ID: 1150288963

View in Genome Browser
Species Human (GRCh38)
Location 17:63970978-63971000
Sequence TGGGGTCCTACATGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288963_1150288974 14 Left 1150288963 17:63970978-63971000 CCATCCTTCCATGTAGGACCCCA 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288963_1150288971 -2 Left 1150288963 17:63970978-63971000 CCATCCTTCCATGTAGGACCCCA 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1150288971 17:63970999-63971021 CATCTGCCCTCTGGTCACGTGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1150288963_1150288970 -3 Left 1150288963 17:63970978-63971000 CCATCCTTCCATGTAGGACCCCA 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1150288970 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 18
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288963 Original CRISPR TGGGGTCCTACATGGAAGGA TGG (reversed) Intronic
902850055 1:19148203-19148225 TGGTGGCCTAGAAGGAAGGAAGG - Intronic
903758064 1:25676858-25676880 GGGGGTACAACTTGGAAGGAAGG - Intronic
907529945 1:55084929-55084951 TGGGTTGGTACATGGGAGGAAGG + Intronic
909502061 1:76345742-76345764 ACGGGTCCTACTTGGAAGAAAGG - Intronic
910562137 1:88601732-88601754 TGGGGTCCACCATGGAGGTAAGG + Intergenic
912501468 1:110125310-110125332 TGGGGTCCCATAGGGAAGGATGG - Intergenic
913674696 1:121129959-121129981 TGGGGTCATCCAGGGCAGGAGGG - Intergenic
914026537 1:143917589-143917611 TGGGGTCATCCAGGGCAGGAGGG - Intergenic
914664917 1:149825020-149825042 TGGGGTCATCCAGGGCAGGAGGG - Intergenic
914670848 1:149868800-149868822 TGGGGTCATCCAGGGCAGGAGGG + Intronic
915454851 1:156033464-156033486 TGGGGTCAAGCAAGGAAGGAAGG - Intergenic
915535608 1:156533718-156533740 AGGGGACCTGCATGGAGGGAGGG - Intronic
915938294 1:160101619-160101641 TGGGGTAGTACATGGAGGGCAGG - Intergenic
916072286 1:161177294-161177316 CGGGGTCCTAGGTGGAAGTATGG - Intronic
919179482 1:194062022-194062044 TGGTGTCCAGCATGGAAGGCTGG + Intergenic
919751490 1:201040707-201040729 TGGGGTCCTGTATGCAAGAAGGG + Exonic
921071800 1:211665932-211665954 TGCTGTCCTACATGGAATAAGGG + Intronic
922820591 1:228482740-228482762 GAGGGTCCTGGATGGAAGGAAGG + Intergenic
924416279 1:243859916-243859938 AGGGAGCCTAGATGGAAGGAAGG + Intergenic
1065093644 10:22260387-22260409 TGGGGACATCCATGGAAAGAGGG - Intergenic
1067385805 10:45817161-45817183 TGAGGTCGGGCATGGAAGGAGGG - Intronic
1069073525 10:64014454-64014476 AGGGTTCCTGCATGGGAGGAGGG + Intergenic
1069153906 10:65000810-65000832 TGGGGTCATAAATAGAAGGCAGG + Intergenic
1071423991 10:85529780-85529802 TGGTGGCCTACAGGGATGGACGG + Intergenic
1073123718 10:101136920-101136942 TGGGGTCCCACAGGGCAGAATGG - Exonic
