ID: 1150288960

View in Genome Browser
Species Human (GRCh38)
Location 17:63970966-63970988
Sequence TGGAAGGATGGGCGTTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 411}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288960_1150288971 10 Left 1150288960 17:63970966-63970988 CCTCTCAAACGCCCATCCTTCCA 0: 1
1: 0
2: 0
3: 31
4: 411
Right 1150288971 17:63970999-63971021 CATCTGCCCTCTGGTCACGTGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1150288960_1150288970 9 Left 1150288960 17:63970966-63970988 CCTCTCAAACGCCCATCCTTCCA 0: 1
1: 0
2: 0
3: 31
4: 411
Right 1150288970 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 18
4: 119
1150288960_1150288974 26 Left 1150288960 17:63970966-63970988 CCTCTCAAACGCCCATCCTTCCA 0: 1
1: 0
2: 0
3: 31
4: 411
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288960_1150288966 1 Left 1150288960 17:63970966-63970988 CCTCTCAAACGCCCATCCTTCCA 0: 1
1: 0
2: 0
3: 31
4: 411
Right 1150288966 17:63970990-63971012 GTAGGACCCCATCTGCCCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288960 Original CRISPR TGGAAGGATGGGCGTTTGAG AGG (reversed) Intronic
900535665 1:3175959-3175981 TGGATGGATGGGTGAGTGAGTGG - Intronic
900573500 1:3371563-3371585 TGGAAGGATGGGTGAGTGGGTGG - Intronic
900993397 1:6108017-6108039 TGGAGGGATGGGTGATGGAGGGG + Intronic
901130686 1:6961291-6961313 TGGAAGGAAGGGCTTTGGGGAGG + Intronic
901133176 1:6975526-6975548 TTGAAGGATGGGCATTTGTTGGG + Intronic
901700253 1:11041477-11041499 TGGAAGGATGGGTGGATGGGTGG + Intronic
901700337 1:11041871-11041893 TGGAAGGATGGGTGGATGGGTGG + Intronic
901796837 1:11684425-11684447 AGGAAGGATGGGTGTTTAGGGGG + Intronic
902098371 1:13965147-13965169 TGGAGGGGTGGGCGCTAGAGAGG + Intergenic
902147867 1:14418908-14418930 TGGCTGGATGGGGGTTTGTGGGG + Intergenic
902202622 1:14845188-14845210 TGGATGGATGGGTGAGTGAGTGG + Intronic
902723708 1:18321711-18321733 TAGAAGGAGGGGCTTTTGGGAGG - Intronic
903277483 1:22231250-22231272 TGGATGGGTGGGTGTGTGAGTGG - Intergenic
903294261 1:22333647-22333669 TGGATGGATGGGTGATTGAGTGG + Intergenic
903294279 1:22333735-22333757 TGGATGGATGGGTGATGGAGTGG + Intergenic
903294332 1:22334001-22334023 TGGATGGGTGGGTGGTTGAGTGG + Intergenic
903294681 1:22336210-22336232 AGGATGGATGGGTGGTTGAGTGG - Intergenic
903294699 1:22336329-22336351 TGAATGGATGGGTGATTGAGTGG - Intergenic
903294717 1:22336441-22336463 TGAATGGATGGGTGATTGAGTGG - Intergenic
903294755 1:22336669-22336691 TGGATGGATGGGTGATTGAGTGG - Intergenic
903294769 1:22336741-22336763 TGAATGGATGGGTGATTGAGTGG - Intergenic
903294837 1:22337141-22337163 TGGATGGATGGGTGATTGAGTGG - Intergenic
903294883 1:22337416-22337438 TGGATGGATGGGTGATTGAGTGG - Intergenic
904391043 1:30186349-30186371 TGGATGGATGGGGGGGTGAGTGG - Intergenic
904755633 1:32767006-32767028 TGGAAGGATGGGCAGGGGAGGGG - Intronic
908701563 1:66907880-66907902 TTGAAGGATTGGAGTTTGAGAGG - Intronic
910544655 1:88400211-88400233 TGGAAGGTAGGGCCTTTGGGAGG - Intergenic
911166007 1:94724869-94724891 TGGGAGGTGGGGCCTTTGAGAGG - Intergenic
912727887 1:112075709-112075731 TGGAAGGATGGTTGTGTGGGTGG + Intergenic
915279017 1:154809764-154809786 AGGAAGGATGGGAGATTGAGGGG + Intronic
917238213 1:172917498-172917520 TGGATGGATGGGTGGGTGAGTGG + Intergenic
917748803 1:178036455-178036477 TGGACTGATGGGGGTTGGAGGGG - Intergenic
918104060 1:181401247-181401269 AGGAAGGATGGGAGTTAGGGTGG - Intergenic
918642001 1:186852710-186852732 TGGGAGGTGGGGCCTTTGAGAGG - Intronic
921570373 1:216770876-216770898 TGGAAGGATGGGTGAATGGGTGG - Intronic
923004912 1:230040723-230040745 TGGGACGATGGGTTTTTGAGAGG + Intergenic
1066316702 10:34254635-34254657 AGGAAGGATGGGCTTCTAAGGGG - Intronic
1070689997 10:78517479-78517501 TGGAGGGATGGGTTTTTGGGGGG + Intergenic
1070746947 10:78939488-78939510 TGAAAGGATGGGTGTAGGAGGGG - Intergenic
1071131217 10:82395690-82395712 TGGATGGATGGGTGGATGAGTGG - Intronic
1072257200 10:93631505-93631527 CGGAAGGATGGAAGGTTGAGGGG - Intronic
1072542379 10:96407993-96408015 TGGAAGGAAGGGTGTTTGCTTGG - Intronic
