ID: 1150288974

View in Genome Browser
Species Human (GRCh38)
Location 17:63971015-63971037
Sequence ACGTGGGCCCCTGTATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288960_1150288974 26 Left 1150288960 17:63970966-63970988 CCTCTCAAACGCCCATCCTTCCA 0: 1
1: 0
2: 0
3: 31
4: 411
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288964_1150288974 10 Left 1150288964 17:63970982-63971004 CCTTCCATGTAGGACCCCATCTG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288962_1150288974 15 Left 1150288962 17:63970977-63970999 CCCATCCTTCCATGTAGGACCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288968_1150288974 -5 Left 1150288968 17:63970997-63971019 CCCATCTGCCCTCTGGTCACGTG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288967_1150288974 -4 Left 1150288967 17:63970996-63971018 CCCCATCTGCCCTCTGGTCACGT 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288969_1150288974 -6 Left 1150288969 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288963_1150288974 14 Left 1150288963 17:63970978-63971000 CCATCCTTCCATGTAGGACCCCA 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150288965_1150288974 6 Left 1150288965 17:63970986-63971008 CCATGTAGGACCCCATCTGCCCT 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288974 Original CRISPR ACGTGGGCCCCTGTATGTCC AGG Intronic
903683872 1:25116787-25116809 ACGTGGGCTCCTGGAGGGCCTGG - Intergenic
904317294 1:29673727-29673749 AGGTGGGCCCCAGGATGCCCAGG - Intergenic
907267403 1:53271357-53271379 ACATGGGCTCCTGAAGGTCCAGG + Intronic
907710207 1:56873738-56873760 ACGTGCAGCCCTGTATTTCCTGG - Intronic
910216931 1:84852545-84852567 ACGTGCACACCTGGATGTCCTGG - Intronic
911043856 1:93612754-93612776 ACTTGAGCCCCTTTCTGTCCTGG - Intronic
921251923 1:213306267-213306289 ATGTGATCCTCTGTATGTCCAGG + Intergenic
921808889 1:219489111-219489133 ACCTGGGCCCCTGAAAGTACTGG - Intergenic
922542117 1:226427464-226427486 ATGTGGGCCCCTGTGGGCCCAGG - Intergenic
922717569 1:227885274-227885296 ACCTGGGCCCCTGAACTTCCAGG - Intergenic
1062987261 10:1780285-1780307 AGGTGGGCAGGTGTATGTCCCGG + Intergenic
1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG + Intergenic
1067551189 10:47237645-47237667 AGGTGGGCTCCAGTATGGCCTGG - Intergenic
1072352856 10:94575377-94575399 ACGTGAGCCACTGTACCTCCCGG + Intronic
1077186769 11:1238986-1239008 ACGCGGGCCTGTGTGTGTCCTGG + Exonic
1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG + Exonic
1077416476 11:2426464-2426486 ACGATGGCCCCTGGCTGTCCCGG - Intergenic
1079133110 11:17761033-17761055 ACGTGGACCCCTGCCTGTCTTGG - Intronic
1081122690 11:39285944-39285966 ACTTGGTGCCCTGTATGTCAGGG - Intergenic
1082717131 11:56627893-56627915 ACGTAGGTCCTTGTGTGTCCTGG + Intergenic
1089075072 11:115731839-115731861 ACGGGGACCCCTGCATGTCTAGG + Intergenic
1095559995 12:43552660-43552682 GCATGGGCCCCTGTGTGTGCTGG + Intergenic
1105307206 13:19177313-19177335 ACGTGGGACGCTCGATGTCCAGG + Exonic
1108215654 13:48181741-48181763 ACTTGGGCAACTGTATGTCAAGG - Intergenic
1113062446 13:106337834-106337856 ACATGGGGCCCTGTCAGTCCTGG - Intergenic
1116372552 14:44154598-44154620 AGGTTGGCCCCTGTAGGACCAGG + Intergenic
1118797943 14:69161066-69161088 TGGTGGGCGCCTGTAAGTCCAGG + Intergenic
1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG + Intergenic
1129199615 15:73991250-73991272 ACTTGGGCTCCTGAATCTCCAGG - Intronic
1129478348 15:75803040-75803062 ACGTGGGGCCTTGTGTGTCCTGG + Intergenic
