ID: 1150288968

View in Genome Browser
Species Human (GRCh38)
Location 17:63970997-63971019
Sequence CACGTGACCAGAGGGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288968_1150288974 -5 Left 1150288968 17:63970997-63971019 CCCATCTGCCCTCTGGTCACGTG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288968_1150288980 30 Left 1150288968 17:63970997-63971019 CCCATCTGCCCTCTGGTCACGTG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288968_1150288979 29 Left 1150288968 17:63970997-63971019 CCCATCTGCCCTCTGGTCACGTG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288968 Original CRISPR CACGTGACCAGAGGGCAGAT GGG (reversed) Intronic
900607663 1:3531075-3531097 CCGGTGACCAGAGGCCAGGTGGG - Intronic
902741900 1:18444673-18444695 CAGGAGTCCAGAGGTCAGATGGG + Intergenic
903765516 1:25731825-25731847 CACATGACCACAGGCCAGACAGG - Intronic
907256806 1:53185497-53185519 CACGTGGCCACAGGACAAATAGG + Intergenic
907913069 1:58843736-58843758 CCTGTGGCCAGAGGGCACATAGG + Intergenic
915145029 1:153791762-153791784 CAGGTGAGCAGATGGCAGAGAGG + Intergenic
915632626 1:157163942-157163964 AGAGTGACCACAGGGCAGATAGG + Intergenic
917802346 1:178581996-178582018 CAAGGGGCCAGAGAGCAGATGGG - Intergenic
918341152 1:183568847-183568869 CACGTGGACAGAGGGCCAATGGG + Intronic
1069892476 10:71660933-71660955 CACGTGACAGGAGCGCAGCTTGG - Intronic
1073209249 10:101785400-101785422 CAACTGACCTGAGGGCAAATGGG + Exonic
1075898338 10:126017866-126017888 CAACTGACCAGAGGTAAGATTGG + Intronic
1076978065 11:190240-190262 CACGCCACCTGCGGGCAGATGGG + Intronic
1077133796 11:988395-988417 CACGTGGCCCGAGTGCAGGTCGG + Intronic
1077397699 11:2332931-2332953 GACGGGCCCAGAGGGCAGAGGGG - Intergenic
1081869110 11:46375297-46375319 CCCCTGGCCAGAGGGCAGAGGGG - Intronic
1084968998 11:72759435-72759457 CAGGGGACCAGAAGGCAGACAGG + Intronic
1089402701 11:118173460-118173482 CACATGACTTGAGGGCAGAATGG + Intronic
1090202167 11:124864885-124864907 CAAAGGACCAGAGGGCAGAGAGG + Intergenic
1091306248 11:134538116-134538138 CTGGTGGCCAGAGGGCAGAAAGG + Intergenic
1094654681 12:32408934-32408956 AACCTTCCCAGAGGGCAGATGGG - Intronic
1101586944 12:106093444-106093466 CAGATGATCAGAGGGCAGAACGG - Intronic
1104521608 12:129480863-129480885 CAGAGGACCAGAGGGCACATGGG + Intronic
1121223488 14:92304213-92304235 CACTTGACCAAAAGGCAGAGTGG - Intergenic
1121466945 14:94121856-94121878 CAGGAGAACAGAGGGCAGAGTGG - Intergenic
1129453106 15:75661688-75661710 GACTTGGCCAGAGGGAAGATGGG + Exonic
1131620980 15:94067807-94067829 TAAGCTACCAGAGGGCAGATGGG + Intergenic
1132764041 16:1525476-1525498 CACGTGGCCAGGGGGCAGTGGGG + Intronic
1136060598 16:27723732-27723754 CACGAGACCACATGGCAGGTTGG + Intronic
1139315283 16:66062343-66062365 CACCTGTCCAGATGGCAGAATGG + Intergenic