1073996306 10:109318903-109318925 TAGGGTCCTACAAGCAATGATGG + Intergenic
1076799293 10:132813263-132813285 TGGGATCCTGTATGGAAGGAGGG - Intronic
1077549692 11:3194552-3194574 CTGGGGCCAACATGGAAGGAGGG - Intergenic
1079746359 11:24136484-24136506 TCGATTCCTACATAGAAGGAAGG - Intergenic
1079837249 11:25350346-25350368 TGGGGGCTCACAAGGAAGGAGGG + Intergenic
1080684709 11:34505476-34505498 AGGGCTCCTGGATGGAAGGAAGG - Intronic
1082958913 11:58900744-58900766 TTGGGTGCTAAATGGAGGGATGG - Intronic
1082965585 11:58963615-58963637 TGTGGCGCTAAATGGAAGGATGG - Intronic
1083185620 11:61016211-61016233 TGGGGTCAGACAGGGCAGGATGG - Intronic
1088228999 11:107654230-107654252 TGGGATCTCACATGGAAAGATGG + Intronic
1089383441 11:118052369-118052391 TGGGGCCCTGCAGGGAAGCAGGG + Intergenic
1091096059 11:132823254-132823276 TGAGGTTCTACTGGGAAGGAAGG - Intronic
1092266114 12:6981767-6981789 GAGGGACCTACATGTAAGGAAGG + Intronic
1093269272 12:17038937-17038959 TGTGTTCTTACATGGCAGGAAGG - Intergenic
1093553345 12:20441664-20441686 TTTGGTACTACAGGGAAGGATGG + Intronic
1097155220 12:57007088-57007110 TGGCCACCTAGATGGAAGGAGGG - Intergenic
1102250992 12:111387574-111387596 TGCGGTCCTCAATGGATGGATGG - Intergenic
1106622076 13:31380360-31380382 TGGACTACTAGATGGAAGGAGGG + Intergenic
1109335227 13:60985657-60985679 TAAGGTGCTACATGGAAGCAGGG + Intergenic
1112205653 13:97321079-97321101 TGGGATCCTAGTTGGAAGTAGGG - Intronic
1112595679 13:100804895-100804917 TGGGATCCCACATGGCATGATGG + Intergenic
1113699896 13:112376468-112376490 TGGGGCCCTACCTGGAATCACGG - Exonic
1114556568 14:23565691-23565713 TGGGGTACCACCTGGAGGGAGGG + Exonic
1119269422 14:73288926-73288948 TGTGGTCCTACTTGGGAGGTGGG + Intronic
1121321420 14:92993875-92993897 TTGAGGCCTACATGGAAGGTAGG - Exonic
1126309781 15:47302492-47302514 TGTTGCCCTACATGGAATGAGGG + Intronic
1127151134 15:56076477-56076499 TGGTCTTCCACATGGAAGGAAGG - Intergenic
1127265202 15:57355393-57355415 TGGCGAGCTACATGGAAGGAGGG - Intergenic
1127471662 15:59295755-59295777 TGGGGTCCTCCAAAGCAGGAGGG - Intronic
1128511409 15:68316072-68316094 AGGGGTCCTTGATGGCAGGAAGG + Intronic
1128543354 15:68551866-68551888 TGGGGTTCTTCATGGAAGTGAGG + Intergenic
1129198320 15:73984003-73984025 TGGGGGCCTACATGAGTGGACGG - Exonic
1130968632 15:88715708-88715730 TGGGGTCCTAGAGGCAGGGATGG - Intergenic
1130985813 15:88843693-88843715 TGGGGTCCTAGAGGGAAGAGGGG + Intronic
1131108418 15:89749956-89749978 TGGGTCCCTCCATGGAGGGAGGG + Exonic
1134344211 16:13374318-13374340 TGGGGTCTGTCATGGATGGAGGG - Intergenic
1134829518 16:17311964-17311986 TGGGTCCCTCCATGGAGGGAGGG + Intronic
1135152582 16:20021925-20021947 GGGGGTCCTACAGGGAAGACGGG - Intergenic
