ID: 1150288979

View in Genome Browser
Species Human (GRCh38)
Location 17:63971049-63971071
Sequence GTTCTACAAAAACACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 203}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288967_1150288979 30 Left 1150288967 17:63970996-63971018 CCCCATCTGCCCTCTGGTCACGT 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288973_1150288979 20 Left 1150288973 17:63971006-63971028 CCTCTGGTCACGTGGGCCCCTGT 0: 1
1: 0
2: 1
3: 6
4: 145
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288972_1150288979 21 Left 1150288972 17:63971005-63971027 CCCTCTGGTCACGTGGGCCCCTG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288969_1150288979 28 Left 1150288969 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288975_1150288979 4 Left 1150288975 17:63971022-63971044 CCCCTGTATGTCCAGGCTTTGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288968_1150288979 29 Left 1150288968 17:63970997-63971019 CCCATCTGCCCTCTGGTCACGTG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288977_1150288979 2 Left 1150288977 17:63971024-63971046 CCTGTATGTCCAGGCTTTGCTGT 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288976_1150288979 3 Left 1150288976 17:63971023-63971045 CCCTGTATGTCCAGGCTTTGCTG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203
1150288978_1150288979 -7 Left 1150288978 17:63971033-63971055 CCAGGCTTTGCTGTGAGTTCTAC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288979 Original CRISPR GTTCTACAAAAACACCAGCC TGG Intronic
901711640 1:11120222-11120244 TTTCTACAAAAAAATTAGCCGGG - Intronic
903088182 1:20882919-20882941 TCTCTACAAAAAAATCAGCCAGG + Intronic
907774458 1:57499584-57499606 CATCTAGAAAAACACCAGTCCGG - Intronic
909082341 1:71127833-71127855 ATTTTACAAAAACAGCAGTCAGG + Intergenic
910235900 1:85036350-85036372 CTTCTACAAAAAAATTAGCCGGG - Intronic
910459536 1:87434376-87434398 GTTTTGCAGAAAGACCAGCCTGG + Intergenic
912926124 1:113914804-113914826 GTTCAACACCAAGACCAGCCTGG - Intergenic
914316768 1:146520688-146520710 GTTTTGCAGAAAGACCAGCCTGG + Intergenic
914497587 1:148212672-148212694 GTTTTGCAGAAAGACCAGCCTGG - Intergenic
915088176 1:153402738-153402760 TTTCTACAAAAATTCCAGCAAGG - Intergenic
915096712 1:153468071-153468093 TTTCTACAAAAATTCCAGCAAGG + Intergenic
915228128 1:154426213-154426235 GTTCGAGAAAAGCACCAGCTGGG + Intronic
917191294 1:172422129-172422151 GATCTAGTAAGACACCAGCCAGG + Intronic
919621114 1:199865581-199865603 CTTCTAGACAAACACCAACCTGG - Intergenic
920438352 1:205962542-205962564 GTCCTCCAAAAACACCGGGCTGG - Intergenic
921356476 1:214289051-214289073 GTTCTACAGGAATACCAACCAGG - Intronic
922226736 1:223652127-223652149 GTTTTAAAAAAATCCCAGCCTGG + Intronic
924104515 1:240636927-240636949 GTACTACAAGAACATCAGTCTGG - Intergenic
1063316520 10:5011533-5011555 GGTCTACAAAAACACAAGCAGGG + Intronic
1063755174 10:8999232-8999254 GTTCTTCAAAAACAACAACGTGG + Intergenic
1064106854 10:12507685-12507707 TTTCTTGAAAACCACCAGCCCGG + Intronic
1064203195 10:13301131-13301153 GATCTACAAAAAAATTAGCCGGG + Intronic