1073300694 10:102469496-102469518 TGGATGGGTGGGAGTTTGAAGGG + Intronic
1073350413 10:102815631-102815653 TGGAAGGAAAGGCATCTGAGGGG - Exonic
1074568865 10:114606609-114606631 GGGAAGGAAGGGGGCTTGAGAGG - Intronic
1075090664 10:119442411-119442433 TGGGAGGAGAGGCCTTTGAGAGG + Intronic
1077140005 11:1020130-1020152 TGGAAGGAGGGGTGTCTGGGTGG + Exonic
1077159434 11:1106031-1106053 TGGAAGGATGGGTGGGTGAGTGG - Intergenic
1077208147 11:1353863-1353885 TGGGAGGAGGGGCCTTTGGGCGG + Intergenic
1080752341 11:35162300-35162322 TGAAAGAATGGGCTTTTGCGAGG + Intronic
1081629971 11:44682406-44682428 TGGAAGGATGGGTGGATGGGTGG - Intergenic
1081730785 11:45370404-45370426 TGGATGGATGGGTGGGTGAGTGG - Intergenic
1081730815 11:45370496-45370518 TGGAAGGATGGGTGGGTGTGTGG - Intergenic
1083288178 11:61674387-61674409 TGGATGGATGGGTGAATGAGTGG + Intergenic
1083719199 11:64595814-64595836 TGGATGGATGGACGGTTGAATGG + Intronic
1084430932 11:69110829-69110851 TGGATGGATGGGTGTTTGAATGG - Intergenic
1084464473 11:69314022-69314044 TGGATGGATGGGCGAATGAGTGG - Intronic
1084464531 11:69314267-69314289 TGGAAGGATGGATGGTTGAGTGG - Intronic
1084545966 11:69815227-69815249 TGGAAGGATGGGTGGATGGGTGG + Intronic
1084596259 11:70118722-70118744 TGGATGGATGGGTGAATGAGTGG + Intronic
1084697485 11:70764347-70764369 TGGATGGATGGGTGGGTGAGTGG - Intronic
1084697570 11:70764764-70764786 TGGATGGATGGATGTGTGAGTGG - Intronic
1084713133 11:70856526-70856548 TGGGAGGATGGGAGGTTGGGTGG + Intronic
1086299647 11:85412808-85412830 TTGATGGATGGGCATTTGGGTGG + Intronic
1087429435 11:98033661-98033683 TGGAAGGTGGGTCCTTTGAGAGG + Intergenic
1088409635 11:109520181-109520203 TAGAAGGCTGGGCCTTTGGGAGG - Intergenic
1089682551 11:120127254-120127276 TGGATGGATGGATGTTGGAGGGG + Intronic
1089730955 11:120518416-120518438 TGAAAGGATGGGGATTTGGGAGG + Intronic
1091839041 12:3605984-3606006 TAGAAGGATTGGCGCTGGAGAGG - Intergenic
1091861886 12:3792840-3792862 TTGAAGGATGGGGGTTGGCGGGG - Intronic
1092071356 12:5633962-5633984 TGGAGGGAGAGGCGTTTGACTGG - Intronic
1096380688 12:51155361-51155383 TGGATGGATGGGTGAATGAGAGG - Intronic
1096455343 12:51780420-51780442 TGGAAGGAAAGGTGGTTGAGAGG - Intronic
1097575942 12:61392653-61392675 TGGATGGATGGATGGTTGAGAGG - Intergenic
1098035204 12:66294695-66294717 TGGAAGTATGTGTGTTTCAGTGG - Intergenic
1100457324 12:94765134-94765156 TGGCAGGATGAGCATTTGGGGGG - Intergenic
1100817630 12:98401282-98401304 TGGCATGGTGGGTGTTTGAGAGG - Intergenic
1101385030 12:104249305-104249327 TAGAAGGAGGGGCCTTTGGGAGG - Intronic
1102795405 12:115685022-115685044 TGGACGGATGGGTGGATGAGTGG + Intergenic
1103064108 12:117882729-117882751 TGGATGGATGGGTGGTTGGGTGG - Intronic
1103444929 12:120988404-120988426 TGGATGGATGGGCGAATGGGTGG - Intronic
1104467485 12:129002741-129002763 AGAAAGGATGGGCGCTGGAGAGG - Intergenic
1104882926 12:132084654-132084676 GGGATGGGTGGGCGTTTGCGGGG - Intronic
1104925716 12:132313149-132313171 TGGATGGATGGGTGGGTGAGTGG - Intronic
1104925848 12:132313610-132313632 TGGATGGATGGGTGGGTGAGTGG - Intronic
1104954439 12:132457508-132457530 TGGGTGGATGGGCGGGTGAGTGG + Intergenic
1104954498 12:132457685-132457707 TGGGTGGATGGGCGGGTGAGTGG + Intergenic
1104954510 12:132457722-132457744 TGGGTGGATGGGCGGGTGAGCGG + Intergenic
1105530636 13:21216370-21216392 TGTAAGGATGAGCGTTTGCCTGG + Intergenic
1105712053 13:23020599-23020621 TGAAAGGTAGGGCGTTTGAAAGG - Intergenic
1106387468 13:29302012-29302034 TGGAAGGTGGGGCCTTTGGGAGG - Intronic
1106875917 13:34072755-34072777 TAGAAGGCTGGCAGTTTGAGGGG - Intergenic
1107242010 13:38247520-38247542 TGGGAGGATTGGGATTTGAGAGG - Intergenic
1108827965 13:54438975-54438997 TTGGAGGTTGGGCCTTTGAGAGG + Intergenic
1109369728 13:61407253-61407275 AGGAGGGAAGGGCATTTGAGTGG - Intergenic
1110350078 13:74496723-74496745 TTGAAGGTGGGGCCTTTGAGAGG + Intergenic
1112804265 13:103145631-103145653 TGGGAGGTGGGGCCTTTGAGAGG - Intergenic
1113335650 13:109373587-109373609 TGGGAGGAGGGGCCTTTGGGAGG - Intergenic
