ID: 1150288962

View in Genome Browser
Species Human (GRCh38)
Location 17:63970977-63970999
Sequence GGGGTCCTACATGGAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288962_1150288966 -10 Left 1150288962 17:63970977-63970999 CCCATCCTTCCATGTAGGACCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1150288966 17:63970990-63971012 GTAGGACCCCATCTGCCCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 117
1150288962_1150288971 -1 Left 1150288962 17:63970977-63970999 CCCATCCTTCCATGTAGGACCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1150288971 17:63970999-63971021 CATCTGCCCTCTGGTCACGTGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1150288962_1150288970 -2 Left 1150288962 17:63970977-63970999 CCCATCCTTCCATGTAGGACCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1150288970 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 18
4: 119
1150288962_1150288974 15 Left 1150288962 17:63970977-63970999 CCCATCCTTCCATGTAGGACCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288962 Original CRISPR GGGGTCCTACATGGAAGGAT GGG (reversed) Intronic
902053337 1:13581293-13581315 GGGATCCTACAAGGTAGGAGCGG - Intergenic
902570953 1:17346744-17346766 GGGGTGCGGCATGGAAGGACAGG - Intronic
903758063 1:25676857-25676879 GGGGTACAACTTGGAAGGAAGGG - Intronic
904891919 1:33785689-33785711 AGGGACCTCCATGGTAGGATAGG - Intronic
907535433 1:55151265-55151287 GTGGTCCTAGATAGAAGGATAGG - Intronic
909502060 1:76345741-76345763 CGGGTCCTACTTGGAAGAAAGGG - Intronic
915697248 1:157756240-157756262 GAGGACCTTCATGGAAGGAAAGG + Intronic
1063233392 10:4088188-4088210 GGTGTCTTACATGGCAGGAATGG + Intergenic
1064221216 10:13441846-13441868 GGGGGGCTACAAGGAAGGTTTGG - Intronic
1064322720 10:14320610-14320632 AGGGCCCTACATGGAAGGTATGG - Intronic
1069909138 10:71749246-71749268 GGGGGCCTGCATGGCAGGAGTGG - Exonic
1071200460 10:83216186-83216208 AGGATTCTACATGGAGGGATAGG + Intergenic
1071726034 10:88199078-88199100 GGTGTCCTACAGGAAAGGGTAGG + Intergenic
1073123717 10:101136919-101136941 GGGGTCCCACAGGGCAGAATGGG - Exonic
1073948925 10:108784760-108784782 GGGGTCACACCTGGAACGATGGG + Intergenic
1074505019 10:114062232-114062254 AGGATCCCACATGAAAGGATGGG - Intergenic
1077030313 11:462550-462572 GGGCTCCTTCCTGGAAGGCTCGG + Intronic
1078101701 11:8333989-8334011 GTGGGCCTGCATGGCAGGATGGG + Intergenic
1080684708 11:34505475-34505497 GGGCTCCTGGATGGAAGGAAGGG - Intronic
1082958912 11:58900743-58900765 TGGGTGCTAAATGGAGGGATGGG - Intronic
1082965584 11:58963614-58963636 GTGGCGCTAAATGGAAGGATGGG - Intronic
1083185619 11:61016210-61016232 GGGGTCAGACAGGGCAGGATGGG - Intronic
1083793312 11:64999844-64999866 GAGCTCCTACATGGCAGGACTGG + Intergenic
1089030040 11:115316486-115316508 GAGGTGCCAAATGGAAGGATCGG - Intronic
1089061466 11:115629509-115629531 GGGGTGCTACATGGAGAAATTGG - Intergenic
1097955015 12:65475589-65475611 GGGGTATTACAAGAAAGGATAGG - Intronic
1101065768 12:101018754-101018776 ATGGTCTTACATGGAAGGAAAGG + Intronic
