ID: 1150288967

View in Genome Browser
Species Human (GRCh38)
Location 17:63970996-63971018
Sequence ACGTGACCAGAGGGCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288967_1150288979 30 Left 1150288967 17:63970996-63971018 CCCCATCTGCCCTCTGGTCACGT 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288967_1150288974 -4 Left 1150288967 17:63970996-63971018 CCCCATCTGCCCTCTGGTCACGT 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288967 Original CRISPR ACGTGACCAGAGGGCAGATG GGG (reversed) Intronic
900323374 1:2095779-2095801 AGGGGAGCAGAGGGCAGAGGAGG - Intronic
900874450 1:5331438-5331460 CAGTGGCCAGAGGGCAGGTGGGG + Intergenic
901747545 1:11384511-11384533 AAATGACCAGGTGGCAGATGTGG - Intergenic
901817043 1:11800293-11800315 AGGTGACCAGTGGGAAGAGGAGG - Exonic
903182384 1:21611542-21611564 ACGTGACCCACGGGCAGACGGGG - Exonic
905656287 1:39688141-39688163 ATTTTCCCAGAGGGCAGATGTGG - Intronic
909362584 1:74781029-74781051 AGGGGGTCAGAGGGCAGATGGGG + Intergenic
910302828 1:85726762-85726784 AGGTTACCAGAGGCCAGAGGAGG - Intergenic
910660999 1:89672541-89672563 ACGTTTCCAAAGGACAGATGCGG - Intronic
912776729 1:112510184-112510206 ACTTCACAAGAGGGCAGATGAGG + Intronic
913496664 1:119433823-119433845 GCGTGTACAGAGGGCAGATGAGG + Intergenic
913501499 1:119476353-119476375 ACGTGTACAGAGGGCAGATGAGG + Intergenic
915475483 1:156150429-156150451 CCATAACAAGAGGGCAGATGAGG + Intronic
919347327 1:196400910-196400932 CTGTGACCTGAGGGCAGCTGTGG + Intronic
922657164 1:227395738-227395760 ACGAGACCAGAGAGCAGAGAAGG + Intergenic
1063570468 10:7210709-7210731 ACACGCCCAGAGGGCAGGTGGGG - Intronic
1068551848 10:58415796-58415818 AAGTGCCCAGAGGGCAGCTGAGG + Intergenic
1073358062 10:102872582-102872604 ACATGACCAAAGGCCAGGTGAGG + Exonic
1073451855 10:103614687-103614709 ATGTGTCCAGGGAGCAGATGGGG - Intronic
1074122252 10:110501369-110501391 AGGTGACCACAGGGGAGATCTGG + Intronic
1074775111 10:116762218-116762240 AGGTGCCCACAGGGCTGATGAGG - Intergenic
1075420413 10:122296361-122296383 GCCAGACCAGAAGGCAGATGGGG - Intronic
1076978066 11:190241-190263 ACGCCACCTGCGGGCAGATGGGG + Intronic
1077224230 11:1433080-1433102 ACCTGACCAGACCGCAGAAGAGG - Intronic
1077304852 11:1864437-1864459 AGGTGGCCTGAGGGCAGAGGCGG + Intronic
1077336416 11:2006911-2006933 ACGTGACCAGTGGGTGGAAGCGG + Intergenic
1077499531 11:2902901-2902923 CTGTGGCCAGAGGGCTGATGTGG - Intronic
1078270172 11:9787833-9787855 GCATGGCCAGAGGGCAGTTGAGG + Intronic
1078573416 11:12478576-12478598 AGGTGCCCAGAGGGCAGCTAAGG - Intronic
1081685429 11:45039369-45039391 TTGTGGCCAGAAGGCAGATGTGG + Intergenic
1084719038 11:70892396-70892418 AGGTGGCCAGAGGGAAGAGGAGG - Intronic
1085313263 11:75528552-75528574 GAGTGGCCAGAGGGCAAATGTGG - Intergenic
1087822908 11:102731545-102731567 ATGTCACCAAAGGGCATATGTGG - Intergenic