1113581690 13:111434624-111434646 TGAATGGATGGGTGTGTGAGTGG + Intergenic
1113780218 13:112972497-112972519 TGGATGGATGGATGTGTGAGTGG + Intronic
1113934528 13:113986724-113986746 TGGAAGGATGGGTGAGTGATGGG - Intronic
1113935006 13:113989321-113989343 TGGAAGGATGGGTGAGTGATGGG - Intronic
1113935089 13:113989684-113989706 TGGAAGGATGGGTGAGTGACGGG - Intronic
1120292398 14:82591554-82591576 TGGAAGGGTGGGAGGTTGAGGGG + Intergenic
1120845432 14:89121071-89121093 TAGAAGGAAGGGCATTTGGGAGG - Intergenic
1121047648 14:90799688-90799710 TGGAGGGAAGGGCGTTGGGGTGG + Intronic
1121340289 14:93100980-93101002 GGGAAGGATGGGGGAGTGAGTGG - Intronic
1121598540 14:95185393-95185415 TGGAAGGCTGGGAGCTGGAGTGG - Exonic
1121676988 14:95761454-95761476 TGGAAAGCTTGGCGTGTGAGAGG + Intergenic
1122867563 14:104614327-104614349 TGGATGGATGGATGTTTGGGTGG + Intergenic
1122923749 14:104890579-104890601 TGGATGGATGGGTGAGTGAGTGG + Intronic
1123126062 14:105947072-105947094 TGGACGGATGGACGGGTGAGTGG - Intergenic
1124572571 15:30878571-30878593 TGGGAGGTGGGGCCTTTGAGAGG + Intergenic
1125726863 15:41872562-41872584 TAGATGGATGGGCGTGTGAGTGG - Intronic
1125729579 15:41885667-41885689 TGGAAGGATGGGGGTGTGGTAGG + Intronic
1127832723 15:62765022-62765044 TGAAAGGATGGGGGGATGAGGGG - Intronic
1128446147 15:67762842-67762864 GGGTAGGATGGGCCTTTCAGTGG + Intronic
1131244463 15:90778525-90778547 TGGCAGGATGGGGATGTGAGGGG - Intronic
1131334601 15:91535980-91536002 TAGAAGGTTGGGCTTTTGAGAGG + Intergenic
1131649971 15:94387833-94387855 TGGAAAAAGGGGCATTTGAGTGG + Intronic
1131864142 15:96689108-96689130 TGGAAGGGTGGGAGTCTCAGGGG - Intergenic
1133111578 16:3551101-3551123 TGGATGGATGGGTGGATGAGTGG - Intronic
1133111673 16:3551591-3551613 TGGATGGATGGGTGGATGAGTGG - Intronic
1133141838 16:3750821-3750843 TGAAAGGATGGAGGTTTAAGTGG + Intronic
1133474579 16:6107742-6107764 TGGATGGATGGGTGTTTGGATGG + Intronic
1133813122 16:9176767-9176789 TGGAAGGTGGGGCCTTTGGGAGG - Intergenic
1135108083 16:19668385-19668407 AGGAAGGATGGGAGGTGGAGGGG - Intronic
1135656766 16:24256715-24256737 TGGACGGCTGGGGGTTGGAGGGG - Exonic
1135853454 16:25985323-25985345 TGGAAGGCTGGGAGAATGAGAGG + Intronic
1135949741 16:26902968-26902990 TGGAAGGATGGATGGGTGAGTGG + Intergenic
1136290911 16:29270812-29270834 TGGATGGATGGGTGGATGAGTGG + Intergenic
1137770429 16:51012069-51012091 TGGATGGATGGGTGAATGAGTGG + Intergenic
1137770680 16:51013767-51013789 TGGAAGGTTGGGGGTAGGAGAGG + Intergenic
1138544073 16:57705890-57705912 TGGATGGATGGGAGGATGAGTGG - Intronic
1138544224 16:57706418-57706440 TGGATGGATGGGAGGATGAGTGG - Intronic
1138547712 16:57729523-57729545 TGGATGGATGGGTGAGTGAGTGG + Intronic
1138547733 16:57729595-57729617 TGGATGGATGGGTGAGTGAGTGG + Intronic
1140067696 16:71625421-71625443 TGGATGGATGGGCAGGTGAGTGG + Intergenic
1141119266 16:81338828-81338850 TGGAAGGGAGGCCCTTTGAGAGG + Intronic
1141167279 16:81669062-81669084 TGGAAGGAGGTGAGTGTGAGAGG - Intronic
1141167289 16:81669110-81669132 TGGAAGGAGGTGAGTGTGAGAGG - Intronic
1141167319 16:81669248-81669270 TGGAAGGAGGTGAGTGTGAGAGG - Intronic
1141167329 16:81669296-81669318 TGGAAGGAGGTGAGTGTGAGAGG - Intronic
1141167351 16:81669387-81669409 TGGAAGGAGGTGAGTGTGAGAGG - Intronic
1141167382 16:81669524-81669546 TGGAAGGAGGTGAGTGTGAGAGG - Intronic
1141650205 16:85388697-85388719 TGGATGGATGGGTGGATGAGTGG + Intergenic
1141778301 16:86139071-86139093 TAGAAGGCGGGGCCTTTGAGAGG - Intergenic
1141984219 16:87569608-87569630 TGGAAGGATTGGGGATTGACAGG - Intergenic
1142096786 16:88244314-88244336 TGGATGGATGGGTGGATGAGTGG + Intergenic
1142152603 16:88519286-88519308 TGGATGGATGGGTGGGTGAGTGG + Intronic
1142152892 16:88520579-88520601 TGGATGGATGGGAGGGTGAGTGG + Intronic
1142255641 16:89012482-89012504 TGGATGGATGGGTGGATGAGTGG - Intergenic
1142284345 16:89165655-89165677 TGGAAGGAAGGTCGTGTGACGGG - Intergenic
1142597587 17:1037067-1037089 TGGAAGGATGGGTGGGTGGGTGG - Intronic
1143279850 17:5745660-5745682 CAGAAGGATGGGCGTATGGGGGG - Intergenic