1068990703 10:63147479-63147501 TCTCTACAAAAATACAAGCCGGG - Intronic
1070032183 10:72687653-72687675 GCTCTACAAAAAAATTAGCCAGG - Intergenic
1070372152 10:75792556-75792578 GTTAAAAAAATACACCAGCCAGG - Intronic
1070666222 10:78346182-78346204 TTTCTACAAAAAACCCAGCTGGG + Intergenic
1070736791 10:78868500-78868522 GTTCTCCAGAAACTCCAGGCAGG + Intergenic
1071205580 10:83272417-83272439 CTTCTTCAAAAACAAAAGCCTGG + Intergenic
1073708264 10:106011191-106011213 GATCTACTGAGACACCAGCCGGG - Intergenic
1075899846 10:126032385-126032407 GTTCCAGACAGACACCAGCCTGG + Intronic
1075903059 10:126058352-126058374 GTTCTGCAAACACAGCAGCCTGG + Intronic
1077196718 11:1284649-1284671 GTCTTAGAAAACCACCAGCCTGG - Intronic
1077731730 11:4738086-4738108 GTTTTAAAAAAAACCCAGCCAGG - Intronic
1080153977 11:29086407-29086429 GTTGCATAAAAACAGCAGCCAGG + Intergenic
1080679484 11:34460780-34460802 TTTCTACAAAACCAACAGCATGG - Intronic
1080712179 11:34759325-34759347 GTTCTTCAAAAAGCCCAGCTGGG - Intergenic
1081572665 11:44301382-44301404 GTTCTTGAAAACCACAAGCCAGG - Intronic
1081615162 11:44586493-44586515 TTTCTACAAAATAATCAGCCAGG + Intronic
1085884323 11:80504970-80504992 GTTTTTCAAAATCACTAGCCAGG + Intergenic
1086702956 11:89920891-89920913 GTTTTAAAAAAACATTAGCCAGG - Intronic
1087895063 11:103577690-103577712 GTACTACAAAAACAGCCACCTGG + Intergenic
1088776524 11:113089721-113089743 GTTTTACAAAAAAAGCAACCGGG + Intronic
1092028549 12:5263749-5263771 TCTCTACAAAAACATCAGCTGGG + Intergenic
1093808474 12:23464692-23464714 GATCTCCAATAACTCCAGCCAGG + Intergenic
1098896225 12:76064005-76064027 TCTCTACAAAAATAACAGCCAGG + Intronic
1100011300 12:89956720-89956742 GTTCTACAAAGAAACCAGAAGGG - Intergenic
1100637037 12:96444447-96444469 GATCGACAAACACTCCAGCCTGG + Intergenic
1104423338 12:128655085-128655107 ATTCTACCAAAACATCATCCAGG + Intronic
1104799637 12:131545308-131545330 ATTCAAGAAATACACCAGCCTGG + Intergenic
1107935157 13:45340569-45340591 TTTCTAGAAAAACCCAAGCCCGG + Intronic
1108041485 13:46343612-46343634 CTTCTAAAAAGAAACCAGCCAGG + Intronic
1108321974 13:49298555-49298577 TTTCTTCAAAAACACTGGCCAGG - Intergenic
1108337307 13:49458242-49458264 TCTCTACAAAAAAATCAGCCAGG - Intronic
1110114036 13:71789035-71789057 CTTCTCCAAAAAAACCAGACTGG + Intronic
1111397178 13:87678145-87678167 GTTCTACAAAGACAGCACTCGGG - Exonic
1113600673 13:111566169-111566191 GTACAACACAAACACCAACCAGG + Intergenic
1117973248 14:61272723-61272745 TATCTACAAAAACACTTGCCTGG + Intronic
1118543473 14:66858167-66858189 GACCTACTAAGACACCAGCCAGG + Intronic
1121464927 14:94109580-94109602 GTTATGCAAAAACACTTGCCTGG - Intronic
1121618529 14:95330472-95330494 CCTTTACAAAAACAACAGCCCGG + Intergenic
1124555309 15:30719604-30719626 GTTCAACAGCATCACCAGCCAGG + Intronic
1124675952 15:31686090-31686112 GTTCAACAGCATCACCAGCCAGG - Intronic
1125764268 15:42122811-42122833 GTTCTAAGAAAATTCCAGCCCGG - Intergenic
1127704466 15:61533413-61533435 GCTCAATAAAAACACCAGTCTGG - Intergenic
1130446289 15:84004877-84004899 GTTCTCCAAACACACCACACTGG - Intronic
1130773546 15:86951018-86951040 GTTCTACAAAAACCTCAAACTGG + Intronic
