ID: 1150288964

View in Genome Browser
Species Human (GRCh38)
Location 17:63970982-63971004
Sequence CAGATGGGGTCCTACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288964_1150288971 -6 Left 1150288964 17:63970982-63971004 CCTTCCATGTAGGACCCCATCTG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1150288971 17:63970999-63971021 CATCTGCCCTCTGGTCACGTGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1150288964_1150288970 -7 Left 1150288964 17:63970982-63971004 CCTTCCATGTAGGACCCCATCTG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1150288970 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 18
4: 119
1150288964_1150288974 10 Left 1150288964 17:63970982-63971004 CCTTCCATGTAGGACCCCATCTG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288964 Original CRISPR CAGATGGGGTCCTACATGGA AGG (reversed) Intronic
900799880 1:4730708-4730730 CAGATGTGGCTCAACATGGAAGG - Intronic
904300084 1:29548767-29548789 CAGCTAGGGTCCCAGATGGATGG - Intergenic
907080460 1:51617108-51617130 AAGATGGCGTCCATCATGGAAGG + Exonic
908047747 1:60189803-60189825 CAGATGGTGTCTTTCAAGGAAGG - Intergenic
910268079 1:85362073-85362095 CAGATGGGATCTGTCATGGAGGG - Intronic
915964060 1:160291278-160291300 CAGATCAGCTCTTACATGGAGGG - Intronic
919658810 1:200223078-200223100 CAGAATGGGTCATGCATGGAAGG + Intergenic
921591037 1:217003849-217003871 CATATGGGTACATACATGGATGG + Intronic
922820590 1:228482736-228482758 CAGAGAGGGTCCTGGATGGAAGG + Intergenic
1064322721 10:14320615-14320637 GAGAAAGGGCCCTACATGGAAGG - Intronic
1069663150 10:70137196-70137218 CAGATCACGTCTTACATGGATGG + Intergenic
1071274321 10:84038953-84038975 GAGATGGGGGGCTACATAGAGGG + Intergenic
1072664426 10:97383581-97383603 CAGTTGGTGACCTGCATGGAGGG - Intronic
1077580050 11:3411376-3411398 GAGATGGGGTCCTGAATGCATGG + Intergenic
1077810609 11:5632752-5632774 CAGGTAGGGCCCTAGATGGAGGG + Exonic
1079041956 11:17067456-17067478 CAGATAGGGTACTACAGGAATGG + Intergenic
1080314272 11:30931888-30931910 CAGATGGGTTTCTTCATGGGAGG + Intronic
1083511608 11:63213856-63213878 CAGATGGGGTGCGATATGCAAGG + Intronic
1084236969 11:67794204-67794226 GAGATGGGGTCCTGAATGCATGG + Intergenic
1084480406 11:69416503-69416525 CAGATGGGGTCCTCTAGGGATGG + Intergenic
1085795851 11:79538916-79538938 CAGGTGGGGTCAGACATGCACGG + Intergenic
1087798804 11:102482081-102482103 CAGATGGGGTTCTACAATGTTGG - Intronic
1088398005 11:109389959-109389981 TTGAGGGTGTCCTACATGGAAGG - Intergenic
1089370750 11:117954573-117954595 CAGATTGGGTGCTGCACGGATGG + Intergenic
1089377091 11:118002144-118002166 CACATGGGGTTTTTCATGGAGGG - Intergenic
1089762777 11:120740527-120740549 CAGCTGGGGCCCTATATGGGTGG - Intronic
1090240209 11:125176389-125176411 CAGATGGGTTCCTGCCGGGAGGG + Intronic