1088497920 11:110450490-110450512 AGGTGAGCAGAGGGCAAGTGAGG - Intronic
1088891971 11:114051739-114051761 ACAGGACCAAAGGGCAAATGAGG - Intergenic
1089505061 11:118957194-118957216 ACGTCACCACTGGGCAGAAGTGG - Exonic
1089600798 11:119613546-119613568 AGGTGAGCAGGGGGCAGTTGTGG + Intergenic
1202819400 11_KI270721v1_random:62093-62115 ACGTGACCAGTGGGTGGAAGCGG + Intergenic
1092200925 12:6582229-6582251 ATGTGAGCCGGGGGCAGATGGGG - Exonic
1092949377 12:13487198-13487220 AAGTGACAAAATGGCAGATGAGG + Intergenic
1096599191 12:52717521-52717543 ACCAGACCAGTGGGAAGATGAGG + Intergenic
1099899081 12:88684760-88684782 AAGTGACCAGATGGCAGGTGTGG - Intergenic
1101737389 12:107473282-107473304 TAGTGACCAGAGGGAGGATGGGG - Intronic
1103962351 12:124617076-124617098 AAGGAACGAGAGGGCAGATGTGG - Intergenic
1107458803 13:40580660-40580682 AGGTGACATGAGGTCAGATGAGG - Intronic
1107871447 13:44749971-44749993 ACCTGACAAGAGGGCAGCTGAGG + Intergenic
1111797052 13:92935142-92935164 ACATGACAAGAGGCCAGAGGAGG - Intergenic
1112733687 13:102394683-102394705 CCGTGAGCAGAGGGCAGCGGCGG + Intronic
1113466629 13:110517944-110517966 ACAAGAACAAAGGGCAGATGGGG + Intergenic
1113896328 13:113766544-113766566 GGGTGACCAGAGGGCAGGAGGGG + Intronic
1116174475 14:41450002-41450024 ACTTAACCAGAGGGCACTTGGGG + Intergenic
1117189620 14:53277440-53277462 AGATGACCAGAGGCCATATGTGG - Intergenic
1117653115 14:57926896-57926918 AGGAGACCAGAGGGCAGCTTTGG - Intronic
1119907855 14:78321909-78321931 ATGTTACCTGAGTGCAGATGAGG + Intronic
1122127795 14:99588467-99588489 AAGTCACCAGAGGCCTGATGTGG + Intronic
1123967977 15:25477940-25477962 ACGTGACCAGGGGGCAGGAACGG - Intergenic
1128513449 15:68327453-68327475 AAGAGACCAAAGGGAAGATGAGG - Intronic
1131082571 15:89548946-89548968 ATGAGGCCAGAGGGCAGAGGTGG + Intergenic
1131620981 15:94067808-94067830 AAGCTACCAGAGGGCAGATGGGG + Intergenic
1132431684 15:101766310-101766332 AAGTGAGCAGAGAGCTGATGAGG - Intergenic
1132764042 16:1525477-1525499 ACGTGGCCAGGGGGCAGTGGGGG + Intronic
1135045233 16:19149906-19149928 AGATGAACAGAGGGAAGATGTGG + Intronic
1135323768 16:21513194-21513216 CAGTGACCAGAGAGCAGAGGGGG - Intergenic
1136032861 16:27516158-27516180 TCGTGACCAGAGGGCAGCTTTGG - Intronic
1136335251 16:29606459-29606481 CAGTGACCAGAGAGCAGAGGGGG - Intergenic
1138024205 16:53510185-53510207 ACTTGGCCAGAGGTCGGATGCGG - Intergenic
1142035976 16:87862301-87862323 CAGTGACCAGAGAGCAGAGGGGG - Intronic
1142188423 16:88705987-88706009 ACGCGCCCAGAGGGCAGAGGCGG + Intronic
1203066153 16_KI270728v1_random:1020080-1020102 ACATGATCAGAGGCCAGGTGGGG - Intergenic
1142465491 17:134706-134728 ACGCCACCTGCGGGCAGATGGGG + Intergenic
1142632091 17:1231664-1231686 ACGTGGGCAGAGACCAGATGTGG - Intergenic
1144630927 17:16872065-16872087 TGGGCACCAGAGGGCAGATGGGG - Intergenic
