1:163423690-163423712 TGCCATTACTGGCTTTGCCAGGG + Intergenic
917672632 1:177287436-177287458 TGCCATTAGAGTCTCTTCCAGGG - Intergenic
921078050 1:211715759-211715781 TGCCATTGCACTCCTAGCCTGGG + Intergenic
923543572 1:234907695-234907717 TGCCATTGAAGCCTGTGACATGG - Intergenic
1065282860 10:24157831-24157853 TGCAATGGCAGCCTTTGCCATGG + Intronic
1065888709 10:30101971-30101993 TGCCAGTGTGGTCTTTGCCTGGG + Intronic
1067255244 10:44631609-44631631 TGATATTGCAGACTTTGGCAGGG - Intergenic
1067814019 10:49457891-49457913 TGCCTTTGCATTCCTTGCGACGG - Exonic
1068702957 10:60039319-60039341 TGTCATGCAAGTCTTTGCCATGG + Intronic
1071115273 10:82211498-82211520 AGGGATTGCATTCTTTGCCAAGG - Intronic
1071314951 10:84386641-84386663 CGCCATTGCAGCCTCTGCCTGGG - Intronic
1073854168 10:107655866-107655888 GGCTCTTGCAGCCTTTGCCATGG + Intergenic
1084065508 11:66701609-66701631 TGACAATGCGGTCTTTGCCTGGG + Exonic
1085772488 11:79337813-79337835 TGCCATCGAAGGCCTTGCCAAGG + Intronic
1086148545 11:83582254-83582276 TGACTTTGGAATCTTTGCCATGG + Intronic
1086149851 11:83597082-83597104 TTCCAGTTCAGTCATTGCCAAGG + Intronic
1087380580 11:97399626-97399648 TGCCATTGGTGTCCTTGTCAGGG + Intergenic
1089325058 11:117651274-117651296 TGCCACTGCAGCCCCTGCCAGGG - Intronic
1090618986 11:128544521-128544543 TGCAATTCCATTCTTTTCCAAGG + Intronic
1090624196 11:128591722-128591744 TGCCATTGCAGTCTCAGCTGTGG - Intergenic
1092191304 12:6523019-6523041 TGCCTTTGCTGACTTTTCCAAGG + Intronic
1092792963 12:12085391-12085413 TGCCATTTCTTTCTTTGCCAGGG + Intronic
1094407243 12:30129909-30129931 TGCCACTGCACTTGTTGCCAGGG + Intergenic
1095169687 12:39019725-39019747 TGCCAAGGCAGTATTTGCCATGG + Intergenic
1100237522 12:92675329-92675351 TGCAATTGAAGTCTTGGCCAGGG - Intergenic
1101736196 12:107465105-107465127 TGCTATGGCAGTCCCTGCCATGG - Intronic
1102146332 12:110657847-110657869 GGACTCTGCAGTCTTTGCCAGGG - Intronic
1104100889 12:125608270-125608292 AGCCATTCCAGTCTGTGTCAAGG + Intronic
1106187907 13:27424995-27425017 AGCCACTGCAGTCGTGGCCAGGG + Intronic
1106468374 13:30033165-30033187 TCCCATTGCAGTCCCAGCCATGG - Intergenic
1107667319 13:42704845-42704867 TGCCATTGCACTCCTGGCAATGG - Intergenic
1109913217 13:68944224-68944246 TGCCATTGCACTCTCAGCCTGGG + Intergenic
1111422052 13:88024819-88024841 TGTGTTTGCAGTCTTAGCCATGG - Intergenic
1114408002 14:22474335-22474357 TTCCATTTCTGTCTTTTCCATGG + Intergenic
1114466248 14:22924911-22924933 TGCCTATGAACTCTTTGCCAAGG - Exonic
1114852322 14:26395892-26395914 TGTCACTGCACTGTTTGCCAGGG - Intergenic
1116173893 14:41440288-41440310 GGCCATAGAAGTCTTTCCCAGGG + Intergenic
1120213450 14:81657116-81657138 TCCCATGGCCGTCTTTTCCAAGG + Intergenic
1120505460 14:85349852-85349874 TGCCATGTCTGTCTTTGCCAGGG - Intergenic