1143477944 17:7213685-7213707 TGGAAGGGTGGGCGTTCAATGGG - Intronic
1143939075 17:10519798-10519820 TGCAGGGATGTGCGTCTGAGAGG + Intergenic
1144022887 17:11252533-11252555 TGGATGGATGGGCTCTTGAAGGG - Intronic
1144069357 17:11653910-11653932 TGGATGGATGGGTGAATGAGTGG - Intronic
1144828155 17:18118094-18118116 GGCAAGGAGGGGCGTTTCAGTGG - Intronic
1145271632 17:21407870-21407892 TGGATGGATGGGTGAATGAGTGG - Intronic
1145309844 17:21695318-21695340 TGGATGGATGGGTGAATGAGTGG - Intronic
1146964682 17:37015584-37015606 TGGAAGGAATGGCCTTTGGGAGG - Intronic
1147374353 17:40015202-40015224 CGGGAGGAAGGGAGTTTGAGGGG + Intergenic
1149031114 17:52083560-52083582 TGGAAGGGTGGGAGAGTGAGGGG - Intronic
1150288960 17:63970966-63970988 TGGAAGGATGGGCGTTTGAGAGG - Intronic
1151560907 17:74869054-74869076 TGGGAGGATGGGGGATTGATGGG - Intronic
1151576221 17:74953803-74953825 TGGAGGGATGGGCGCAGGAGAGG - Intronic
1151888335 17:76937423-76937445 TGGATGGGTGGATGTTTGAGAGG + Intronic
1152034062 17:77861195-77861217 TGGATGGATGGGTGAATGAGTGG + Intergenic
1152038100 17:77885508-77885530 TGGATGGATGGGCGGGTGGGTGG + Intergenic
1152301658 17:79498517-79498539 TGGATGGATGGGTGAGTGAGTGG - Intronic
1152301692 17:79498662-79498684 TGGATGGATGGGTGAGTGAGTGG - Intronic
1152301730 17:79498823-79498845 TGGAAGGATGGGTGCATGAGTGG - Intronic
1152301760 17:79498956-79498978 TGGAAGGATGAGTGCATGAGTGG - Intronic
1152301767 17:79499004-79499026 TGGATGGATGGGTATATGAGTGG - Intronic
1152390629 17:80001824-80001846 TGGAGGGAAGGGCATGTGAGAGG - Intronic
1153825536 18:8870796-8870818 TGGAATAATGGGGTTTTGAGTGG + Intergenic
1154417228 18:14185495-14185517 TAGAAGAATTGGCGTTTGATAGG + Intergenic
1155474543 18:26225262-26225284 TAGAAGGTTGGGCCTTTGAAAGG - Intergenic
1156300464 18:35832104-35832126 GGCAAGGATGGGTGTTTGACGGG - Intergenic
1156371754 18:36477475-36477497 TGGATGGATGGGTGGGTGAGTGG - Intronic
1157187730 18:45554646-45554668 GGGAAGGATGGGGGTGTGGGGGG + Intronic
1157500830 18:48189613-48189635 TGGAAGGATGGGTGGGGGAGAGG - Intronic
1157597151 18:48870870-48870892 TGGAAGGAAGGGCCTTCGTGAGG - Intergenic
1158150684 18:54365932-54365954 AGGAATGATGGGTATTTGAGAGG - Intronic
1159557165 18:69957598-69957620 AGGAAGGAAGGACGTTTGACAGG + Intronic
1159770018 18:72538452-72538474 GGGAAGGATGGGGGTGGGAGTGG - Intronic
1160687451 19:443395-443417 TGGATGGATGGACGGGTGAGTGG + Intronic
1160687504 19:443591-443613 TGGATGGATGGACGGGTGAGTGG + Intronic
1160687534 19:443703-443725 TGGATGGATGGACGGGTGAGTGG + Intronic
1160926729 19:1550104-1550126 TGGATGGATGGGTGGATGAGTGG - Intergenic
1161227435 19:3153570-3153592 TGGATGGATGGGTGAATGAGTGG + Intronic
1161227476 19:3153741-3153763 TGGATGGATGGGTGGATGAGTGG + Intronic
1161227566 19:3154194-3154216 TGGATGGATGGGTGGATGAGTGG + Intronic
1161227586 19:3154276-3154298 TGGATGGATGGGTGGATGAGTGG + Intronic
1161422845 19:4185125-4185147 TGGATGGATGGGTGGTTGGGTGG + Intronic
1161422855 19:4185169-4185191 TGGATGGATGGGTGGATGAGTGG + Intronic
1161489368 19:4553485-4553507 TGGATGGATGGGTGTGTGGGTGG + Intronic
1161679666 19:5673587-5673609 TGGACGGATGGGTGGTTGGGTGG - Intergenic
1161916038 19:7228996-7229018 TGGATGGATGGACGTCTGGGTGG + Intronic
1162142587 19:8593481-8593503 TGGAGGGGTGGGAGTTTGGGAGG + Intronic
1162389007 19:10378035-10378057 TGGATGGATGGGTGGTTGGGAGG + Intronic
1163182425 19:15614106-15614128 TGGAATGAGGGGCTTTAGAGGGG - Intergenic
1163610012 19:18295787-18295809 TGGATGGATGGGTGGATGAGTGG - Intergenic
1163731857 19:18954199-18954221 TGGATGGATGGGCGAATGAGTGG - Intergenic
1164670339 19:30068779-30068801 TGGATGAATGGGTGTGTGAGTGG - Intergenic
1165144345 19:33721870-33721892 TGGATGGATGGGTGGGTGAGTGG + Intronic
1165144360 19:33721934-33721956 TGGATGGATGGGTGGGTGAGTGG + Intronic
1165477685 19:36040693-36040715 TGGAAGGAGGGGCAGTGGAGGGG - Intronic
1165759039 19:38309920-38309942 TGGATGGATGGGTGGGTGAGTGG - Intronic
1166423256 19:42654331-42654353 TGGAAGGATGGGGCTCTGAGAGG + Intronic
1166738192 19:45098380-45098402 TGGAAAGATAGGCATGTGAGAGG + Intronic