1144650389 17:17003411-17003433 TGGGCACCAGAGGGCAGATGGGG + Intergenic
1145782203 17:27570748-27570770 TCCAGACCAGAAGGCAGATGTGG - Intronic
1145982241 17:29019913-29019935 AGGTGACCAGAAGGGAGAGGGGG + Intronic
1148370569 17:47096769-47096791 ACCTTACAAGAGGCCAGATGCGG + Intergenic
1148733474 17:49851554-49851576 ACGTGAGATGAGGGCGGATGAGG + Intergenic
1148846682 17:50533797-50533819 AGATGACGAGAGGGCAGAGGAGG - Intronic
1150277836 17:63911134-63911156 ACGTGTCCTGAGGGGAGAGGCGG - Intronic
1150288967 17:63970996-63971018 ACGTGACCAGAGGGCAGATGGGG - Intronic
1151079755 17:71315440-71315462 ACGTGCCCACAGGCCAAATGTGG - Intergenic
1151419981 17:73990854-73990876 AGGTGCCCAGGGGGCAGGTGGGG - Intergenic
1152825458 17:82462014-82462036 ACACAACCAGAGGGCAGGTGAGG - Intronic
1152929246 17:83101548-83101570 AGGTGAGCAGAGGGCATTTGTGG + Intergenic
1153533848 18:6079082-6079104 AGGTGAGCAGAGGGCAGGCGAGG - Intronic
1156391278 18:36652734-36652756 GGGTGACAGGAGGGCAGATGGGG - Exonic
1156487851 18:37477933-37477955 ACCTGAGCAGAGGGCAGGGGTGG + Intronic
1158650010 18:59275847-59275869 TGGTGATCAGAGGGCAGCTGTGG + Intronic
1159781670 18:72667489-72667511 ACATGACCAGAGTACAGCTGAGG - Intergenic
1160107665 18:75993594-75993616 ACAGGGCCAGAGGGCTGATGTGG + Intergenic
1160177450 18:76607473-76607495 ACTCCACCACAGGGCAGATGGGG - Intergenic
1160913199 19:1484121-1484143 TGGTGACCTGAGGGCAGAGGGGG + Exonic
1161589516 19:5122985-5123007 ACGTGCCCTGAGGGCAGCTCTGG - Intronic
1162199128 19:9008613-9008635 ATGTGGCCAGAGGGGTGATGGGG + Intergenic
1163333964 19:16659825-16659847 GCGTGCCCAGAGGGCGGATAGGG + Intronic
1164679394 19:30123728-30123750 ACATGTCCGGAGGGCAGAAGAGG - Intergenic
1165374202 19:35430065-35430087 AGGTGACCAGAGTGGAGAGGAGG + Intergenic
1166781362 19:45345196-45345218 AGGTGAGCTGAGGGCAGATGGGG + Intronic
925352561 2:3211731-3211753 GCGTGAACAGAAGGCAGAGGTGG + Intronic
925439926 2:3876659-3876681 TGGTGGCCAGAGGGCAGATGAGG - Intergenic
927859763 2:26553286-26553308 ACCAGACCAGAGGCCAGAGGAGG - Intronic
928423797 2:31161265-31161287 ACATGACCTGAGTGCAGAGGAGG - Intergenic
929307424 2:40379518-40379540 AGGTGACCAGAGGGTTCATGGGG - Intronic
929731179 2:44494412-44494434 ACGTAAACAGAGGGAAGAGGGGG - Intronic
931745446 2:65287937-65287959 ACGTGACCACACCCCAGATGTGG - Intergenic
934767683 2:96889140-96889162 ACATGCCCAGAGGGCAGCTGGGG + Intronic
938408665 2:131046436-131046458 ACAGGTCCAGAGGGCGGATGGGG - Exonic
940453931 2:153872646-153872668 ACGTCACCAGAACGCAGAGGGGG - Intronic
942320625 2:174732801-174732823 AAGTGAACAGAGGGAAGATGAGG + Intergenic
944392132 2:199228606-199228628 AGATGACCAGAGGCCACATGTGG - Intergenic
947587275 2:231364265-231364287 ACGTGGCCTGAGGACAGGTGAGG + Intronic
948371851 2:237494578-237494600 GCTTGACCAGAGATCAGATGGGG + Intronic