1121118979 14:91364071-91364093 TGCCACTCTAGTCTTTGCAATGG + Intronic
1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG + Intergenic
1122368335 14:101212445-101212467 TGCTCTCTCAGTCTTTGCCAAGG - Intergenic
1126468253 15:48980227-48980249 TGCCATTTCTGTCTATGCCTAGG + Intergenic
1127691620 15:61402754-61402776 TGTAATTGCATTCATTGCCATGG - Intergenic
1129176909 15:73846923-73846945 GGCCACTGGAGGCTTTGCCAAGG + Intergenic
1131722708 15:95188108-95188130 AGCCATTCCAGTTTTAGCCATGG + Intergenic
1133495496 16:6313402-6313424 TGGCATTGCATTCATTGCCTGGG + Intronic
1139661501 16:68424069-68424091 GGCCAGGGCAGTCTTAGCCAGGG + Intronic
1140444207 16:75011647-75011669 TGCCATTGCAGCCAGTGCCCTGG + Intronic
1143344909 17:6242320-6242342 TACCATTGCAGTCTAGGCGAGGG - Intergenic
1144432716 17:15209905-15209927 TGCCATTGGAGCCTTTGTCATGG + Intergenic
1144686554 17:17229805-17229827 TCCCATTGCTGGCTCTGCCACGG - Intronic
1145719449 17:27055382-27055404 AGTCTTTGAAGTCTTTGCCAGGG - Intergenic
1146143655 17:30390632-30390654 TGCCTTTGCCTTCATTGCCAGGG + Intronic
1146918265 17:36691795-36691817 TGGCACTGCGGGCTTTGCCAGGG + Intergenic
1147318696 17:39633251-39633273 AGCCAGTGCAGTCTGTGCCGGGG - Intronic
1147896014 17:43751854-43751876 TGCACTTGCAGTCTTTGCTTGGG + Intergenic
1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG + Exonic
1151335084 17:73434993-73435015 TGCCCTTGGAGTCTCTGTCAGGG - Intronic
1154380912 18:13849016-13849038 TGCCATTTCTGTCTTTTCTAGGG + Intergenic
1155860260 18:30889254-30889276 TGCCCTTGCAGTTACTGCCAAGG - Intergenic
1156706797 18:39892503-39892525 TACCATTGAATTATTTGCCAAGG + Intergenic
1157907173 18:51579668-51579690 TTCCTTTGCAGTCACTGCCACGG + Intergenic
1162508443 19:11102279-11102301 TGCCAATCCTGTCTTTGCAAAGG - Intronic
1163302046 19:16453921-16453943 TGCCATTAGGGTCCTTGCCAAGG - Intronic
1163629961 19:18413248-18413270 TGCCATTGCACTCCTGGCCGAGG - Intergenic
1163891978 19:20024794-20024816 TGCCATGGCACTCCTTGCCTGGG + Intronic
1165702298 19:37947924-37947946 TGCCACAGAAGTCTTGGCCAGGG - Intronic
1167491925 19:49798004-49798026 TGCCATTGCTGTGTGTCCCATGG + Intronic
927915449 2:26933170-26933192 TGCCAGGGCTGACTTTGCCAGGG + Intronic
928427388 2:31190420-31190442 TCCAATTGCCCTCTTTGCCATGG + Intronic
928453270 2:31397737-31397759 TGACATTGCAGTTTTTTCCTTGG - Intronic
933823021 2:86131793-86131815 TGTAATTGCGGTTTTTGCCATGG - Intronic
934664481 2:96159994-96160016 TGCTTTTGGAGTCTCTGCCAGGG - Intergenic
934771495 2:96910442-96910464 TGCTTTTGCCGTCTTTGTCAAGG - Intronic
938403900 2:131016550-131016572 AGGCAATGCAGTCTTTGACATGG - Intronic
938786590 2:134635615-134635637 TGTCATTAAAGTCTTTACCAGGG + Intronic
938899504 2:135787923-135787945 TGATATTGCAGTCTATGCAATGG + Exonic
