ID: 1150288965

View in Genome Browser
Species Human (GRCh38)
Location 17:63970986-63971008
Sequence AGGGCAGATGGGGTCCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288965_1150288971 -10 Left 1150288965 17:63970986-63971008 CCATGTAGGACCCCATCTGCCCT 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1150288971 17:63970999-63971021 CATCTGCCCTCTGGTCACGTGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1150288965_1150288974 6 Left 1150288965 17:63970986-63971008 CCATGTAGGACCCCATCTGCCCT 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288965 Original CRISPR AGGGCAGATGGGGTCCTACA TGG (reversed) Intronic
900168298 1:1253773-1253795 AGGGCAGGTGGGTCCCCACAGGG - Intergenic
901033061 1:6319754-6319776 AGAGCAGATGGGGTCCTGGCAGG + Intronic
901491241 1:9597409-9597431 AGGACAGAGTGGGTCCAACAGGG - Intronic
905971696 1:42146641-42146663 AGGGCAGAGGGAGAACTACAAGG - Intergenic
907459118 1:54594719-54594741 AGGGTAGCTGGCGTCCTGCATGG + Intronic
907866498 1:58404482-58404504 AGGGCAGCTGGGGACCAGCAGGG + Intronic
913681120 1:121187328-121187350 AGGGCAGAAGGGGCCCCCCACGG - Exonic
913973573 1:143435762-143435784 AGGTCAGCTGTGGTTCTACAGGG - Intergenic
914032950 1:143974968-143974990 AGGGCAGAAGGGGCCCCCCACGG - Intergenic
914067961 1:144261369-144261391 AGGTCAGCTGTGGTTCTACAGGG - Intergenic
914111194 1:144704985-144705007 AGGTCAGCTGTGGTTCTACAGGG + Intergenic
914156496 1:145092998-145093020 AGGGCAGAAGGGGCCCCCCACGG + Exonic
914452094 1:147801574-147801596 AAGGCAGATGGTTTCCTACCTGG + Intergenic
914947133 1:152077864-152077886 AGGGTACATGAAGTCCTACAGGG + Intergenic
915426274 1:155829790-155829812 AAGGAAGGTGGGGTCCTAAAGGG + Intronic
915935860 1:160089923-160089945 TGGGCAGATAGGGTCCTATGGGG + Exonic
916014795 1:160740446-160740468 AGGGCAGAGGGGGACCTGCATGG - Intronic
916116505 1:161489302-161489324 GGGACAGATAGGGTCCTATAGGG + Intergenic
917808983 1:178639133-178639155 AGGGCATATGGGATCTTACAGGG - Intergenic
918251175 1:182704739-182704761 AGGACAGCTTGGGTCCAACATGG - Intergenic
920468434 1:206205852-206205874 AGGGCAGAAGGGGCCCCCCACGG - Intronic
922143731 1:222917367-222917389 GGGACAGATAGGGTCCTATAGGG + Intronic
923275645 1:232393408-232393430 AGCCCAGATGGGGTTCTACAAGG + Intergenic
923714332 1:236412061-236412083 ATGGGAGATGAGGTCCTCCATGG + Intronic
924238884 1:242022450-242022472 GGGGGAGCTGGGGTCCTAGATGG - Intergenic
924941417 1:248814641-248814663 TGGGCAGCTGGGGTCCCTCAGGG - Intronic
1062954219 10:1529648-1529670 GGGGCAGAGGGGCTCCAACAAGG - Intronic
1066452895 10:35547726-35547748 TGGGCATATGGGGTCCTGCAGGG - Intronic
1067031155 10:42879431-42879453 AGGGGAGATGGGGTCCATCAGGG + Intergenic
1069902144 10:71712545-71712567 AGGGCAGATGGGGCGGAACAGGG + Exonic
1069908922 10:71748241-71748263 AGGGCAGAGGGGCTGATACATGG - Exonic
1072741441 10:97912395-97912417 AGGGGAAATGGGGACCTCCAAGG - Intronic
1073442792 10:103562689-103562711 GGGGCTGATGGGGTCCTCAAAGG + Intronic
1073942682 10:108715881-108715903 AAGGCAGATGGGGTATGACATGG - Intergenic
1074165760 10:110872337-110872359 AGGGCTGAGGGGGACCTTCAAGG - Intronic