1135755604 16:25095237-25095259 TGTGGTCCTACAGGAAAGGCTGG + Intergenic
1137252942 16:46753172-46753194 TGGGGTCCTACAGGGAAAGCTGG - Intronic
1140661516 16:77194321-77194343 TGTGGTCCTCTAGGGAAGGAAGG - Exonic
1141955287 16:87366731-87366753 TGGGCTGCTACATGGAGAGAGGG + Intronic
1146534207 17:33635784-33635806 TGGGGACCTACCAGGAAGGCAGG - Intronic
1147541519 17:41364147-41364169 TAGGGTCATACAAGGAAGGCTGG - Intronic
1148742029 17:49898364-49898386 TGGGGTCCTACAGGGAGGGAGGG + Intergenic
1148876346 17:50689723-50689745 TGGGGTCCTAAATGGGAGTGGGG - Intronic
1148995283 17:51704101-51704123 TGGGTTAGTACATGGATGGATGG - Intronic
1149533837 17:57416886-57416908 TGGGTTCCTGAATGCAAGGATGG - Intronic
1150288963 17:63970978-63971000 TGGGGTCCTACATGGAAGGATGG - Intronic
1152137052 17:78510692-78510714 TGCGGTTTTACAGGGAAGGAAGG - Intronic
1153874704 18:9358755-9358777 TCAGGTGTTACATGGAAGGATGG + Intronic
1154083590 18:11280873-11280895 CGGGGTCTTACATAGAGGGAAGG + Intergenic
1156366535 18:36432622-36432644 TGGGGTCACACATGGAAGGGAGG + Intronic
1157083432 18:44552944-44552966 TGGGCTCCTGCAGGGAAGGAAGG - Intergenic
1160709620 19:544996-545018 TGGGTGGATACATGGAAGGAGGG - Intronic
1160764045 19:799166-799188 TGGGGTCCTGCTGGGAGGGAGGG + Intronic
1161235584 19:3196518-3196540 GGGGGTCCATGATGGAAGGAAGG - Intronic
1162054430 19:8054191-8054213 TGGGGGCAGACAGGGAAGGAGGG - Intronic
1162060645 19:8092894-8092916 TGGGGACCCCCAGGGAAGGATGG + Intronic
1162662476 19:12181226-12181248 TGGGGTCCGACATGGCTGGAGGG + Intronic
1162748510 19:12813227-12813249 GGGGGTGCTATAGGGAAGGAAGG + Intronic
1164051530 19:21588249-21588271 GGGGGAGCCACATGGAAGGAGGG + Intergenic
1166343302 19:42151134-42151156 TGGGGACCCAGATGGGAGGAGGG + Intronic
1166739510 19:45105430-45105452 CGGTGTCCTACATGGAGAGATGG - Intronic
1168161495 19:54513186-54513208 TGGGGCCCAACATGGAGGGGAGG + Intergenic
929129155 2:38549255-38549277 TGGGAGCCTAGTTGGAAGGAGGG + Intergenic
934947491 2:98552242-98552264 TGGGGTCAGACATGAGAGGAAGG + Intronic
935050834 2:99523736-99523758 TGGGGTCCTGCTTGAAAGGCAGG - Intergenic
935555844 2:104508745-104508767 TGGGGACCCACATGGAGGAAGGG + Intergenic
935876309 2:107511837-107511859 AAGAGGCCTACATGGAAGGATGG + Intergenic
937225983 2:120368996-120369018 AGAGGTCCTGGATGGAAGGAGGG + Intergenic
937953358 2:127405260-127405282 TGGGGTGCTATTAGGAAGGAAGG + Intergenic
938255695 2:129858384-129858406 TGGGGTCCCAGGTGGAGGGAAGG + Intergenic
938541884 2:132289802-132289824 TGGGGCCCTGCATGGGGGGAGGG - Intergenic
938939986 2:136161625-136161647 TGGCCTCCTCCATGAAAGGAGGG - Intergenic
939740370 2:145899208-145899230 AGGGGCCCTATCTGGAAGGAAGG - Intergenic