1091661063 12:2384022-2384044 CAGATGAGGTTCTCCATGTAGGG - Intronic
1094289085 12:28825978-28826000 CCTCTGGGGTCCTAGATGGAAGG - Intergenic
1096080362 12:48828607-48828629 CAGATGGGAGCCAACCTGGATGG + Exonic
1102224976 12:111222095-111222117 CAGATGGGGTTGTTGATGGATGG + Intronic
1102254383 12:111407218-111407240 CAGCTGGGGGCCTCCAGGGAGGG + Intronic
1102460577 12:113097300-113097322 CAGATGGGGATCCACATGGGGGG - Exonic
1104116975 12:125759309-125759331 CAGGTGGCTTCCTAGATGGATGG + Intergenic
1104286349 12:127428215-127428237 CAGATGAGGGGCTTCATGGATGG - Intergenic
1104973490 12:132541822-132541844 AAGATGGGGTCCCACAGGGCAGG + Intronic
1107103351 13:36617778-36617800 CAAATCAGGTCTTACATGGATGG - Intergenic
1107446906 13:40477819-40477841 CAGATGGGGAAATACATTGAAGG + Intergenic
1108145843 13:47475874-47475896 CAAATTGTGTCCTACATAGAAGG + Intergenic
1110081986 13:71325407-71325429 CAGATGTGGACCTACATTCAGGG - Intergenic
1110487769 13:76067228-76067250 CAAATCGGGTCTTACATGGATGG - Intergenic
1114556566 14:23565687-23565709 CAGCTGGGGTACCACCTGGAGGG + Exonic
1116876895 14:50121095-50121117 CTTATGGGTTCCTATATGGAGGG - Intronic
1119376766 14:74200703-74200725 CTGCTGGGGTGCTACATAGAAGG + Exonic
1120871092 14:89338117-89338139 CAGATGGGGAAGTAGATGGAAGG + Intronic
1121004411 14:90479664-90479686 CTGATGGGGTTCTGCATGGCCGG + Intergenic
1121321421 14:92993879-92993901 AAGATTGAGGCCTACATGGAAGG - Exonic
1121454564 14:94030032-94030054 CACATGGGGTCAGACATGGGAGG + Intronic
1122026133 14:98878718-98878740 CAAGTGACGTCCTACATGGATGG + Intergenic
1122250470 14:100435763-100435785 CAGATGGGGATCTTCATGGCTGG + Intronic
1122785380 14:104161042-104161064 TAGCTGGGGACCCACATGGAAGG + Intronic
1122836755 14:104434388-104434410 CAGGTGGGGACCAGCATGGATGG + Intergenic
1127265204 15:57355397-57355419 CAGCTGGCGAGCTACATGGAAGG - Intergenic
1129799956 15:78406134-78406156 CAGATGGGCTCCTGGGTGGAGGG + Intergenic
1131676442 15:94675016-94675038 CAGGTGGATTCTTACATGGAAGG - Intergenic
1132917993 16:2364502-2364524 CATATGGGGTCCTAGATTTAAGG - Intergenic
1133298336 16:4766678-4766700 TAGAGTGGGTCCTATATGGAAGG + Intronic
1133387476 16:5381591-5381613 CAGCTAAGGTCCCACATGGAAGG - Intergenic
1135638572 16:24100427-24100449 CAGAGAGGGTGCTGCATGGAGGG - Intronic
1137065670 16:35840369-35840391 CATATGGGCTACAACATGGATGG + Intergenic
1141990385 16:87605904-87605926 CAGATGGGGAGCTTCATGGCCGG + Intronic
1144727164 17:17507692-17507714 CTGCTGGGGTCCTACATGCCGGG + Intronic
1147358197 17:39913823-39913845 CAGATGGGAACCTACAGGGGAGG + Intronic
1147986532 17:44310292-44310314 GAGCTAGGCTCCTACATGGATGG - Intronic
1148742026 17:49898360-49898382 CTCCTGGGGTCCTACAGGGAGGG + Intergenic
1148995284 17:51704105-51704127 TAGATGGGTTAGTACATGGATGG - Intronic
1149522512 17:57328391-57328413 CAGATGGGGGACAAGATGGATGG - Intronic