1167148739 19:47696910-47696932 TGGATGGATGGGAGTCTGGGCGG + Intronic
1167202181 19:48073544-48073566 TGGATGGATGGCCGGTTGGGTGG + Intronic
1167212079 19:48139650-48139672 TGGAAGGTTGGGGCTTAGAGAGG - Intronic
1168086888 19:54054726-54054748 TGGAAGGATGGACAAATGAGTGG + Intronic
1168086924 19:54054910-54054932 TGGATGGATGGGTGAATGAGTGG + Intronic
1168567908 19:57440101-57440123 TATAAGGAAGGGCTTTTGAGGGG + Intronic
925098186 2:1224152-1224174 TGGAAGGTGGGGCCTTTGAGAGG - Intronic
926151771 2:10429449-10429471 TGGATGGATGGGAGTATGGGTGG + Intergenic
926385809 2:12334730-12334752 TGGAAGGAGGGGAGCTTGAATGG + Intergenic
927275329 2:21257625-21257647 TAGAAGGTGGGGCCTTTGAGAGG - Intergenic
929048197 2:37811316-37811338 TGGAAGGGTGGGAGTGTGAGAGG - Intergenic
929219000 2:39444055-39444077 TGGGAGGGTGGGAGTGTGAGTGG + Intergenic
930086622 2:47502428-47502450 TGGATGGATGGGTGGATGAGTGG + Intronic
930086673 2:47502656-47502678 TGGATGGATGGACGGATGAGTGG + Intronic
930730876 2:54725968-54725990 TGGATGAATGGCCGTTTTAGGGG + Intronic
930992953 2:57682687-57682709 TGGAAGGTGGGGCCTTTGCGAGG + Intergenic
932076330 2:68667339-68667361 TGGAAAGATGGGAGGTTGGGAGG + Intergenic
936787051 2:116106095-116106117 TGGGAGGTGGGGCTTTTGAGAGG - Intergenic
937977077 2:127588808-127588830 TGGATGGATGGGTGGGTGAGTGG + Intronic
937977124 2:127588989-127589011 TGGATGGATGGGTGAGTGAGTGG + Intronic
937977138 2:127589028-127589050 TGGATGGATGGGTGGGTGAGTGG + Intronic
937977366 2:127589822-127589844 TGGAAGGATGGGTGAGTGGGTGG + Intronic
937977384 2:127589877-127589899 TGGATGGATAGGTGTGTGAGTGG + Intronic
938108214 2:128547470-128547492 TGGATGGATGGGTGGGTGAGTGG - Intergenic
938185538 2:129228815-129228837 TGGCAGGGTGGTGGTTTGAGAGG - Intergenic
940466446 2:154034582-154034604 TGAAAGGATGGGAGTGTGACAGG - Intronic
941924895 2:170884892-170884914 TGGAAGGACAGGCTTTAGAGTGG - Intergenic
947229035 2:227866906-227866928 TGGGAGGATGGGAGTTGGGGAGG - Intergenic
948375319 2:237517090-237517112 TAGATGGATAGGTGTTTGAGTGG + Intronic
948375388 2:237517408-237517430 TGGATGGATGGGTGGGTGAGTGG + Intronic
948765377 2:240216646-240216668 TGGAAGGATGGGGGTGGGGGTGG + Intergenic
948765428 2:240216753-240216775 TGGAAGGATGGGGGTGGGGGTGG + Intergenic
948765452 2:240216805-240216827 TGGAAGGATGGGGGTGGGGGTGG + Intergenic
948765473 2:240216857-240216879 TGGAAGGATGGGGGTGGGGGTGG + Intergenic
948765497 2:240216909-240216931 TGGAAGGATGGGGGTGGGGGTGG + Intergenic
1170155996 20:13269910-13269932 TGGATGGATGGGTGTGTGGGTGG + Intronic
1171042067 20:21773901-21773923 TGGGAGGGTGGGGGTGTGAGTGG - Intergenic
1172646439 20:36473053-36473075 CGGAAGGATGGGAGTTTAAAAGG - Intronic
1173021314 20:39269919-39269941 TGGAAGGATGGATGGATGAGGGG - Intergenic
1173976606 20:47191514-47191536 TGGAGGGATGGGTGAATGAGTGG + Intergenic
1174106388 20:48165347-48165369 TGGGAGGAAGGGCCTTTGGGGGG + Intergenic
1174148057 20:48465969-48465991 TGGAAGGATGGACGGATGGGTGG + Intergenic
1174306959 20:49619923-49619945 TGGATGGATGGACGGATGAGTGG + Intergenic
1174619239 20:51861610-51861632 TGGAAGGATGGGTGGGTGGGTGG - Intergenic
1175094399 20:56530060-56530082 TGGATGGATGGGTGTGTGGGTGG - Intergenic
1175931666 20:62496501-62496523 GGGAGGGATGGGCGGTTGCGGGG + Intergenic
1176717347 21:10364434-10364456 AGGCAGGATGGCCGGTTGAGGGG - Intergenic
1178376585 21:32072568-32072590 TGGAAGGATGGACGGTTAAGTGG + Intergenic
1179551100 21:42144472-42144494 TGGATGGATGGATGGTTGAGTGG - Intergenic
1180298571 22:11017354-11017376 AGGCAGGATGGCCGGTTGAGGGG - Intergenic
1180600995 22:17015559-17015581 AGGCAGGATGGCCGGTTGAGGGG + Intergenic
1180837155 22:18935597-18935619 TTCAAAGCTGGGCGTTTGAGGGG + Intronic
1181064802 22:20300426-20300448 TTCAAAGCTGGGCGTTTGAGGGG - Intergenic
1181822684 22:25487844-25487866 TAGAAGGATGGGTGTGTGGGTGG + Intergenic
1182013288 22:27018422-27018444 TGGAAGGATGGATGGATGAGTGG - Intergenic
1182795773 22:32990488-32990510 TGGATGGATGGGCGAATGTGTGG - Intronic
1183078071 22:35439171-35439193 TGGGTGGATGGGCGGGTGAGTGG - Intergenic