1101277412 12:103217789-103217811 GGGGCTCTACAAGGAAGGAAAGG - Intergenic
1106133629 13:26958606-26958628 GGGGTGCTCCATGGACAGATGGG + Intergenic
1112319527 13:98394445-98394467 GGGGGTCTCCAGGGAAGGATGGG - Intronic
1112595680 13:100804896-100804918 GGGATCCCACATGGCATGATGGG + Intergenic
1112802634 13:103129577-103129599 GGGTTCCTACATTGAAGGACAGG - Intergenic
1113908561 13:113831358-113831380 GCCGTCCTACAGGGAAGGGTGGG + Intronic
1119376767 14:74200708-74200730 GGGGTGCTACATAGAAGGTTAGG + Exonic
1119466503 14:74862870-74862892 GGGGTCATTCTTGGAGGGATAGG + Intronic
1120240397 14:81943204-81943226 TGGCTTCTACATAGAAGGATGGG + Intergenic
1124689033 15:31806523-31806545 AGGGGTCTGCATGGAAGGATGGG - Intronic
1127008613 15:54597506-54597528 GGGGTAAGACATGGAAGGAGAGG + Intronic
1128511410 15:68316073-68316095 GGGGTCCTTGATGGCAGGAAGGG + Intronic
1130727730 15:86457896-86457918 AGGGCCCCACATGGAAGAATCGG - Intronic
1136485494 16:30569516-30569538 GGGGACCTACATGGAGGGCGTGG - Exonic
1138126240 16:54440988-54441010 GGGGTACCCCAAGGAAGGATGGG + Intergenic
1140752382 16:78037117-78037139 GGGCTCCTCCATGAAAGGAATGG - Intronic
1147541518 17:41364146-41364168 AGGGTCATACAAGGAAGGCTGGG - Intronic
1149755384 17:59181711-59181733 AGGGACCTACATGGGAGGCTGGG + Intronic
1150288962 17:63970977-63970999 GGGGTCCTACATGGAAGGATGGG - Intronic
1161277772 19:3428502-3428524 GGCGTCCTTCTTGGAAGGACCGG + Intronic
1161407364 19:4098053-4098075 GTGGTCCTACCCGGATGGATTGG - Intronic
1162060646 19:8092895-8092917 GGGGACCCCCAGGGAAGGATGGG + Intronic
1162662477 19:12181227-12181249 GGGGTCCGACATGGCTGGAGGGG + Intronic
1166739509 19:45105429-45105451 GGTGTCCTACATGGAGAGATGGG - Intronic
925497516 2:4469002-4469024 GGATTCATGCATGGAAGGATTGG - Intergenic
937248707 2:120510343-120510365 GGGGTCCTGGATGGAGGGTTGGG - Intergenic
941268701 2:163397770-163397792 GGGGTCCCACATGGCAGGAATGG + Intergenic
945677088 2:212868696-212868718 AGGGTCCTAGATAGAAGGAAAGG + Intergenic
947018460 2:225647490-225647512 GGGGTCCTACAGAGAAGGCACGG - Intronic
948798309 2:240418448-240418470 AGGGTCCTAGATGGATGGCTAGG - Intergenic
1168924069 20:1565492-1565514 AGGGTCCTACATGGCAGGGAAGG + Exonic
1178300792 21:31451105-31451127 GAGGTCCCACATGCTAGGATAGG + Intronic
1179135444 21:38676534-38676556 GGGGTCATCTATGGAAGGTTTGG + Intergenic
1179175294 21:39003738-39003760 GGGGTCTTACATGAATGGAAGGG - Intergenic
1180181758 21:46121309-46121331 TGGGTCCTTCAGGGCAGGATGGG - Intronic
1182021957 22:27088973-27088995 TGGGTCCCAAATGGAAGAATGGG + Intergenic
1183237093 22:36627158-36627180 GGGGTCCTAGATGGGAGGGGAGG - Intronic
949193242 3:1275097-1275119 GAGAACCCACATGGAAGGATCGG - Intronic
950878077 3:16296243-16296265 AGGGTCCTACATTGGGGGATGGG - Intronic
952560474 3:34586961-34586983 GGGGTTCTACATGACAGGAATGG - Intergenic
952640706 3:35591787-35591809 GGGTTTTTACAGGGAAGGATAGG + Intergenic
953724168 3:45382915-45382937 GGAGGCCAAGATGGAAGGATTGG - Intergenic
954317170 3:49807436-49807458 GGGGTACTCCAAGGAAGGAGGGG + Intronic
954427836 3:50452852-50452874 GGGGCCCTGCATTGTAGGATGGG + Intronic