938955884 2:136297770-136297792 TACCATTTCAGCATTTGCCAAGG + Intergenic
939606364 2:144259498-144259520 AGTCATTGCGGTTTTTGCCATGG - Intronic
940589433 2:155702437-155702459 TTCCATTGCAGTGTAAGCCAGGG + Intergenic
941354374 2:164471006-164471028 TGTCATTTCATTCTCTGCCATGG + Intergenic
942193643 2:173495736-173495758 TGCCATTGGAGTCACAGCCAGGG + Intergenic
942620307 2:177838086-177838108 TGCCTTTTCTGTTTTTGCCAAGG - Intronic
943019480 2:182555091-182555113 TGCCATTTGAGTCATTGCCCAGG - Intergenic
946103703 2:217351355-217351377 TGCCATTGCAGTCTGAGCCTTGG - Intronic
947335950 2:229083308-229083330 TGCCCTTGCACTCTTGGCCTAGG - Intronic
1169031775 20:2415114-2415136 TGGCATTACATTCTTTGGCAGGG + Intronic
1169512077 20:6275241-6275263 TATCACTGCAGTCTTTGACATGG + Intergenic
1170249838 20:14268884-14268906 TCCCATAGCAGCCTTTACCAAGG + Intronic
1172863928 20:38080256-38080278 TACTTTTGGAGTCTTTGCCAGGG + Intronic
1173385841 20:42587238-42587260 TGCAATTGCATTGTTTCCCACGG + Intronic
1174707924 20:52676002-52676024 TGCCATTTGGATCTTTGCCATGG + Intergenic
1174889836 20:54379609-54379631 TGCCAATTCATTCTTTGTCATGG + Intergenic
1175212710 20:57371257-57371279 TGCCTTTTCACTCTTTTCCATGG - Intronic
1177884693 21:26733561-26733583 TTCCATGGCAGTGTTTGTCATGG + Intergenic
1178068402 21:28933603-28933625 TGTCATTTCAGTCGTTGCCCAGG - Intronic
1178135004 21:29617360-29617382 TGCCATTTAAGTTCTTGCCATGG + Intronic
1178513583 21:33228026-33228048 AGCAAATGCAGTCTATGCCAAGG - Intergenic
1178608740 21:34061503-34061525 TGCCCTTCCACTTTTTGCCATGG + Intergenic
1183866478 22:40708245-40708267 GGCCATTGCATTCATTCCCATGG - Intergenic
1185286301 22:50001319-50001341 TGGGGCTGCAGTCTTTGCCAGGG + Intronic
950580072 3:13856130-13856152 TGCCAGGGCTGTCTTTGCCGTGG + Intronic
952037300 3:29217990-29218012 TGCCTTTGCTGTCTTTCTCAGGG - Intergenic
958634982 3:96732269-96732291 TGCCATTTAAGTCTTTGATATGG - Intergenic
959086377 3:101854691-101854713 TGCCATTTCAGACTCTGTCAAGG - Intronic
959103390 3:102039500-102039522 GGCAATTGCTTTCTTTGCCAAGG - Intergenic
959123869 3:102266416-102266438 AGCCATTGAAGTCTTTACCAGGG + Intronic
959633837 3:108538898-108538920 TGCCCTTCCACTCTCTGCCATGG - Intergenic
959676267 3:109039498-109039520 TGCCAGTGCAGTTTTTGTCTAGG - Intronic
962350331 3:134651407-134651429 TGCGATTTCTGTATTTGCCAGGG - Intronic
962436718 3:135373708-135373730 TTCCAATTCAGTCTTTGTCATGG + Intergenic
963198796 3:142565876-142565898 TGCCATTGAACACTTTGGCATGG - Intronic
964615764 3:158663260-158663282 TGCATTTTCATTCTTTGCCATGG + Intronic
964734550 3:159903238-159903260 CGCCACTGCAGCCCTTGCCACGG + Intergenic
965852421 3:173044790-173044812 TGCCATTGCATTCTCTCACAGGG - Intronic
969078426 4:4599193-4599215 TGTCAATGCAGTCTTACCCAGGG + Intergenic