1078144438 11:8713268-8713290 AGGGGAGATGGGGGACTGCAGGG + Intronic
1079156084 11:17949264-17949286 GGGGAAGATGGGGAACTACAGGG + Intronic
1081992431 11:47345140-47345162 AAGGCAGATGGGGACCTCCGAGG - Intronic
1082925759 11:58545194-58545216 AGGGCTGATGGGGTCATTTATGG - Intronic
1083185622 11:61016219-61016241 GGGGCTGATGGGGTCAGACAGGG - Intronic
1087422325 11:97945285-97945307 AGGGCAGAAGGGCACCTACGTGG - Intergenic
1089333052 11:117703387-117703409 AGGGGAGATGGTGTCCAGCAGGG - Intronic
1089370749 11:117954569-117954591 AGGACAGATTGGGTGCTGCACGG + Intergenic
1089619869 11:119716013-119716035 AGGGCAGTGGGATTCCTACAGGG + Intronic
1089826568 11:121283230-121283252 GGGACAGATGGGGTCCTATAGGG + Intergenic
1091696656 12:2632451-2632473 AGGACACCTGGGGTCCTATAGGG + Intronic
1091840231 12:3615340-3615362 GTGGCTGATAGGGTCCTACAAGG - Exonic
1094124464 12:27008769-27008791 AGAGAACATGGGGTACTACAGGG - Intronic
1096649682 12:53055901-53055923 AGGGGAGATGGGTTCCTAAGGGG - Intronic
1097182883 12:57180959-57180981 AGGGCTGCTGGGAGCCTACAAGG - Intronic
1098039291 12:66337826-66337848 AAAGCAGATGTGATCCTACAAGG + Intronic
1102424051 12:112826557-112826579 GGGGCAGAAGGGGGCCTCCATGG - Intronic
1103713504 12:122929828-122929850 AGGGCAGCTGGGGGCCTCCGTGG + Exonic
1104382038 12:128315657-128315679 AGGTCACATGAGATCCTACATGG - Intronic
1104973489 12:132541818-132541840 TGGGAAGATGGGGTCCCACAGGG + Intronic
1105704178 13:22959334-22959356 AGCGCAGATGGCGCCTTACACGG + Intergenic
1105857127 13:24384404-24384426 AGCGCAGATGGCGCCTTACACGG + Intergenic
1110487770 13:76067232-76067254 GGGGCAAATCGGGTCTTACATGG - Intergenic
1110866101 13:80398072-80398094 GGGACAGATAGGGTCCTATAGGG + Intergenic
1114275348 14:21138558-21138580 AGGGCAGAAGGGGAGCTACTGGG - Intergenic
1114532319 14:23403667-23403689 AAGGCAGAGGGGGACCTAGAGGG + Intronic
1116508553 14:45715444-45715466 GGGACAGATAGGGTCCTACAGGG - Intergenic
1125684201 15:41553786-41553808 AGGGCAGATGGGTCCAAACATGG - Intergenic
1126336025 15:47587201-47587223 AGGGCAGAGGGGGCCTTGCAGGG - Intronic
1129740217 15:77986388-77986410 GGGGCAGGTGGGGTGCTCCACGG - Intronic
1131094190 15:89645628-89645650 AGGGCAGCTGGGGGCATAGAGGG + Intronic
1131379325 15:91950463-91950485 AGGGCAGATGAGCCCCTGCAGGG + Intronic
1131404154 15:92150159-92150181 AGGGCAGAAGGGGTCCAGCAAGG + Intronic
1134166065 16:11930596-11930618 AGGGCAGAGGGAATCCCACACGG - Intronic
1134494653 16:14723131-14723153 AGGGCAGAGGGAATCCCACACGG + Intronic
1134500036 16:14762251-14762273 AGGGCAGAGGGAATCCCACACGG + Intronic
1134545825 16:15107476-15107498 AGGGCAGAGGGAATCCCACACGG - Intronic
1134580544 16:15366799-15366821 AGGGCAGAGGGAATCCCACACGG - Intronic
1134722030 16:16390706-16390728 AGGGCAGAGGGAATCCCACACGG + Intronic
1135311455 16:21408021-21408043 AGGGCAGAGGGAATCCCACACGG - Intronic
1135364407 16:21840472-21840494 AGGGCAGAGGGAATCCCACACGG - Intronic
1135447436 16:22530876-22530898 AGGGCAGAGGGAATCCCACACGG + Intronic
1136150614 16:28345919-28345941 AGGGCAGAGGGAATCCCACATGG - Intronic
1136166851 16:28459757-28459779 AGGGCAGAGGGAATCCCACATGG - Intronic