1150288964 17:63970982-63971004 CAGATGGGGTCCTACATGGAAGG - Intronic
1151979049 17:77498344-77498366 CAGATCTGGTCCAACATGGTGGG + Intronic
1152018125 17:77765395-77765417 CAGATGGGAACTTAGATGGATGG + Intergenic
1154267906 18:12894970-12894992 GAGATGGAGTCTTACATGGGAGG + Intronic
1155155760 18:23156145-23156167 CAGAGGGGGGGCTCCATGGAGGG + Intronic
1156366533 18:36432618-36432640 ATGATGGGGTCACACATGGAAGG + Intronic
1157083433 18:44552948-44552970 GAGATGGGCTCCTGCAGGGAAGG - Intergenic
1157686208 18:49644731-49644753 CAGAGGGGGCCCTGCATGCATGG + Intergenic
1160875040 19:1292970-1292992 CAGAGGGGGACCTACAGGGCTGG + Intronic
1162788768 19:13052365-13052387 CAGATGGGAGCCCACCTGGATGG + Intronic
1165160662 19:33813782-33813804 CAGATGGGCCCCTTCATGGTGGG - Exonic
1167043278 19:47035438-47035460 AAGATGGGGGCCTGCATTGAGGG + Intronic
1167552511 19:50170645-50170667 CAGGTCGGGGCCTACAAGGACGG - Intergenic
925903268 2:8523685-8523707 CAGATGGAGTCCTGGATGGAGGG - Intergenic
925942028 2:8830021-8830043 AGGATGGTGTTCTACATGGAAGG - Intronic
926958875 2:18332433-18332455 CAGACGGGCTCCTAGGTGGAAGG - Intronic
927825018 2:26302326-26302348 CAGATGGGGTACGATATGCAGGG + Intergenic
930558616 2:52930850-52930872 CAAATTGTGTCTTACATGGATGG + Intergenic
930922277 2:56770607-56770629 CTGATGGGGACATACATTGATGG + Intergenic
936509922 2:113137163-113137185 GAGATGGGGTCCTACTCAGAGGG + Intergenic
938692001 2:133800357-133800379 CAGATGAGGTCCCTCTTGGAGGG - Intergenic
939208692 2:139142748-139142770 CAGATGGGATTCTACAAAGAAGG + Intergenic
945127138 2:206524968-206524990 CACATCGAGTTCTACATGGAAGG - Intronic
946529554 2:220557195-220557217 CAGAGGTGGTCCATCATGGAGGG + Intergenic
946743867 2:222826859-222826881 GAGATGGGGTCATAGTTGGATGG + Intergenic
1170469545 20:16654776-16654798 CAGATGGGGTGTAAAATGGAGGG + Intergenic
1175121320 20:56718279-56718301 CAGATGGGCACCTCCAGGGAAGG - Intergenic
1176095984 20:63344871-63344893 CAGATGGGGTCCTGAATACACGG + Exonic
1177699099 21:24613985-24614007 CAAATCATGTCCTACATGGATGG - Intergenic
1179081934 21:38179401-38179423 CTGATGAGGACCTGCATGGAAGG + Intronic
1179175296 21:39003743-39003765 AAGATGGGGTCTTACATGAATGG - Intergenic
1179175623 21:39005834-39005856 AAGATGGGGTCTTACACGAATGG - Intergenic
1179911809 21:44454936-44454958 CAGAAGGGGACCTAGATGGGCGG + Intergenic
1183237096 22:36627163-36627185 TAGATGGGGTCCTAGATGGGAGG - Intronic
950027265 3:9828823-9828845 GAGATGGGGCCCTACTGGGAAGG - Intronic
950096886 3:10335783-10335805 CAGAGGGGGACAGACATGGAGGG - Intronic
950192661 3:10988554-10988576 CAGATGGGGTCCTGGACAGAGGG + Intergenic
955929645 3:64043896-64043918 CAACTGGGGTCCCACATGGCTGG + Intergenic
961011246 3:123437581-123437603 TAGATGAGGTCATGCATGGAAGG + Intronic