1131135598 15:89932590-89932612 CTTCTACAAGACCACTAGCCTGG - Intergenic
1131419131 15:92288967-92288989 GTTCTACATAAAGATCACCCTGG - Intergenic
1133395675 16:5445339-5445361 GTTCTACAAACTCAACACCCTGG + Intergenic
1133624095 16:7553873-7553895 GCTCTTCAAAAAGACCTGCCAGG - Intronic
1137577666 16:49613659-49613681 ATGCTACAAACACTCCAGCCTGG + Intronic
1139489829 16:67280184-67280206 GTCCTCCAAGACCACCAGCCGGG + Exonic
1140008370 16:71103772-71103794 TTTCTACAAAAAAACCATCTTGG + Intronic
1141616102 16:85210433-85210455 TTTCTACAAAAAAATTAGCCGGG + Intergenic
1142732776 17:1872839-1872861 TTTCTACAAAAAAATTAGCCAGG - Intronic
1144693819 17:17287536-17287558 ATTCTACAATAGCACCTGCCTGG - Intergenic
1146758010 17:35449732-35449754 GTGTTACAAGAAAACCAGCCAGG - Intergenic
1146764486 17:35506942-35506964 GTACTACAAAAACAGCCACCTGG + Intronic
1146973544 17:37092117-37092139 CCTCTACAAAAAAATCAGCCAGG + Intronic
1150288979 17:63971049-63971071 GTTCTACAAAAACACCAGCCTGG + Intronic
1150771629 17:68046946-68046968 CTTCTGCAAAAACTGCAGCCAGG - Intergenic
1152342592 17:79733545-79733567 GTACTACAACACCACCAGCAAGG + Exonic
1152653068 17:81505207-81505229 CTACTAAAAATACACCAGCCGGG + Intergenic
1153044376 18:842432-842454 ATTGTACAAAGACACCATCCAGG + Intergenic
1155788977 18:29939516-29939538 CTTCCACAAAAATAACAGCCTGG - Intergenic
1161210552 19:3063080-3063102 GTTCTGCAGAAAAACCAGCCGGG + Exonic
1161580090 19:5075990-5076012 GTTCTAGAACCAGACCAGCCAGG - Intronic
1161710654 19:5845853-5845875 TTTTTAAAAAAAGACCAGCCTGG + Intronic
1162530822 19:11235583-11235605 TTTCTACAAACTCACCATCCGGG + Exonic
1162796781 19:13091209-13091231 ATTTTACAAAAACACCACCTTGG + Intronic
1162844461 19:13381716-13381738 GTTCTTCAAATGCACCAGGCTGG + Intronic
1165045478 19:33101680-33101702 GTTTTCAAAAAACAACAGCCTGG + Intronic
1165983979 19:39751523-39751545 GACATACAAAAACACCAGCTTGG + Intergenic
1166952486 19:46438828-46438850 GTTCTTCAAGTACACCAGGCAGG - Intergenic
1166952681 19:46440242-46440264 GTTCTTCAAGTACACCAGGCAGG - Intergenic
1167929453 19:52852378-52852400 TTTTTACAAAAATAACAGCCAGG + Intronic
1168592398 19:57648173-57648195 ATTCTATAAAACCAGCAGCCTGG - Intergenic
925269358 2:2591339-2591361 GTTCTAGAAAAACACCAGCTGGG + Intergenic
925579704 2:5398110-5398132 GTTCTACGAGAAAAGCAGCCAGG + Intergenic
925972469 2:9115706-9115728 TCTCTACAAAAACATTAGCCTGG - Intergenic
926030102 2:9579102-9579124 CCTCTACAAAAATACTAGCCAGG - Intergenic
929816970 2:45240229-45240251 GTACAAGAAAATCACCAGCCTGG + Intergenic
929998973 2:46848142-46848164 GATCTGGAAAAACATCAGCCTGG - Intronic
930312162 2:49755632-49755654 TCTCTACAAACAAACCAGCCAGG + Intergenic
930361331 2:50383867-50383889 GTACTACAAAAAGACCAGTTGGG + Intronic
932951421 2:76298428-76298450 ATTATACAAAAACACTAACCAGG + Intergenic
933238075 2:79887116-79887138 GATCTTCAAAAACACAAGTCTGG - Intronic
933381425 2:81551727-81551749 GTTTTACTAAAACACCACACAGG - Intergenic
934931295 2:98427004-98427026 TTTCTACAAAGAAACCAGCTGGG + Intergenic
935491065 2:103720944-103720966 CTTACACAAAAACAACAGCCAGG + Intergenic