954698856 3:52441441-52441463 GGGGCCCCACAGGGGAGGATGGG + Intronic
961780683 3:129318526-129318548 GGTGTCCTACATGGCAGGGGCGG - Intergenic
963611207 3:147471081-147471103 GGGAGACTACTTGGAAGGATGGG - Intronic
971494060 4:27245572-27245594 CTGGTCCTACATGTAAGGGTGGG + Intergenic
972356053 4:38280342-38280364 GGAGACCTAGGTGGAAGGATGGG - Intergenic
973369375 4:49233584-49233606 GGGGTCCTGCCTGGACTGATTGG + Intergenic
973391662 4:49561832-49561854 GGGGTCCTGCCTGGACTGATTGG - Intergenic
974635370 4:64557547-64557569 GAGGTCTGACATGGAAGGAAGGG - Intergenic
981552233 4:145953720-145953742 GGGGTCCTGGTTGGAAGGACTGG - Intergenic
982065354 4:151649928-151649950 AGGGTCCTACATAGAAGAGTCGG + Exonic
984869237 4:184311947-184311969 GAGGTCCCAGATGGAGGGATTGG - Intergenic
986712613 5:10499060-10499082 GGGTTCCCACATGGAAGATTGGG - Intergenic
989821472 5:45799223-45799245 CTGTTCCTACATGGAAGGCTTGG - Intergenic
998474462 5:142408782-142408804 GGGATACTACAGGGAAGGCTGGG - Intergenic
999998069 5:157111455-157111477 GGGGGTAAACATGGAAGGATGGG - Intronic
1006645704 6:35512752-35512774 GGGGGCCTAGATGGAGGGATGGG - Intronic
1008154327 6:47995239-47995261 GGTGGCCAACATGGAATGATCGG + Intronic
1013821284 6:114156154-114156176 GGGATTCCACATGGAAGGAAAGG - Intronic
1014273918 6:119365482-119365504 GGGCTCCAAGATGGCAGGATTGG - Intergenic
1016087470 6:139931897-139931919 GAGGTCCTACAAGGGAGGAGGGG + Intergenic
1019955357 7:4410165-4410187 GGCGTCGTACATAGAAGGAGCGG + Intergenic
1023020615 7:36008753-36008775 GGACTCCCACATGGAAGGATAGG + Intergenic
1024379774 7:48683132-48683154 TGGGTCCTAAATTGAATGATTGG - Intergenic
1025031231 7:55558686-55558708 GGGGTTGGACATGGATGGATGGG - Intronic
1028599688 7:92588832-92588854 GGCGTCTTACATGGCAGGAGCGG - Intronic
1029976987 7:104844087-104844109 GTGGTCAAACAGGGAAGGATGGG - Intronic
1034384616 7:150729789-150729811 TGGATCCTTCATAGAAGGATTGG + Intronic
1035403751 7:158586005-158586027 GGAGTCCTGCATGGGAGGCTTGG - Intronic
1037813408 8:22099553-22099575 GAGGTCCTGCAGGGAAGGGTAGG - Intronic
1038002748 8:23404728-23404750 GGGGTCCTTCCTGGAATGGTAGG + Intronic
1038334986 8:26638836-26638858 GGGGCCCTCCATGGAAAGAGAGG - Intronic
1038581675 8:28753499-28753521 GGGGTCCTGTCCGGAAGGATGGG + Exonic
1039039540 8:33394334-33394356 GGGGTCCTGAGTGGATGGATGGG - Intronic
1040884006 8:52239745-52239767 GGGGTCCTATAAGAAAGAATAGG - Intronic
1049442938 8:142617423-142617445 GGGGTCCTGCAGGGGAGGGTGGG + Intergenic
1055363197 9:75517373-75517395 TGGGTTCCACCTGGAAGGATGGG + Intergenic
1061457460 9:130709451-130709473 TGGAACCTACATGGAAGGATGGG - Intergenic
1061750158 9:132771512-132771534 GGGGTCCTTCATGGACTGAAAGG + Intronic
1061867645 9:133501802-133501824 GGAGTCCCACATTGAAGGAATGG - Intergenic
1185665650 X:1763302-1763324 GGGGTCCTAAATGCAAGGACAGG + Intergenic
1186224207 X:7379983-7380005 GGGGTCCTACCTGAAAGTTTGGG + Intergenic
1194825595 X:98558961-98558983 GGAGTCCTAGAAGGAAAGATAGG - Intergenic
1198273629 X:135079998-135080020 GGGGTACTTCCTGGAAAGATTGG + Intergenic