1136196124 16:28655275-28655297 AGGGCAGAGGGAATCCCACATGG + Intronic
1136212464 16:28769398-28769420 AGGGCAGAGGGAATCCCACATGG + Intronic
1136257185 16:29049310-29049332 AGGGCAGAGGGAATCCCACATGG + Intronic
1136308161 16:29387017-29387039 AGGGCAGAGGGAATCCCACACGG - Intronic
1136321577 16:29488555-29488577 AGGGCAGAGGGAATCCCACACGG - Intronic
1136436257 16:30228525-30228547 AGGGCAGAGGGAATCCCACACGG - Intronic
1138179481 16:54932223-54932245 CGGGCAGATGGGGGCCTACGGGG + Intronic
1139390072 16:66601778-66601800 AGGGCAGGTGGGGGCCTTCCTGG + Intergenic
1139564162 16:67762948-67762970 AGGGCTGAAGGGGTCAGACAAGG + Intronic
1140366876 16:74388645-74388667 AGGGCAGAGGGAATCCCACATGG + Intronic
1142213422 16:88819283-88819305 AGGAGAGCTGGGGTCCTTCAGGG + Intronic
1148778115 17:50107050-50107072 AGAGAAGATGGGGTCATTCAGGG - Intronic
1150288965 17:63970986-63971008 AGGGCAGATGGGGTCCTACATGG - Intronic
1150429612 17:65104654-65104676 AGGGCAGATGGGGTGCCAGGAGG + Intergenic
1154117326 18:11622641-11622663 AGGGCAGAGGGAATCCCACACGG - Intergenic
1157209207 18:45727121-45727143 AGGGAAGATGTGGCCCCACATGG - Exonic
1158472676 18:57751564-57751586 AGGTCAAATGGGGATCTACAAGG + Intronic
1159442849 18:68504132-68504154 AGGCCAAAAGGGGGCCTACAAGG + Intergenic
1160228833 18:77031352-77031374 AGGGCAGGTGGTGGCCCACACGG - Intronic
1160875038 19:1292966-1292988 AGGCCAGAGGGGGACCTACAGGG + Intronic
1163785766 19:19274173-19274195 AGGGTAGAAGGGGTCCTAGCGGG + Intergenic
1164783424 19:30911577-30911599 AGGGAAGATGAGGTCCCCCAAGG - Intergenic
1165797363 19:38526813-38526835 GGGTCAGAAGGGGTCCTAGAGGG - Intronic
1165819140 19:38663523-38663545 AGGGCAGGTGGGGTCAGTCATGG + Intronic
1166516900 19:43453963-43453985 AGCAGAGATGGGTTCCTACATGG + Intergenic
1167241388 19:48345331-48345353 AGGGTTGATGGGGTCATATAAGG + Exonic
1167726863 19:51220749-51220771 AGGGCAGATGGGGGCCTCCTAGG - Intergenic
1168008340 19:53509200-53509222 AGGGCAGATGGGTACCGAAAGGG - Intergenic
925903270 2:8523689-8523711 GGGGCAGATGGAGTCCTGGATGG - Intergenic
927133253 2:20078717-20078739 AGGGCAGATGGGGCCAAAGAAGG + Intergenic
929138518 2:38647326-38647348 ATAGCACATGGGGTCCTAAAAGG + Intergenic
929618413 2:43330515-43330537 AGGGCAGATGTGCTCCTGCCAGG + Intronic
929909210 2:46074791-46074813 TGGACAGATGGGGATCTACAAGG + Intronic
931669304 2:64632416-64632438 AGGGCAGCTGGGGCACTCCAAGG + Exonic
932103144 2:68919244-68919266 AGGGCAGTTGGTGTCCTGGAAGG + Intergenic
932681222 2:73827552-73827574 AGTGCAGATGGGGTCCTGGCAGG - Intergenic
933375103 2:81469002-81469024 AAGCCAGATGGGGTCCTGGATGG - Intergenic
934178267 2:89596728-89596750 AGGTCAGCTGTGGTTCTACAGGG - Intergenic
934288562 2:91671020-91671042 AGGTCAGCTGTGGTTCTACAGGG - Intergenic
935431150 2:102977253-102977275 AGGGCAGAAGGGGTTCCACTGGG + Intergenic
936096065 2:109531056-109531078 ATGGGAGATGGGGTCCCACAAGG - Intergenic
937870617 2:126783340-126783362 AGGGCAGGTGGTGGCTTACAAGG + Intergenic
940799942 2:158122464-158122486 AGGGCTGTTGGGGTCCAATAGGG + Intronic
941037506 2:160584334-160584356 AGGGCACATGTGGTACTGCAGGG + Intergenic