1139556957 16:67718613-67718635 GACGTGGCCATAGGGCACATGGG + Intronic
1140427753 16:74875113-74875135 CACTTCAGCAGAGGGCAGACTGG + Intronic
1142465490 17:134705-134727 CACGCCACCTGCGGGCAGATGGG + Intergenic
1144630928 17:16872066-16872088 CTGGGCACCAGAGGGCAGATGGG - Intergenic
1144650388 17:17003410-17003432 CTGGGCACCAGAGGGCAGATGGG + Intergenic
1145982240 17:29019912-29019934 CAGGTGACCAGAAGGGAGAGGGG + Intronic
1146649568 17:34598379-34598401 CAGGTAATCAGGGGGCAGATAGG - Intronic
1148050882 17:44769469-44769491 CCCGGGCCCAGAGGGCAGAAAGG + Intronic
1150288968 17:63970997-63971019 CACGTGACCAGAGGGCAGATGGG - Intronic
1151713896 17:75821801-75821823 CGAGTGAGCAGAGGGCAGCTGGG + Intronic
1152419378 17:80183898-80183920 CATGAGACCTGTGGGCAGATGGG - Exonic
1153909708 18:9696228-9696250 CACCTGACCACAAGGCAGACAGG + Intergenic
1154154067 18:11930152-11930174 ATCGTAACCAGAGGGCAGTTTGG - Intergenic
1156441390 18:37191917-37191939 CTTGTGACCAGAGGGCAGAGTGG + Intronic
1157749754 18:50167844-50167866 CGTGGGGCCAGAGGGCAGATGGG - Intronic
1163333963 19:16659824-16659846 GGCGTGCCCAGAGGGCGGATAGG + Intronic
1166781361 19:45345195-45345217 CAGGTGAGCTGAGGGCAGATGGG + Intronic
925197587 2:1939185-1939207 CACGTGGCCAGAGCACAGAGCGG - Intronic
925409152 2:3628834-3628856 TGCGTGTCCAGAGGACAGATGGG + Intronic
927239953 2:20912638-20912660 CAAGTGGCCAGAGGGAAGAGAGG - Intergenic
931511211 2:62997336-62997358 CTCCTAACCAGAGGGCAGATTGG + Intronic
934767682 2:96889139-96889161 GACATGCCCAGAGGGCAGCTGGG + Intronic
937095333 2:119231911-119231933 CAGCTGACCTGAGGGCAGAGAGG - Intronic
937437750 2:121893240-121893262 GACGGGCCCAGAGGGCAGAGGGG - Intergenic
938408666 2:131046437-131046459 CACAGGTCCAGAGGGCGGATGGG - Exonic
939271864 2:139949419-139949441 CACGTCATCAGTGGGCAGAAGGG + Intergenic
944601567 2:201308757-201308779 CATGTGGGCAGGGGGCAGATAGG - Intronic
1171471898 20:25378871-25378893 AATGAGAGCAGAGGGCAGATGGG - Intronic
1174751114 20:53112151-53112173 CAGGTCACCAGAGGGCAGGGAGG + Intronic
1175173767 20:57097421-57097443 CATGTGACCAGAGGGAGGACGGG - Intergenic
1181992568 22:26848511-26848533 CAGGTGAGCAGAGGGCTGAGGGG + Intergenic
1182549109 22:31091465-31091487 CAGGCAACCAGAGGGCAGGTAGG + Exonic
1183106955 22:35621900-35621922 CATGTGACCAGAGGTGAGAGTGG - Intronic
1184153395 22:42651175-42651197 CAGGTGAACAGAGGCCTGATGGG + Intergenic
1184467413 22:44677012-44677034 CACATGGCCAAAGGGCAGAGGGG - Intronic
1184872485 22:47249709-47249731 TAGGAGACCAGAGGGCAGAGAGG + Intergenic
950123817 3:10499327-10499349 CACGTGACAACCGGGAAGATGGG + Intronic
956251436 3:67238357-67238379 CACGAGTACAGAGGGCAGCTGGG + Intergenic
962132780 3:132699629-132699651 GACGTGTCCAGAGTTCAGATTGG - Intronic
965193999 3:165571104-165571126 CAGGTGACCACACTGCAGATTGG + Intergenic