1132327622 15:100984938-100984960 ACGTGGGCCCTTCTAGGTGCAGG - Intronic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1142374126 16:89698015-89698037 ACGTGGCCTCCTGTGTGGCCTGG - Exonic
1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG + Intronic
1142847575 17:2689742-2689764 ACGTCGGCACCTGTAACTCCCGG + Exonic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151137942 17:71965674-71965696 ATGTGGGACCCTGTGTGTTCTGG - Intergenic
1151193204 17:72413566-72413588 ACCTGGTCCCTTGTTTGTCCCGG + Intergenic
1157572738 18:48723705-48723727 ACCTGTGCCCCTGTCTCTCCTGG - Intronic
1161460713 19:4395524-4395546 AGGTGAGCACCTGTATTTCCTGG - Intronic
1164720718 19:30429938-30429960 ATGTGGGCCCCAGGAGGTCCTGG + Intronic
1167371005 19:49081972-49081994 ACTTGGGACCCTGTGTGTCATGG - Intergenic
925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG + Intergenic
927199893 2:20571655-20571677 ATGTGGGCCCCAGCAGGTCCAGG - Intronic
932421741 2:71605436-71605458 TCGTGGGTCCCTGAATGCCCAGG + Intronic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
940879144 2:158929119-158929141 TCATGGGCCCCTGGATTTCCAGG + Intergenic
945181612 2:207097466-207097488 ACTTTGTCACCTGTATGTCCAGG + Intronic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1181283470 22:21735974-21735996 ACGTGGGCTCCTGCCCGTCCCGG - Intergenic
1184144322 22:42599930-42599952 ACTTGGGCCCCAGTCTTTCCAGG - Intronic
1184148798 22:42626953-42626975 AGATGGGCCCCTCCATGTCCAGG + Intronic
954290868 3:49649320-49649342 TGGTGGGAGCCTGTATGTCCAGG + Intronic
954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG + Intronic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
962239887 3:133743458-133743480 TCCTTGGCCCCTGCATGTCCTGG + Intergenic
963068679 3:141284213-141284235 ACCTGGGGCCCTGAATGACCAGG - Intronic
965683189 3:171273225-171273247 AGGTGGGTCCCTGTAGCTCCAGG - Intronic
969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG + Intronic
969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG + Intronic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG + Exonic
975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG + Intergenic
984839946 4:184059079-184059101 ACGTGCTCCCCTGCATTTCCTGG + Intergenic
988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002539298 5:179895448-179895470 ACTTGGCCCCCTGTATGCCAGGG + Intronic
1006520786 6:34569976-34569998 AAGTTGGCCCCTGTATGGGCAGG - Intergenic
1016738013 6:147501288-147501310 CCCGGGGCTCCTGTATGTCCAGG + Intergenic
1021555749 7:21916004-21916026 ACGTGGGCCACTGTAAGTTCTGG - Intronic
1023052723 7:36267316-36267338 ATGGGGGCCCCTGCATGGCCAGG + Intronic
1023391385 7:39714721-39714743 ACCTGGGCCCCTTTGTGCCCTGG - Intergenic
1033824980 7:145178552-145178574 CTGTGGGCCCCTGGAGGTCCAGG + Intergenic
1035848853 8:2894058-2894080 ACGTGGGGTCCTGGATGTCTTGG - Intergenic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036258074 8:7221052-7221074 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036310124 8:7679648-7679670 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036891544 8:12600498-12600520 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1047541132 8:125767837-125767859 GTGTGGGTCCCTGTCTGTCCTGG - Intergenic
1056756599 9:89385720-89385742 AAGAGGGCCCCTGTCTGGCCGGG - Intronic
1060913895 9:127372898-127372920 AGGTAGGCCCCTGTATCTTCTGG - Intronic
1062119785 9:134828058-134828080 ACGTGAGCCCCAGTCAGTCCAGG + Intronic
1062616440 9:137398673-137398695 ACGTGGGTGCCTGTGTGTCTTGG - Intronic
1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG + Intronic