942725853 2:179006918-179006940 TGGTTTCTCACATGGAAGGAGGG - Intronic
946743868 2:222826863-222826885 TGGGGTCATAGTTGGATGGATGG + Intergenic
948436966 2:237960496-237960518 TGGGGTCCTCCGTGGCATGAGGG - Intergenic
1169408682 20:5348488-5348510 TGTGGTCTTACTTGGAAGTAAGG + Intergenic
1169607963 20:7344674-7344696 TTGTGTCCTACATGGCAGAAAGG - Intergenic
1171870763 20:30522683-30522705 TGGGGCCCTGCATGGGGGGAGGG - Intergenic
1173053599 20:39589453-39589475 TCGGGACATTCATGGAAGGAGGG + Intergenic
1175767005 20:61598797-61598819 CGGGGTCCTCCATGGAAGTGTGG + Intronic
1178459404 21:32788684-32788706 TGGGCTACTGCATGGAAGGTGGG + Intergenic
1179175295 21:39003739-39003761 TGGGGTCTTACATGAATGGAAGG - Intergenic
1179175622 21:39005830-39005852 TGGGGTCTTACACGAATGGAAGG - Intergenic
1180883341 22:19222253-19222275 TGGGATTCTACTTGGAAAGAGGG + Intronic
1183687243 22:39368192-39368214 TGAGGTCATGCATGCAAGGAAGG - Intronic
1183698862 22:39438337-39438359 TGGGTTTATACCTGGAAGGAAGG - Intergenic
1184970821 22:48018768-48018790 TGGGACCCTACTTGGAAGGCAGG + Intergenic
949883561 3:8678777-8678799 TGGGGTCCTAAGTGGCAGGGAGG - Intronic
950055005 3:10017445-10017467 TGGGGTTCTAGCTGGAAGGTTGG - Intergenic
950242076 3:11379532-11379554 TGGGGTCTCACAAGGAAAGATGG - Intronic
953034080 3:39196620-39196642 TGGAGCCCTACTTGGAGGGAGGG - Intergenic
954317169 3:49807435-49807457 AGGGGTACTCCAAGGAAGGAGGG + Intronic
954427835 3:50452851-50452873 TGGGGCCCTGCATTGTAGGATGG + Intronic
957927923 3:86839112-86839134 TGTGTTCCTACATGGTGGGAAGG + Intergenic
961227940 3:125270562-125270584 GGGGGCCCTACATTAAAGGAAGG + Intronic
961230617 3:125304171-125304193 AGGGCTTCTACATGGGAGGATGG + Intronic
962386378 3:134935921-134935943 TGGGACCCTGCAAGGAAGGAAGG + Intronic
963611208 3:147471082-147471104 TGGGAGACTACTTGGAAGGATGG - Intronic
965834026 3:172830966-172830988 TGGGGTCCCACAGGGAAGAAAGG + Intergenic
966507553 3:180723945-180723967 AGTGGTCCTACATGAAAGAAAGG - Intronic
968893983 4:3388167-3388189 TGGGGCTCTCCATGGAGGGACGG - Intronic
970035835 4:11734973-11734995 TGTAGCCCCACATGGAAGGAAGG + Intergenic
973735246 4:53865087-53865109 TGAGGTCCAATTTGGAAGGAAGG + Intronic
974635371 4:64557548-64557570 AGAGGTCTGACATGGAAGGAAGG - Intergenic
978390899 4:108224244-108224266 TTGGGTCCTATCTGGAATGAAGG - Intergenic
982356765 4:154478433-154478455 AGGGGTCCAAAATGGAAGAATGG + Intronic
990953224 5:61319073-61319095 TGGGGTCCTTCATGGGCAGAAGG + Intergenic
992997626 5:82348343-82348365 TGGGAGCTTACATAGAAGGAGGG - Intronic
998474463 5:142408783-142408805 TGGGATACTACAGGGAAGGCTGG - Intergenic
999243167 5:150139043-150139065 TGGAGTGCCACATGGGAGGAGGG - Intronic
999998070 5:157111456-157111478 TGGGGGTAAACATGGAAGGATGG - Intronic