970500455 4:16671715-16671737 AGCTATTGCAGACTTTGCAATGG - Intronic
971542971 4:27844793-27844815 TGCCATTGAAATCTCTACCAAGG - Intergenic
974240346 4:59238241-59238263 TGCCATTGCAGTCGAAGCCTTGG - Intergenic
978563105 4:110054057-110054079 TGCCATTGCACTCTAGGCCTGGG + Intronic
980050820 4:128038051-128038073 TGCCTTTGCAGTCTTTTTAAAGG + Intronic
985036950 4:185849997-185850019 TGCAATAGCAGTCATTGCCAGGG - Intronic
989540279 5:42610243-42610265 TGCCAATGGTGTGTTTGCCAAGG - Intronic
990999107 5:61765025-61765047 TTCCATTCCAGCCTTTGCCTAGG + Intergenic
992071103 5:73150483-73150505 TGGCATTGCTGTTTGTGCCAGGG - Intergenic
992299692 5:75365555-75365577 TTCCATTCCAGTCCTTGCTATGG + Intergenic
992424323 5:76640543-76640565 GGCCATTGCAGTCTTTTCCTTGG + Intronic
992757636 5:79923664-79923686 TGCCATTCCATTTTTTGCCATGG - Intergenic
993166920 5:84368030-84368052 TGCCAGTGCAATTTTTGCCTAGG - Intronic
993630314 5:90278484-90278506 TGCCATAGCAGACTTTTCTATGG + Intergenic
994775032 5:104029597-104029619 TCCCTTTGCAGTCTTTCCCCAGG - Intergenic
995301130 5:110584457-110584479 TGCCATTCTATTCTTTGCCTCGG - Intronic
996449047 5:123597479-123597501 TATCATTGCAGTCTTTTCCTTGG + Intronic
996500381 5:124209908-124209930 TGCCAGAGCAGTCTGAGCCAAGG + Intergenic
997324531 5:133009047-133009069 TGCCACTGCACTCTTGGCCTGGG - Intronic
999322848 5:150625584-150625606 TGCAATTGCCCTCCTTGCCAAGG + Intronic
1000201638 5:159016638-159016660 TGGCATTGCAGTCATAGGCATGG - Intronic
1001700434 5:173702745-173702767 TCCCATTGGGATCTTTGCCATGG - Intergenic
1004031937 6:11879147-11879169 TCCCATTGCAGTCTTCTCAATGG - Intergenic
1008885192 6:56424720-56424742 TGACTTTCCTGTCTTTGCCAAGG - Intergenic
1009400587 6:63250309-63250331 TGCTATTGCAGTATTTGGCTTGG + Intergenic
1010915095 6:81606126-81606148 TCCCACTGGATTCTTTGCCATGG - Intronic
1010994669 6:82519611-82519633 GGCCATTGGAGTCTATCCCAGGG - Intergenic
1013328725 6:109075671-109075693 TGCAATTACAGTATCTGCCAGGG - Intronic
1014722383 6:124933411-124933433 TGCCATTACATTATTTCCCAAGG - Intergenic
1015627694 6:135197912-135197934 TACTAGTGCAGTTTTTGCCAAGG + Intronic
1016149467 6:140721527-140721549 TGCCATTGCATTCTTTCTTATGG + Intergenic
1016453629 6:144209522-144209544 TGCCATTGCAGTCAGAGCCTTGG - Intergenic
1018360015 6:163057945-163057967 TGCCATTCCAGTCAATGCCTTGG + Intronic
1018864551 6:167736690-167736712 TGCAATAGCAGTGTTTGCCTCGG - Intergenic
1019257202 7:60050-60072 TCCCATGGCAGTGTTAGCCAAGG - Intergenic
1019622675 7:2000280-2000302 CGCCATTGCAGTCCTAGCCCAGG + Intronic
1020856105 7:13425980-13426002 TAGTATTGCAGTCTTAGCCAGGG + Intergenic
1021931350 7:25584389-25584411 TGCCCTTGAAGTCCTTGCCATGG - Intergenic
1023384239 7:39639520-39639542 AGCCATTGCACTCTTAACCATGG + Intronic