942424292 2:175842789-175842811 AGAGGAGATGGGATCCTGCAGGG - Intergenic
942948235 2:181693257-181693279 AGAGCATATGGTGTCATACAAGG - Intergenic
947638665 2:231693821-231693843 AGGGGAGGTGGGGTCTTAAAGGG + Intergenic
948791768 2:240382818-240382840 TAGGCAGATGGGATCCTTCAAGG - Intergenic
948793868 2:240392344-240392366 AGGGCAGCTGGGGTCCTGCCTGG + Intergenic
948921974 2:241070071-241070093 CGGGAAGCTGGCGTCCTACACGG + Exonic
1172183253 20:33016355-33016377 AGGGCAGCAGGGGGACTACAGGG - Intronic
1173540611 20:43848226-43848248 AGGCAGGATGGGGTCCTCCAGGG + Intergenic
1174599475 20:51712807-51712829 AGGGCAGATGGAGGCCTCCCTGG + Intronic
1175625721 20:60486908-60486930 AGGCCAGGTGGGGTCCGGCAAGG - Intergenic
1176164577 20:63665910-63665932 AGGACAGAACGGCTCCTACACGG - Intronic
1176919748 21:14673707-14673729 GGGGAGGAGGGGGTCCTACAGGG + Intergenic
1179941189 21:44639568-44639590 AGGACAAATGGGGGCCTCCAGGG + Intronic
1180830988 22:18906035-18906057 AGGGCCGGTGGGATTCTACATGG + Intronic
1184741470 22:46431176-46431198 AGTGCAGGTGGCGTCCTGCACGG + Intronic
1184981803 22:48100580-48100602 AGGGAACATGGGGACCTCCAGGG - Intergenic
1185003532 22:48261872-48261894 GGGGCAGCTGAGGTCCTCCAGGG - Intergenic
1203281075 22_KI270734v1_random:131306-131328 AGGGCCGGTGGGATTCTACATGG + Intergenic
949760314 3:7463292-7463314 ACTTCAGATGGGGTCTTACATGG + Intronic
950755837 3:15171760-15171782 AGGGCAGGTGGGGTTCCAAATGG - Intergenic
955733162 3:62008928-62008950 ATGGCACATGGGCTCCAACAGGG - Intronic
956296166 3:67715994-67716016 AGGGCAGATGGGTTAATCCATGG - Intergenic
957284551 3:78201576-78201598 AGGGCAGAAGGGTGGCTACAAGG + Intergenic
960037741 3:113118658-113118680 AGGACACAAGGGGCCCTACATGG + Intergenic
961390061 3:126547165-126547187 AGGGCACATGGGGACCCAGATGG + Intronic
961778877 3:129309807-129309829 AGTGCAGCAGTGGTCCTACATGG - Intergenic
961810387 3:129518636-129518658 AGGCCAGCAGGGGTCCTGCAGGG - Intronic
962147533 3:132856199-132856221 ATGTCAGATGTGGTCCAACAAGG - Intergenic
968545063 4:1194200-1194222 ACGGCAAATGGGCTCCTCCAAGG + Intronic
969300469 4:6294237-6294259 ACGGCAACTGGGGTCCTTCAGGG + Intronic
969503714 4:7570699-7570721 ATGGCAGATGGGGTCTGGCAGGG - Intronic
969830979 4:9796667-9796689 AGGTCAGCTGTGGTTCTACAGGG + Intronic
970480557 4:16468732-16468754 AGGGCAGATGGGGTAGAATAAGG + Intergenic
971222023 4:24717143-24717165 AGGGCTGTGGGGGTCCAACAAGG + Intergenic
979798194 4:124873819-124873841 AGGGGAGATGGGTTTCTACATGG - Intergenic
979939131 4:126737873-126737895 TGGGTAGATGGGTTCCTCCATGG - Intergenic
983798198 4:171892946-171892968 AGGGCAGATATGGTCCTTCCTGG - Intronic
986785340 5:11109026-11109048 AGGGCAGAGAGGGTCCTTCTGGG + Intronic
987692467 5:21284282-21284304 GGGACAGATAGGGTCCTATAGGG - Intergenic
989441323 5:41475343-41475365 GGGACAGATAGGGTCCTATAGGG - Intronic
990263111 5:54046766-54046788 AGGGCAGAAGGGGAGCCACATGG + Intronic
992114563 5:73527006-73527028 AGGACAGCTCAGGTCCTACAAGG - Intergenic
997443446 5:133925107-133925129 GGGGCAGAAGGAGTCCGACACGG - Intergenic
999213031 5:149906727-149906749 TAGGCAGATGGGGTCATAAAAGG - Intronic