1000907939 5:166986064-166986086 TGGGGACAAAGATGGAAGGATGG + Intergenic
1006645705 6:35512753-35512775 GGGGGGCCTAGATGGAGGGATGG - Intronic
1006874415 6:37282778-37282800 GGTGGTCTTACATGGATGGAAGG + Intronic
1008278493 6:49568161-49568183 TGGGGTTGCCCATGGAAGGAAGG + Intergenic
1008556666 6:52679239-52679261 TGGAGACCTACCTGGGAGGAGGG - Intronic
1015343218 6:132126399-132126421 TTGTATCCTACATGGCAGGAGGG + Intergenic
1016087469 6:139931896-139931918 TGAGGTCCTACAAGGGAGGAGGG + Intergenic
1017751366 6:157492815-157492837 TGGGGACCCAGATGGGAGGAGGG + Intronic
1023926701 7:44674841-44674863 TGGGGTCTAACCTGGAGGGAAGG + Intronic
1025031232 7:55558687-55558709 TGGGGTTGGACATGGATGGATGG - Intronic
1029422410 7:100478158-100478180 CTGGGTCCGACATGGCAGGAGGG + Exonic
1029976988 7:104844088-104844110 TGTGGTCAAACAGGGAAGGATGG - Intronic
1031355172 7:120780519-120780541 TGGGGTCCTACACAGATGGGAGG + Intergenic
1031540939 7:122993660-122993682 TGGGGTCCTGCAAGGGAAGAAGG + Intergenic
1032502888 7:132413283-132413305 TGGGCTGCTCCAGGGAAGGAAGG - Intronic
1037499241 8:19469660-19469682 CGGAGACCTACATGGTAGGAAGG - Intronic
1038581674 8:28753498-28753520 TGGGGTCCTGTCCGGAAGGATGG + Exonic
1045329656 8:101144179-101144201 TGGGGTCCTAGAGGGCAGGATGG - Intergenic
1049252524 8:141596880-141596902 TCAGATCCTCCATGGAAGGAGGG - Intergenic
1052009205 9:23385953-23385975 TGGGGGACTACAGGGAAGGTGGG + Intergenic
1052726405 9:32233135-32233157 TGTGGTCCTAGATAGGAGGATGG + Intergenic
1053141331 9:35684681-35684703 TGGGGTCCCACAGGGGAGGGAGG - Intronic
1053316033 9:37052502-37052524 TTGAGTCCTAAATGGAAGAAAGG - Intergenic
1053422656 9:37989511-37989533 TGAAGTGCTATATGGAAGGAGGG - Intronic
1055078621 9:72244238-72244260 TGGGGTCACAAATGGAAGCATGG - Intronic
1057220956 9:93257461-93257483 TGGGGTCCTTCAGGGAGGGCGGG + Intronic
1057266909 9:93623160-93623182 TGGGGTCTCACATGGATGTAGGG + Intronic
1057379229 9:94553875-94553897 TGGTGGCCTCCATGGAAGGATGG - Intergenic
1057776577 9:98015588-98015610 AGAGGGACTACATGGAAGGAAGG - Exonic
1058146973 9:101423190-101423212 TGAGGCCCTAAAGGGAAGGAAGG - Intronic
1061457461 9:130709452-130709474 ATGGAACCTACATGGAAGGATGG - Intergenic
1061992890 9:134169818-134169840 TGGGCACCCACAAGGAAGGAAGG + Intergenic
1062468187 9:136690749-136690771 TGATGTCCTCCCTGGAAGGAAGG - Intergenic
1185613142 X:1403861-1403883 TGGGGAGGTACATGGATGGATGG + Intronic
1186224206 X:7379982-7380004 TGGGGTCCTACCTGAAAGTTTGG + Intergenic
1186284208 X:8026795-8026817 TGGGTTGGTACATGGATGGAAGG - Intergenic
1193326222 X:80181174-80181196 TGGGATCCTACTTGTAAGCAAGG + Intergenic
1198229489 X:134675697-134675719 TGGGGACATAAATGGCAGGAGGG - Intronic