966257199 3:177930476-177930498 CAAGAGCCCAGAGGGCAGAGTGG + Intergenic
968647971 4:1749371-1749393 CAGGTGAGGAGGGGGCAGATGGG - Intergenic
969570708 4:8006609-8006631 CACGTGAGTGCAGGGCAGATGGG + Intronic
976077916 4:81320477-81320499 CAGGTGCCCACAGGGCAGAGTGG - Intergenic
982185962 4:152799403-152799425 CACATAAACAGATGGCAGATTGG - Intronic
984940715 4:184929847-184929869 CACATCACCAGTGGGCAGATGGG + Intergenic
986351519 5:6884735-6884757 CACCTTGTCAGAGGGCAGATGGG + Intergenic
986627497 5:9736388-9736410 CACTTCACAAGAGAGCAGATGGG - Intergenic
992255262 5:74914760-74914782 GATCTGACCAGAGGGCAGCTAGG + Intergenic
996657542 5:125959581-125959603 CAGGTCACCAGACGGAAGATAGG + Intergenic
1005496602 6:26393052-26393074 TACGTGACCAGAGGGGAGGAGGG - Exonic
1006250610 6:32780293-32780315 CATGTGACAAGAGGGCAAAGGGG + Intergenic
1006457493 6:34140299-34140321 AACGTGACCAGGGGGCAGTGGGG + Intronic
1011518603 6:88179908-88179930 CAGGTGATCAGAGGGCAGGAGGG - Intergenic
1015685852 6:135858621-135858643 CTGGTGCCCAGAGGGCTGATTGG - Intronic
1015749046 6:136541612-136541634 CACCTGACCAGATGGCACAGAGG - Intronic
1017631499 6:156400656-156400678 CACTAGACCAGAGGGTAGAACGG + Intergenic
1017838910 6:158205385-158205407 CATGTGACCAGAGAGCAGGGCGG + Intergenic
1018916221 6:168134178-168134200 CATGTGTCCAGAGGACAGATGGG - Intergenic
1026844722 7:73692121-73692143 CACAAGACCAGCGGCCAGATAGG - Intronic
1028215951 7:88133435-88133457 TAAGTGACCAGAGGACAGACTGG + Intronic
1029124238 7:98286000-98286022 CATGTGCGCAGAGGGCAGCTTGG + Intronic
1032023620 7:128424006-128424028 CAAGTGGCCAGAAGGCAGAGAGG + Intergenic
1033118297 7:138645464-138645486 CCCATGGCCAGAGGGCAGTTTGG + Intronic
1041456553 8:58066824-58066846 CACATGAGTAGAGGGCAGCTTGG - Intronic
1049534523 8:143172165-143172187 CACGTGACCCCAGAGCAGATTGG + Intergenic
1051100355 9:13514005-13514027 GATGAGTCCAGAGGGCAGATGGG - Intergenic
1052375605 9:27714701-27714723 CAAGTGTCCAAAGGACAGATTGG - Intergenic
1058351938 9:104035360-104035382 CAGGTAACCAGAGGCCAGGTTGG - Intergenic
1059752419 9:117260279-117260301 CATGTGAACAGAGGGCAAAAGGG + Intronic
1060249577 9:121974686-121974708 GAAGTGACCACAGGTCAGATAGG + Intronic
1061890270 9:133615647-133615669 CAAGTGTCCTCAGGGCAGATTGG - Intergenic
1185585041 X:1236493-1236515 GACGGGCCCAGAGGGCAGAGGGG - Intergenic
1192863693 X:75107456-75107478 CACGTGAGGAGAGGGCAGAGTGG + Intronic
1194585786 X:95732514-95732536 CACCTGCGGAGAGGGCAGATGGG - Intergenic
1195233100 X:102871039-102871061 CATGTGACTAGAGAGCATATGGG + Intergenic
1196528106 X:116750775-116750797 CACCTGAGCATAGGGCAGAGAGG + Intergenic
1196895820 X:120334516-120334538 CACTTGACCAGAAGAAAGATGGG - Intergenic
1198158996 X:133988308-133988330 CCTGTGACCAAAGGGCAGATTGG + Intergenic