961948990 3:130726940-130726962 TAGATGAAGTCCTAGATGGAAGG + Intronic
962332792 3:134494472-134494494 CAGCTGGGGAACTACATGAAGGG - Intronic
968725471 4:2245930-2245952 CAGGCAGGGTCCTACTTGGAGGG + Intergenic
969503712 4:7570695-7570717 CAGATGGGGTCTGGCAGGGAGGG - Intronic
972592823 4:40504240-40504262 AAGCTGGGGTCTTTCATGGAAGG + Intronic
978123936 4:105112896-105112918 CAGATGAGAGCCTACAGGGAAGG + Intergenic
978615419 4:110588699-110588721 AAAATGCGGTCCTACTTGGAAGG + Intergenic
984040614 4:174728586-174728608 CAAATGGAGTCCAACATGGAGGG + Exonic
986148820 5:5107805-5107827 CTGATTGCTTCCTACATGGAAGG + Intergenic
992114562 5:73527002-73527024 CAGCTCAGGTCCTACAAGGAAGG - Intergenic
999471648 5:151859896-151859918 CAGATGGAGTCCAGCATGGATGG + Exonic
999818068 5:155197775-155197797 GAGATGGGGTCCTAGTTGGCTGG - Intergenic
1005790577 6:29295896-29295918 CAGACGGGCTCCTAGGTGGAAGG + Intergenic
1005864467 6:29927369-29927391 CAGATCAGGGCCTACCTGGAGGG + Intergenic
1006732735 6:36248315-36248337 TAGATGAGGTGCTACATGCAGGG - Intronic
1014619633 6:123649984-123650006 AAAATAGGGTCCTACAAGGATGG + Intergenic
1017425671 6:154318475-154318497 CAGATTGGGACCGAGATGGAAGG + Intronic
1020500045 7:8906541-8906563 CAGATGGGCTTCTGCCTGGAGGG + Intergenic
1031786552 7:126040820-126040842 CAGACAGGGTCCTGGATGGAAGG + Intergenic
1032487121 7:132296329-132296351 CAGATGGGCACCTCCAGGGAAGG + Intronic
1032886274 7:136142533-136142555 CAGATGATGACCTACATGCATGG + Intergenic
1034211579 7:149367957-149367979 CAGATGGCTTCCTACCAGGAGGG - Intergenic
1035256691 7:157633678-157633700 GGGGTGGGGTCCTACAGGGAAGG + Intronic
1037813739 8:22101368-22101390 GAGATGGGGTCCCACAAGCAGGG + Intronic
1038800229 8:30743043-30743065 CAGGTGGGATGCTAGATGGATGG + Intronic
1040974114 8:53170866-53170888 CCATTGGGGTCCTCCATGGATGG - Intergenic
1047477564 8:125248796-125248818 CAGATAGGGTTTTACAGGGAAGG + Intronic
1048216004 8:132495529-132495551 CAGATGTGTTTTTACATGGAAGG + Intergenic
1048432270 8:134381557-134381579 CAGGTGGGGCCATGCATGGAGGG + Intergenic
1053504537 9:38630152-38630174 CAGACGCGGTCCTACGTGCAGGG - Intergenic
1054937012 9:70698823-70698845 GAGAAGGAGTCTTACATGGAAGG - Intronic
1057151884 9:92803529-92803551 CAGATGCGGTCCTACGTGCAGGG + Intergenic
1061390024 9:130312369-130312391 CAGATAGGGTGCTCCAGGGAGGG + Intronic
1062034593 9:134377295-134377317 CACATGCTGTCCCACATGGAAGG + Intronic
1187053621 X:15718751-15718773 CAGGTGAGGCCCTTCATGGAAGG - Intronic
1192808272 X:74528745-74528767 CAGATGGGGTTGTAAGTGGAAGG - Intronic
1194899307 X:99489016-99489038 CAACTGGGGTCCTAGAAGGAGGG - Intergenic
1195321322 X:103724189-103724211 CAGATAGAGTCCAGCATGGAGGG + Exonic
1198935993 X:141903393-141903415 CTGATGGGCTCCTCCATGGCTGG - Intergenic
1199964352 X:152807330-152807352 CCCATGGGGTCCTGCATGGTGGG + Intergenic