948592245 2:239058555-239058577 ACCTGGCCAAAGGGCAGCTGGGG + Intronic
1171060024 20:21947410-21947432 ATGTGGGCAGAGGGCAGAGGAGG + Intergenic
1174688619 20:52480115-52480137 GAGTGACCAGAAGGCAGAAGAGG + Intergenic
1175409868 20:58760217-58760239 AGGTGACCACAGTGCAGATGAGG + Intergenic
1175582888 20:60114016-60114038 GCCTGACCGGATGGCAGATGGGG + Intergenic
1175861738 20:62153970-62153992 ACGTGTCCACAGGACAGAAGAGG - Intronic
1177214375 21:18109467-18109489 AAGTTTCCAGAGGGCAGCTGTGG + Intronic
1178159867 21:29899690-29899712 AGGTGACCAGAGGGAGGATTTGG + Intronic
1179876884 21:44273141-44273163 AGGTGGGCAGAGGGAAGATGTGG + Intergenic
1183368747 22:37420462-37420484 ATGTGAGCAGAGGCCAGAGGCGG - Intronic
1184467412 22:44677011-44677033 ACATGGCCAAAGGGCAGAGGGGG - Intronic
1184689138 22:46109571-46109593 AAGTGCACAGTGGGCAGATGAGG - Intronic
1184843471 22:47066367-47066389 GCGGGACTAGAGGGCACATGAGG + Intronic
1184872486 22:47249710-47249732 AGGAGACCAGAGGGCAGAGAGGG + Intergenic
1184998952 22:48230479-48230501 GGGTGACCAGAAGGCAGAAGTGG - Intergenic
1185070612 22:48653863-48653885 GCGTCACCAGATGGCAGCTGGGG + Intronic
953845313 3:46422052-46422074 AGATGACCAGAGGCCACATGTGG - Intergenic
955771810 3:62392184-62392206 AAGTGAACTGAGGGCAGAGGTGG - Intergenic
959321718 3:104885310-104885332 ACCTGACCAGAATGCAAATGTGG + Intergenic
960506872 3:118504597-118504619 ACGTGACCAGGAGGAAGAGGAGG - Intergenic
960649256 3:119928092-119928114 AAGTGAGCAGGTGGCAGATGAGG + Intronic
961441847 3:126958065-126958087 AGGTGACCAGAGAGCACATGAGG - Intronic
961541977 3:127606336-127606358 AGGTGAGCTGAGGGCAGGTGAGG + Exonic
963605766 3:147410582-147410604 ACGTGGTCAACGGGCAGATGAGG + Exonic
963986881 3:151606541-151606563 ACCTGACCAAAGGGCTGATCAGG + Intergenic
968647970 4:1749370-1749392 AGGTGAGGAGGGGGCAGATGGGG - Intergenic
969237793 4:5878390-5878412 TCGTGTCAAGAGGGCAGGTGAGG - Intronic
974402776 4:61426630-61426652 AGATGACCAGAGGCCATATGTGG - Intronic
975232888 4:71955460-71955482 AAGGGACCCGAGGGCAGAAGAGG - Intergenic
975399264 4:73915903-73915925 AAGTGACCAGGTGGCAGCTGTGG - Intergenic
976811585 4:89105749-89105771 AGATGACCAGAGGCCACATGTGG + Intronic
978951007 4:114559317-114559339 TCTTGAACAGAGGGCCGATGAGG + Intergenic
980343499 4:131583067-131583089 GGATGACCAGAGGCCAGATGTGG - Intergenic
982216389 4:153086034-153086056 GCGTGAGCAGAGGTCAGAAGTGG + Intergenic
984759576 4:183352099-183352121 AGGTGACCAGAGGGCTGACAAGG + Intergenic
986627496 5:9736387-9736409 ACTTCACAAGAGAGCAGATGGGG - Intergenic
987477077 5:18403712-18403734 AGATGACTAGAGGGCAGAGGAGG - Intergenic
991391117 5:66144462-66144484 CGGTGACCAGCGAGCAGATGCGG + Exonic
992255263 5:74914761-74914783 ATCTGACCAGAGGGCAGCTAGGG + Intergenic
998139750 5:139693170-139693192 AGGTTAGCAGGGGGCAGATGGGG + Intergenic
