ID: 1150288969

View in Genome Browser
Species Human (GRCh38)
Location 17:63970998-63971020
Sequence CCACGTGACCAGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288969_1150288980 29 Left 1150288969 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288969_1150288974 -6 Left 1150288969 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288969_1150288979 28 Left 1150288969 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288969 Original CRISPR CCACGTGACCAGAGGGCAGA TGG (reversed) Intronic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
901489603 1:9589796-9589818 CCACCTTTCCAGAGGGCAGGGGG + Intronic
903654598 1:24941677-24941699 CCAAGGGACCAGAGGCCAGCAGG + Intronic
903682064 1:25103703-25103725 CCCCGTGAGCAGAGAGCAGCTGG - Intergenic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904411771 1:30329029-30329051 CCACCAGTCCTGAGGGCAGAAGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
916069587 1:161162052-161162074 CAACATGACCAGAGCCCAGAAGG - Exonic
917610011 1:176679611-176679633 CCACTTGACCCAAGGGCAGCTGG + Intronic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1067552416 10:47245149-47245171 CCACCCCACCAGAGGGCACAGGG - Intergenic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1074917666 10:117972770-117972792 CCACAGAACCAGAGAGCAGAAGG - Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1079445738 11:20554871-20554893 CCTCTTCACCAGACGGCAGAAGG + Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG + Intronic
1085409054 11:76280997-76281019 CCACGAGTCCAGAGCTCAGAGGG + Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG + Intergenic
1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG + Intergenic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1096462267 12:51828628-51828650 CCACAGGACCCGAGGGCAGCAGG - Intergenic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1099990706 12:89718002-89718024 CCATGTGAGGACAGGGCAGAAGG - Intergenic
1102061351 12:109934217-109934239 CCACACCACCAGAGGGCACATGG + Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108786276 13:53905745-53905767 CCACTTGACCCAAGGGCAGCTGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG + Intronic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124688004 15:31798767-31798789 CCACGGCCCCAGAGGCCAGAAGG + Intronic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1128558785 15:68650911-68650933 TCATCTGACCAGAGGGCAGCAGG - Intronic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1131887054 15:96927350-96927372 CCATGTGACCAGGGGGTTGAAGG + Intergenic
1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1139850744 16:69950630-69950652 CCACGTGACTACAGGCCAGGGGG - Intergenic
1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG + Intergenic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1149124428 17:53210540-53210562 TCACATGACAAGAGGGCAAAAGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1152237608 17:79146746-79146768 CCACGTGACCAGCAGGCTGCAGG - Intronic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1155489845 18:26389742-26389764 CCCAGTGACCAGAGGGTAGTGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158587798 18:58756384-58756406 AGACGAGACTAGAGGGCAGAGGG + Intergenic
1158892319 18:61884254-61884276 CCACGTGACCTGAGTGCACAAGG - Intronic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG + Intergenic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1165376704 19:35448194-35448216 CCACGTGACCAGAGAAAGGAAGG - Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166948474 19:46411675-46411697 CCAGCTGACCAGAGGTCACAGGG - Exonic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG + Intronic
925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG + Intronic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
925973078 2:9121301-9121323 TCACCTGACCTGTGGGCAGAAGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG + Intergenic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
938308047 2:130267896-130267918 CCACGTGGGCAAAGGGCAGGGGG + Intergenic
939271863 2:139949418-139949440 TCACGTCATCAGTGGGCAGAAGG + Intergenic
940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG + Intergenic
940373315 2:152925593-152925615 CCACATGCCCAGAGGGCCAAGGG - Intergenic
942768409 2:179485282-179485304 CCACTTAAGCAAAGGGCAGAAGG - Intronic
944721993 2:202432961-202432983 CCACCTTACCAGCTGGCAGATGG - Intronic
947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG + Intronic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1174297653 20:49560628-49560650 CCACGTGAGCAAAGACCAGAAGG + Intronic
1174340051 20:49889946-49889968 CCTGGTGACGAGGGGGCAGACGG - Exonic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1176135223 20:63519601-63519623 CCACGTGCTCAGGGGGCACAAGG + Intergenic
1176384791 21:6133959-6133981 CCAACTGTCCAGAGGGCATAGGG + Intergenic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG + Intronic
1179738681 21:43404293-43404315 CCAGCTGTCCAGAGGGCATAGGG - Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
951663345 3:25095051-25095073 TCACTGGACCAGAGGCCAGAAGG - Intergenic
954633840 3:52060983-52061005 CTAGGTGACTAGAGGGCTGAGGG - Intergenic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG + Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
984940714 4:184929846-184929868 ACACATCACCAGTGGGCAGATGG + Intergenic
986627498 5:9736389-9736411 CCACTTCACAAGAGAGCAGATGG - Intergenic
988092697 5:26563309-26563331 CCACGTGACCAGCAGGAACAAGG + Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1005496603 6:26393053-26393075 TTACGTGACCAGAGGGGAGGAGG - Exonic
1005727489 6:28664107-28664129 CCACATAACAAGAGGTCAGAAGG - Intergenic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG + Intergenic
1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG + Intronic
1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG + Intronic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1010778615 6:79916853-79916875 CCATGTGACCATTGGGCACACGG - Exonic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1017526419 6:155245115-155245137 CCACATGACCACGGGGAAGAAGG - Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1019567141 7:1689928-1689950 CCAGGTGTCCAGAGGGCTCAAGG - Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1027265408 7:76492432-76492454 CCACGTACCCAGAGAGCAAAAGG - Intronic
1027316779 7:76990549-76990571 CCACGTACCCAGAGAGCAAAAGG - Intergenic
1029605890 7:101599205-101599227 TCACATGCCAAGAGGGCAGAGGG - Intergenic
1031125937 7:117773438-117773460 CCACCTGATCAGAGGACAGTGGG + Intronic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1033410630 7:141114577-141114599 TCACCTGCCCAAAGGGCAGAAGG - Intronic
1034353878 7:150435519-150435541 CCTCGTGACCCCAGAGCAGATGG - Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1047507052 8:125488260-125488282 CCATTTTACCAAAGGGCAGACGG - Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1048941599 8:139404996-139405018 CTACCTGTCAAGAGGGCAGAAGG + Intergenic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1062567786 9:137170964-137170986 CCACCTGAGTAGAGGGCTGAGGG - Exonic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195233099 X:102871038-102871060 CCATGTGACTAGAGAGCATATGG + Intergenic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG + Intergenic
1199961879 X:152786651-152786673 CCGCTGGACCAGAAGGCAGATGG - Intergenic
1200146432 X:153928539-153928561 GCACGTGACCAGCAGGCAGCCGG - Intronic