999818069 5:155197779-155197801 AGTGGAGATGGGGTCCTAGTTGG - Intergenic
1000812746 5:165883201-165883223 GGGACAGATAGGGTCCTACAGGG - Intergenic
1002605753 5:180381804-180381826 AGGGCCCATGGGGGGCTACAGGG - Intergenic
1004152715 6:13135347-13135369 AGGGCAGCTGGGGACGCACAGGG - Intronic
1005135763 6:22569099-22569121 TGAGCAGATCGGGGCCTACAGGG + Intergenic
1006763825 6:36487195-36487217 AGGTGAGATGGGCTCCAACAAGG - Exonic
1013828609 6:114245584-114245606 AGGACAGATACAGTCCTACAAGG + Intronic
1016842555 6:148538966-148538988 AGGGCACATGGAGCCTTACATGG - Intronic
1017273096 6:152532295-152532317 ATGGCAAATGAGGTCCTAGATGG - Intronic
1018790720 6:167145627-167145649 AGGGCAGCTGGGGCCCCAGAGGG + Intergenic
1022274566 7:28842567-28842589 AGGGCAGATATGGTGCTCCAGGG - Intergenic
1022446861 7:30478158-30478180 AGGGCAGACAGGGGCCTTCATGG - Intronic
1022919956 7:35003266-35003288 AGGGCACAGGGGATCCAACAGGG + Intronic
1023010815 7:35923550-35923572 AGGGGAGATGGGGCCATGCATGG + Intergenic
1024554168 7:50589096-50589118 AGGGCAGGTGGGGACCCACCGGG - Intergenic
1025124448 7:56333655-56333677 AGGGGAGATGGGGCCATGCATGG + Intergenic
1028809075 7:95062905-95062927 ATGGCAGATGGGGGACTGCAGGG + Intronic
1029358679 7:100072143-100072165 AGATCACATGGGGTCCTACTGGG - Exonic
1029511138 7:100995994-100996016 AGGGCAGATGTGGTGCTAGGAGG - Exonic
1029512439 7:101004493-101004515 AGGGCAGATGTGGTGCTAGGAGG - Exonic
1030602358 7:111607063-111607085 AGGGCAGATGGGGGCAAAAAGGG + Intergenic
1032441800 7:131947855-131947877 ACGACAGATGGGGTCTTGCAAGG - Intergenic
1033017538 7:137687153-137687175 GTGGCAGATGGGGTCCAGCAGGG - Intronic
1034415686 7:150963225-150963247 AGGGCGGAGGGGGTGCAACAGGG + Intronic
1035185990 7:157126019-157126041 CGGACAGATGCGGTTCTACAGGG + Intergenic
1035256690 7:157633674-157633696 AGTGGGGGTGGGGTCCTACAGGG + Intronic
1036588584 8:10147568-10147590 AGGGTAGAAGGGGTCACACAGGG + Intronic
1037554039 8:20004675-20004697 AGGGCATATGGGGGCCTTCCTGG + Intergenic
1037681441 8:21100928-21100950 AGGGCAGAGGGGGGCCTCCCAGG + Intergenic
1040020970 8:42740689-42740711 AGGCCAGATGGTGTCCCAAACGG - Intergenic
1048638035 8:136321080-136321102 AGGGGAGATGTGGTCAGACATGG - Intergenic
1053050817 9:34958946-34958968 AGGGCACATGGAACCCTACAGGG - Intronic
1053141335 9:35684689-35684711 AGTGAGGATGGGGTCCCACAGGG - Intronic
1057128851 9:92639612-92639634 AGGCCAGATGGGGTCAGAAAAGG + Intronic
1057420756 9:94910370-94910392 AAGGAAGCTGGGGTCCTACCCGG - Intronic
1060820610 9:126659429-126659451 AGGAGGGATGGGGGCCTACAGGG - Intronic
1061369026 9:130187538-130187560 AGGGCAGAACGGCTCCTGCAGGG - Intronic
1062010288 9:134263478-134263500 AGGGCAGCTGGGGTGGTACAGGG - Intergenic
1062712526 9:137984405-137984427 AGGGCAGATGTGGCCCCACAAGG - Intronic
1192758528 X:74070694-74070716 AGGGTGGATGAGGTCCTAGAAGG + Intergenic
1194899309 X:99489020-99489042 AGGGCAACTGGGGTCCTAGAAGG - Intergenic
1198703554 X:139422528-139422550 AGGGCAAATGGGATCCTTCAAGG - Intergenic
1199853899 X:151744306-151744328 AGGGCAGCTGGAGACCAACATGG + Exonic
1199964349 X:152807326-152807348 ATGGCCCATGGGGTCCTGCATGG + Intergenic