1183741234 22:39669700-39669722 TGGATGGATGGGTGGGTGAGTGG + Intronic
1184321263 22:43743869-43743891 TGGATGGATGGGTGGGTGAGTGG + Intronic
1184653352 22:45929380-45929402 TGGAAGGATGGATGGGTGAGTGG - Intronic
1184653414 22:45929656-45929678 GGGAAGGATGGGCGGGTGGGTGG - Intronic
1185103635 22:48855068-48855090 TGGATGGATGGGCGGATAAGTGG - Intergenic
1203287248 22_KI270734v1_random:160896-160918 TTCAAAGCTGGGCGTTTGAGGGG + Intergenic
949149151 3:743753-743775 TGGAGGGAATGGCTTTTGAGTGG + Intergenic
949193239 3:1275086-1275108 TGGAAGGATCGGCCTTTGTAAGG - Intronic
950443732 3:13024313-13024335 TGGATGGATGGGTGGATGAGGGG - Intronic
950541877 3:13617804-13617826 TGGATGGATGGGTGAGTGAGTGG - Intronic
950725065 3:14911949-14911971 AGGAAGGATGGGAGTTTGGCAGG + Intronic
952708020 3:36399658-36399680 TTGAAGGATGGCCATATGAGGGG - Intronic
952846057 3:37688987-37689009 TGGGTGGATGGGTGTGTGAGTGG + Intronic
953069767 3:39507466-39507488 TGGAGGGATTGGCCTTTGATGGG + Intronic
955042505 3:55331649-55331671 TGGATGGATGGACGGATGAGTGG + Intergenic
955080081 3:55650176-55650198 TGGTGGGGTGGGCGTTTCAGTGG - Intronic
955368172 3:58329033-58329055 TGGAAGAACTGGGGTTTGAGAGG - Intergenic
957300143 3:78381365-78381387 TGGGAGGTGGGGCCTTTGAGAGG - Intergenic
958020717 3:87991869-87991891 TTGAAGGATGGGGGTTTTTGAGG + Exonic
958911507 3:99999407-99999429 TGGATGGATGGGTGGGTGAGTGG + Intronic
959151348 3:102612046-102612068 TGGAAGGTGGGGCCTTTAAGGGG - Intergenic
961808925 3:129510243-129510265 TGGAAGGCAGGGCATTTGAGAGG - Intronic
962043085 3:131727749-131727771 TGGAAGGAGGGAAGGTTGAGAGG - Intronic
962374824 3:134850964-134850986 TGGAAGGATGGGCCTTGGCCAGG + Intronic
962409590 3:135129443-135129465 TGGATGGAGGGGCCTTGGAGAGG - Intronic
963056625 3:141191406-141191428 TGGATGGATGGGCGGGTGAGTGG + Intergenic
964868107 3:161283874-161283896 TTGATTGATGGGCATTTGAGCGG - Intergenic
964869909 3:161302252-161302274 TGGAAGGCTGGGCCTAGGAGTGG - Intergenic
966131447 3:176645053-176645075 TGGAAAGTGGGGCCTTTGAGAGG + Intergenic
966243932 3:177785032-177785054 TGGAAGGATAGTCTTATGAGAGG + Intergenic
968246183 3:197151513-197151535 TGGAAGGTTGGGAGTAGGAGGGG + Intronic
968382596 4:108752-108774 TGGAAGGATGGGGTTTGGGGAGG - Intergenic
968403327 4:317138-317160 TGGAAGGATGGGGTTTTGGGAGG + Intergenic
968762124 4:2448074-2448096 TGGATGGATGGGTGGGTGAGTGG + Intronic
968924789 4:3541525-3541547 TGGGTGGATGGGTGGTTGAGTGG + Intergenic
968935890 4:3610191-3610213 TGGATGGATGGGTGGTTGAATGG - Intergenic
969462117 4:7334372-7334394 GGGAAGGAGGGGCGGGTGAGAGG - Intronic
969499412 4:7543840-7543862 TGGATGGATGGACGGATGAGTGG - Intronic
969517065 4:7653797-7653819 TGGGAGGAAGGGCGTTTGGGAGG - Intronic
969565413 4:7974459-7974481 TGGATGGATGGGTGTGTGGGTGG - Intronic
971198574 4:24492004-24492026 TGGATGGATGGGTGTGTGAGTGG + Intergenic
972254601 4:37339821-37339843 TGGGAGGATGGGAGGGTGAGAGG - Intronic
973049084 4:45572574-45572596 TAGGAGGGTGGGCCTTTGAGAGG - Intergenic
973951581 4:56020329-56020351 TGGAAGAATGAGCTTTTGAAAGG + Intronic
974635369 4:64557536-64557558 TGGAAGGAAGGGCATTCGTGTGG - Intergenic
975802916 4:78081115-78081137 TGTGAGGATGGGGGTTTGTGGGG + Intronic
975931888 4:79534392-79534414 TGGAAGAATTTGGGTTTGAGAGG + Intergenic
980791271 4:137622517-137622539 TGGGTGGGTGGGCGATTGAGTGG - Intergenic
981782976 4:148445922-148445944 TGGAAGATTGGGGGTTTGGGAGG + Intergenic
984561646 4:181277785-181277807 TGGGAGAAAGGGAGTTTGAGAGG - Intergenic
985199880 4:187474101-187474123 TGGAAGTCTGGGTGTTTGAATGG + Intergenic
985551941 5:538209-538231 TGGAAGGCTGGTGATTTGAGAGG + Intergenic
985560528 5:583935-583957 TGGCTGGATGGGTGGTTGAGTGG + Intergenic
985560563 5:584047-584069 TGGATGGATGGGTGGGTGAGTGG + Intergenic
985662882 5:1166115-1166137 TGGAAGGATGGATGTATGATTGG - Intergenic
985821211 5:2161305-2161327 TGGATGGATGGGTGGATGAGTGG - Intergenic
985829743 5:2219578-2219600 TGGAAGGATGGACGGTGGATAGG - Intergenic
985874476 5:2584832-2584854 TGGACGGATGGGTGGTTGAGTGG + Intergenic
985884831 5:2669871-2669893 TGGAAGGATGTGCGGTGGAAGGG - Intergenic