1023858672 7:44202828-44202850 GGTCTTTGCAGTCTTTACCATGG + Intronic
1024881617 7:54092078-54092100 TTCCATTTGAGTCTATGCCAGGG + Intergenic
1028970659 7:96854991-96855013 TGCCATTGGAATCTTTGCCAAGG - Intergenic
1029404028 7:100362776-100362798 TGGCATTGCAGGCTGAGCCACGG + Intronic
1035466851 7:159084918-159084940 TGCCACTGCAATCTTTTCCAAGG + Intronic
1036996830 8:13667627-13667649 TGGCCTTGAAATCTTTGCCATGG - Intergenic
1037212615 8:16409726-16409748 TACCATTGTAATCTTTGCAAAGG + Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041541304 8:58988158-58988180 TGTCCTTTCAGTCTTTGCAATGG - Intronic
1041919587 8:63167473-63167495 TGCCCTTCCATTCATTGCCACGG - Intergenic
1043415815 8:80047974-80047996 TCTCATTGCAGTCAGTGCCAGGG - Intronic
1043702874 8:83312966-83312988 TGCCAAGGCTGTCCTTGCCAAGG + Intergenic
1044118522 8:88365061-88365083 TGCTATTACAGTTTTTGCCCAGG - Intergenic
1047873852 8:129113838-129113860 TGGCATTGCTGTGTATGCCAAGG + Intergenic
1048332424 8:133479844-133479866 TTCCATTGCAGTTTTATCCAGGG - Intronic
1048554544 8:135461523-135461545 TGACATTGCAATTCTTGCCAAGG + Intronic
1049478045 8:142805995-142806017 TGGCAGGGCAGGCTTTGCCAAGG - Intergenic
1051072568 9:13189629-13189651 TTGCATTGCATTCTTTGCTAAGG - Intronic
1052386272 9:27827163-27827185 TGCCACTGCACTCCCTGCCAAGG - Intergenic
1052408116 9:28088351-28088373 GGGCATAGCAGTCTTAGCCATGG - Intronic
1054796237 9:69304846-69304868 TGCCATTGAACTCTTTGCGTAGG - Intergenic
1056043451 9:82691410-82691432 TGACATTTCAGTCTCTTCCAGGG + Intergenic
1056899058 9:90582148-90582170 TAGCATTCCAGTGTTTGCCATGG + Intergenic
1057634201 9:96747979-96748001 TGCCATTGCATTCTGTGCCCAGG + Intergenic
1060172292 9:121471776-121471798 TGCCTTTTCTGACTTTGCCACGG - Intergenic
1061270996 9:129542506-129542528 TGCCACTGCACTCCTTGCCTAGG - Intergenic
1061642871 9:131973329-131973351 TGGCATCCCAGTCATTGCCAAGG - Intronic
1186372709 X:8963974-8963996 TTGCATTGAAATCTTTGCCAGGG - Intergenic
1187087391 X:16055259-16055281 TGCCATTGAACTCTTCTCCAAGG - Intergenic
1188377646 X:29452422-29452444 TCCCCTTGAAGTCATTGCCAGGG + Intronic
1188905089 X:35781835-35781857 TGTAATTGCAGTTTTTGTCATGG + Intergenic
1191155392 X:57267295-57267317 TGCTATTGCAGACTTAGCCTTGG + Intergenic
1191225684 X:58040544-58040566 TGCCATTGCAGTCAGAGCCTTGG + Intergenic
1194332032 X:92595098-92595120 TGCCATTTCATTCAATGCCATGG - Intronic
1196254480 X:113500163-113500185 TGCCATTGCAGAATATGGCAAGG - Intergenic
1197378893 X:125714080-125714102 TGCCATTGCAGTCAGAGCCTTGG + Intergenic
1198540285 X:137631365-137631387 TGCCAGTGCTGTCTTCTCCAGGG + Intergenic
1200640738 Y:5714153-5714175 TGCCATTTCATTCAATGCCATGG - Intronic
1201628070 Y:16037043-16037065 TGACATTGCAGTCATCTCCATGG - Intergenic