1001199618 5:169704380-169704402 GCAGGACCAGAGGGCAGAGGAGG + Intronic
1001566271 5:172701440-172701462 AAATGACCACATGGCAGATGAGG + Intergenic
1002272543 5:178082146-178082168 ACATCACCAGAGGGGTGATGGGG - Intergenic
1002449693 5:179311633-179311655 ACATCACCAGAGGGGTGATGGGG - Intronic
1006250093 6:32776201-32776223 AGGTGGCCAGAGGGCTGAAGAGG - Intergenic
1010365382 6:75044624-75044646 AAGAGAGCAGAGGGCAGAGGTGG + Intergenic
1011518602 6:88179907-88179929 AGGTGATCAGAGGGCAGGAGGGG - Intergenic
1014050611 6:116949115-116949137 ACATGGCCAGATGGCAGAGGTGG - Intergenic
1014633611 6:123817479-123817501 AATTGTCCAGAGGGCAGCTGAGG + Intronic
1015783235 6:136893305-136893327 GTGTGACCAGAGGGCCCATGAGG - Intronic
1017137584 6:151161798-151161820 ATGTTAACAGAGGGGAGATGGGG + Intergenic
1018916220 6:168134177-168134199 ATGTGTCCAGAGGACAGATGGGG - Intergenic
1023319339 7:38976209-38976231 ACGGGACCAGTGGGAAGTTGCGG - Intergenic
1024049810 7:45611227-45611249 AAGGGAGGAGAGGGCAGATGTGG + Intronic
1024308149 7:47945390-47945412 CCGCCACCAGAGGGCAGACGAGG + Intronic
1025708371 7:63887025-63887047 AGGGGACCAGAGGACACATGTGG + Intergenic
1026887831 7:73964801-73964823 CTGTGACCTGAGGGGAGATGTGG + Intergenic
1028215952 7:88133436-88133458 AAGTGACCAGAGGACAGACTGGG + Intronic
1029589162 7:101495739-101495761 GAGTGACCAGATGCCAGATGTGG - Intronic
1033569604 7:142614877-142614899 ACGGGACCTGAGGTCAGAGGGGG + Intergenic
1034133939 7:148747814-148747836 ACTTAACCAGATGGCAGATCAGG + Intronic
1036105043 8:5829583-5829605 ACGTGAGCAGAGGAAGGATGTGG + Intergenic
1037988204 8:23302784-23302806 AGGTGATCACAGGGCAGGTGTGG + Intronic
1039148296 8:34474813-34474835 ACAGGGCCAGAGGGCAGATCAGG + Intergenic
1040288590 8:46112862-46112884 ACGGGACCACAGGGGAGAAGCGG - Intergenic
1040722602 8:50344579-50344601 TAGTGGCCAGAGGGCAGATGTGG - Intronic
1043139683 8:76572702-76572724 ACATGTGCAGAGGGCAGGTGAGG + Intergenic
1043469159 8:80544837-80544859 AAGTGAGCAGAGGGAAGCTGGGG + Intergenic
1044585903 8:93869157-93869179 ACCTGCCCAGAGGGAAGAGGAGG - Intronic
1047523935 8:125616419-125616441 GAGTGACCAGAGGGAGGATGAGG + Intergenic
1048396639 8:134020232-134020254 AGGTGACCAGTGTGCAGAGGAGG - Intergenic
1057213339 9:93213249-93213271 AGGTGACAAGAGGGCAGGGGTGG + Intronic
1057547386 9:96028234-96028256 AAGTGAACAGAGGGGAGAAGTGG - Intergenic
1059388719 9:113985401-113985423 ACGTCACAAGAGGACAGCTGTGG - Intronic
1061959346 9:133980104-133980126 ATGTGGCCAGAGGGCAGAGCTGG + Intronic
1186145055 X:6616393-6616415 ATGTGAGCAGAAGGCACATGTGG - Intergenic
1187558863 X:20380062-20380084 AAGCAGCCAGAGGGCAGATGTGG + Intergenic
1192863694 X:75107457-75107479 ACGTGAGGAGAGGGCAGAGTGGG + Intronic
1195805794 X:108763702-108763724 ACTGGTCCAGAGGGCACATGTGG - Intergenic
1199978788 X:152909507-152909529 ACGGGACAGGAGGGCACATGAGG - Intergenic