986249795 5:6045477-6045499 TGGAGGGATGGGAGCTTCAGGGG - Intergenic
986844197 5:11733943-11733965 TAGGAGGAGGGGCCTTTGAGAGG + Intronic
988833215 5:35007067-35007089 TGGGAGGTGGGGCCTTTGAGAGG + Intronic
989811482 5:45681967-45681989 TGGGAGGAGGGGCCTTTGGGAGG + Intronic
990327267 5:54690950-54690972 TGGAAGGTGGGAAGTTTGAGGGG - Intergenic
991069536 5:62461233-62461255 TGGGGGGATGGGGGGTTGAGAGG + Intronic
991662598 5:68965731-68965753 TGAAAGGATGTGTGTGTGAGAGG - Intergenic
992537185 5:77718900-77718922 TGGAAGGATTGATGTTAGAGTGG - Intronic
995632740 5:114151390-114151412 TGGAAGGAAGGGAGCTGGAGTGG - Intergenic
997139583 5:131364368-131364390 TGCAAGGTTGGGTGTGTGAGTGG + Intronic
997376872 5:133403671-133403693 TGGAAGGATGGAGGTATGAGGGG + Intronic
998901821 5:146863616-146863638 TGGATGGATGGGCAGTTGAATGG - Intronic
999136799 5:149325909-149325931 TGAAAAGATGGGACTTTGAGAGG - Intronic
1000532674 5:162443531-162443553 TGGAAGGGTGGGAGGTTGGGAGG + Intergenic
1000669187 5:164039558-164039580 TGGTAGGTGGGGCGTTTGGGAGG - Intergenic
1001481082 5:172089595-172089617 TGGACGGATGGGTGATTGGGTGG + Intronic
1001686465 5:173597891-173597913 TGGAGGGATGGGTGGGTGAGTGG - Intergenic
1001686497 5:173597975-173597997 TGGAGGGATGGGTGGGTGAGTGG - Intergenic
1001900148 5:175420472-175420494 TGGATGGATGGGTGTGTGGGTGG - Intergenic
1002536699 5:179879842-179879864 TGGATGGATGGGCGCATCAGAGG - Intronic
1002642278 5:180635878-180635900 TGGATGGATGGGAGTATGGGTGG + Intronic
1002816387 6:685155-685177 GGGAAGGGTGGACGTTTGGGAGG - Intronic
1004157120 6:13179636-13179658 TGGATGGATGGGTGGTTGATAGG + Intronic
1006056045 6:31385192-31385214 TGGAAGGATGGGCACATGAAGGG + Intergenic
1008511815 6:52283092-52283114 TGGAAGGAGGGGCATTTGGGAGG + Intronic
1008541043 6:52546689-52546711 TGGATGGCTGGGGGTGTGAGAGG + Intronic
1011227309 6:85121795-85121817 TGGGAGGTGGGGCCTTTGAGAGG + Intergenic
1012494271 6:99817080-99817102 TGGAATTATGGGTGTTTGGGAGG + Intergenic
1013747618 6:113364579-113364601 TCTAAGGATGGGATTTTGAGAGG - Intergenic
1014218421 6:118775671-118775693 TGGATGGATGGGTGGTTGAATGG - Intergenic
1014627904 6:123752019-123752041 TGGGAGGCAGGGCTTTTGAGAGG + Intergenic
1014734688 6:125078664-125078686 TGGGAGGTTGGGCCTTTAAGAGG - Intronic
1015502923 6:133952391-133952413 AGGAAGGATGGGAGTGGGAGAGG - Intronic
1017057577 6:150452023-150452045 TGGAAGGATGAGAGGTTCAGAGG + Intergenic
1018197235 6:161366072-161366094 TGGAAGGTGGGGCCTTTGGGAGG + Intronic
1019510760 7:1416179-1416201 TGGATGGATGGGTGGGTGAGTGG + Intergenic
1019530189 7:1499392-1499414 TGGGAGGATGGGCGGGTGGGAGG - Intronic
1020656573 7:10935567-10935589 TTGGAGGCTGGGCCTTTGAGAGG + Intronic
1021566800 7:22024200-22024222 TGGAAGGATGAGTGAATGAGAGG - Intergenic
1022953850 7:35363705-35363727 TGGAAGGGTGGGAGATGGAGTGG - Intergenic
1024457940 7:49630364-49630386 TGGGAGGATGGGCATTTGGATGG - Intergenic
1026873496 7:73867140-73867162 TGGATGGATGGGTGGATGAGTGG - Intergenic
1027190985 7:75995281-75995303 TGGAGGGATGGGGGTGGGAGGGG - Intergenic
1029599750 7:101556763-101556785 TGGGTGGATGGGCGGGTGAGTGG + Intronic
1030075581 7:105733738-105733760 TGGATGGATGGGTGGTTGGGTGG - Intronic
1030075602 7:105733802-105733824 TGGATGGATGGGTGGTTGGGTGG - Intronic
1030199567 7:106888784-106888806 TGAAAGGATGGGCTTTGTAGCGG + Intronic
1032547619 7:132756721-132756743 TTGAAGGAGGAGCGTTTGAAAGG - Intergenic
1033895412 7:146063597-146063619 TGGAAGGGTGGGAGGTTGGGAGG + Intergenic
1034270367 7:149800779-149800801 TGGATGGATGGGTGGGTGAGTGG - Intergenic
1034739855 7:153463676-153463698 TGGAAGGTCAGGCATTTGAGAGG - Intergenic
1035279070 7:157765972-157765994 TGGATGGATGGGTGTGTGGGTGG - Intronic
1035279124 7:157766211-157766233 TGGATGGATGGGTGTGTGGGTGG - Intronic
1035288518 7:157821950-157821972 TGGATGGATGGGTGGATGAGTGG - Intronic
1035318557 7:158013735-158013757 TGGATGGATGGGCGGGTGGGTGG - Intronic
1035318599 7:158013856-158013878 TGCAAGGATGGGTGGGTGAGTGG - Intronic
1035318644 7:158014048-158014070 TGCAAGGATGGGTGGGTGAGTGG - Intronic
1035404639 7:158589029-158589051 TTGAAGGATGGGAGGGTGAGGGG - Intergenic
1035661102 8:1349415-1349437 AGGTAGGAAGGGGGTTTGAGGGG + Intergenic
1036561547 8:9903771-9903793 TGGAGGGATGGGGGTGTGGGTGG + Intergenic
1036753589 8:11457788-11457810 TGGAAGGTGGGGAGTGTGAGAGG - Intronic
1037777163 8:21843074-21843096 TGGAAGGATTGGCATGGGAGAGG - Intergenic
1039798479 8:40934980-40935002 TGGGAGGAAGGGCGTCTCAGAGG + Intergenic
1042164553 8:65933147-65933169 AGGAAGGTAAGGCGTTTGAGGGG + Intergenic
1044921317 8:97172356-97172378 TGGATGGATGGGTGGCTGAGTGG + Intergenic
1046999263 8:120557284-120557306 TGGAAACACGGGCTTTTGAGGGG - Intronic
1047921257 8:129636799-129636821 TGGAAGGATGGAGGGTTAAGTGG + Intergenic
1048510859 8:135060948-135060970 TAGAAGGATGGGCAGTTGATAGG - Intergenic
1049287356 8:141783072-141783094 TGGATGGATGGGTGGATGAGTGG - Intergenic
1049320630 8:141994463-141994485 TGGATGGATGGGTGGATGAGTGG - Intergenic
1049348204 8:142150164-142150186 TGGAAGGGTGGATGTATGAGTGG + Intergenic
1049364237 8:142229028-142229050 TGGATGGATGGGTGGATGAGTGG + Intronic
1049576419 8:143391934-143391956 TGGATGGATGGGTGGATGAGTGG - Intergenic
1049576553 8:143392448-143392470 TGGATGGATGGGTGGATGAGTGG - Intergenic
1049576558 8:143392468-143392490 TGGATGGATGGGTGGATGAGTGG - Intergenic
1049757903 8:144318928-144318950 TGGAGGGATGGGGGTCTGAGTGG + Intronic
1053307705 9:36995804-36995826 GGGAGGGCTGGGCGTCTGAGGGG - Intronic
1053799859 9:41757492-41757514 TGGATGGATGGGTGGATGAGTGG + Intergenic
1054145350 9:61557441-61557463 TGGATGGATGGGCGGATGGGTGG - Intergenic
1054188267 9:61969546-61969568 TGGATGGATGGGTGGATGAGTGG + Intergenic
1054650247 9:67619030-67619052 TGGATGGATGGGTGGATGAGTGG - Intergenic
1056100153 9:83293360-83293382 TGGATGGATGGGCTTTTCAGAGG - Intronic
1056682425 9:88731020-88731042 TGGAAGGATGGGTGGATGATGGG - Intergenic
1057008704 9:91583243-91583265 TGGAAGGATGAGTGGATGAGTGG + Intronic
1057943263 9:99303311-99303333 AGGAAGGATGGGGGTGTGGGAGG + Intergenic
1058418904 9:104816632-104816654 TGGAAGGATGGGTGGGTGGGTGG + Intronic
1059058886 9:111014428-111014450 GGGAAGGATGGGAGTTTGGGGGG - Intronic
1060040912 9:120300220-120300242 TGGATGGATGGGTGGATGAGTGG + Intergenic
1060625237 9:125106517-125106539 GGGAAGAATGTGGGTTTGAGTGG - Intronic
1061950634 9:133933973-133933995 TGGAAGGATGGGTGAATGGGTGG + Intronic
1062217079 9:135395001-135395023 TGGAAGGGTGGGTGAATGAGGGG + Intergenic
1185497501 X:566408-566430 TGGATGGATGGGTGGATGAGTGG + Intergenic
1185616232 X:1423844-1423866 TGGATGGGTGGGCGTGTGAATGG - Intronic
1185616382 X:1424464-1424486 TGGATGGGTGGGCGTGTGAATGG - Intronic
1185624396 X:1472437-1472459 TGGATGGATGGGTGGGTGAGTGG + Intronic
1185624515 X:1472921-1472943 TAGATGGATGGGCGGGTGAGTGG + Intronic
1185856962 X:3544701-3544723 TGGAAGGTGGGGCCTTTGGGAGG + Intergenic
1185957022 X:4502467-4502489 TAGAAGGTGGGGCCTTTGAGAGG + Intergenic
1186208024 X:7220321-7220343 TGGGAGGAAGGGACTTTGAGAGG + Intronic
1186573181 X:10737694-10737716 TGGAAGGAAGGGTGTCAGAGAGG + Intronic
1187179938 X:16934636-16934658 TGGAAAGATGGGGGTTTATGTGG - Intergenic
1188431956 X:30113642-30113664 TGGGAGGTGGGGCATTTGAGAGG - Intergenic
1189959578 X:46311639-46311661 ATAAAGGATGGGCTTTTGAGAGG + Intergenic
1191219218 X:57968858-57968880 GGGAAGGATGGGTGTGTGAAAGG - Intergenic
1192205589 X:69093899-69093921 TGGAGGGATTGGAGTTTGGGGGG + Intergenic
1192277879 X:69651822-69651844 TGGAAGATTTGGCCTTTGAGAGG + Intronic
1194375791 X:93132355-93132377 TGAAAGGTAGGGCTTTTGAGAGG + Intergenic
1194971125 X:100345392-100345414 AGGAAGGATGGCCATTTGACAGG - Intronic
1196827781 X:119754475-119754497 TGCAAGAATGGATGTTTGAGTGG - Intergenic
1197895467 X:131308982-131309004 TGGAAGGTTGAGCCTTTAAGGGG + Intronic
1198746965 X:139900875-139900897 TAGAAGGTAGGGCCTTTGAGAGG + Intronic
1199852348 X:151734420-151734442 TGGAAGGATAAGCTTTTGAGGGG + Intergenic
1199976903 X:152899492-152899514 TGGAAGGAGGGGCAGGTGAGAGG - Intergenic
1200807272 Y:7445761-7445783 TGGAAGGTGGGGCCTTTGGGAGG - Intergenic