938065297 2:128278760-128278782 GTTCAGAAAAAACACCACCCAGG + Intronic
940967389 2:159854914-159854936 GTACTCCAAAAACACCAGACTGG - Exonic
941931595 2:170946170-170946192 TTTCTACAAAAAAATTAGCCAGG - Intronic
944509422 2:200450218-200450240 ATTCTAGAAAATCACTAGCCTGG + Intronic
945575594 2:211525186-211525208 GACCTACTAAAACACCAGCCAGG + Intronic
947222758 2:227809840-227809862 TTTCTACAAAGAAGCCAGCCAGG + Intergenic
948159395 2:235811883-235811905 GTTCTCTCAAAACATCAGCCAGG - Intronic
1173063729 20:39688365-39688387 TTTCTATCAAAACCCCAGCCAGG + Intergenic
1175621300 20:60449869-60449891 CTTCTACAAAAACACTTGCTCGG - Intergenic
1180870656 22:19145000-19145022 ATTCTACAAAAATACAAACCAGG + Intergenic
1180970641 22:19813275-19813297 GTTCTCCAAAAACAGGAACCAGG + Intronic
1181438660 22:22924618-22924640 CTTCTACAAAGACCCCAGCTTGG + Intergenic
1182329957 22:29544519-29544541 GTTATACAAGTACACCTGCCAGG - Exonic
1183028014 22:35080771-35080793 GTTCTTCACATACACCAACCAGG - Intronic
1183343336 22:37294120-37294142 GCTCCAGAAAGACACCAGCCGGG + Intronic
1185044745 22:48523305-48523327 GTTCCACTTAAACACCATCCAGG + Intronic
1185084382 22:48731335-48731357 GTTCTCCAGAAAATCCAGCCAGG + Intronic
949266997 3:2169564-2169586 TCTCTACAAAAAAATCAGCCGGG - Intronic
949792150 3:7804573-7804595 GTTCCACAAAAAAACCAACTTGG + Intergenic
950027607 3:9831253-9831275 GTTCTACAAAACAACCCGCCTGG - Intronic
950927850 3:16760391-16760413 GACCTACTAAGACACCAGCCAGG - Intergenic
952041895 3:29270763-29270785 GTTTTACAAAAATATCAGCTGGG - Intergenic
952973159 3:38668932-38668954 GTTCTACAAAAAATCCTGCTGGG + Intergenic
954061373 3:48070621-48070643 GTTCTACAAAAACACAAAATAGG - Intronic
954486668 3:50859515-50859537 GTCCTACAAAAAAACCACACCGG - Intronic
955007914 3:54986990-54987012 GACTTACAAAAACATCAGCCTGG + Intronic
955058524 3:55476466-55476488 GTTCTACAAATCCCCCATCCAGG - Intronic
955426365 3:58795470-58795492 TTTCTACAAAAAAATCAGCTTGG + Intronic
957666275 3:83233076-83233098 GATATTCAAAAAAACCAGCCTGG + Intergenic
958914945 3:100039437-100039459 GTTCTACAAAAATACCAACTTGG + Intronic
960413755 3:117359176-117359198 GATCTCCAATAACTCCAGCCAGG + Intergenic
962805044 3:138920982-138921004 GCTTTAAAAAAATACCAGCCAGG - Intergenic
963480387 3:145865927-145865949 GTTTTACACAGACATCAGCCTGG - Intergenic
965088066 3:164125172-164125194 CTTCTCCAAAAACACAAGACAGG - Intergenic
966720500 3:183057709-183057731 TCTCTACAAAAAAACTAGCCAGG + Intronic
969017430 4:4113261-4113283 GTGCTATAAAAAGAGCAGCCTGG + Intergenic
971211466 4:24621816-24621838 GTACTACAAAAACAGTAACCTGG - Intergenic
971666058 4:29486942-29486964 ATTCAACAAAAACACCAGGCAGG - Intergenic
974442191 4:61933733-61933755 TTACTATGAAAACACCAGCCAGG + Intronic
976481723 4:85554703-85554725 GCACTACAAACACTCCAGCCTGG - Intronic
977175142 4:93810546-93810568 ATTATAGTAAAACACCAGCCAGG + Intergenic
978191802 4:105922543-105922565 TCTCTACAAAAAAACTAGCCAGG - Intronic
985697679 5:1350265-1350287 GGACTACAAAAACCACAGCCCGG + Intergenic
985744396 5:1638035-1638057 GCTCCACATAAACACAAGCCAGG + Intergenic
986560475 5:9055847-9055869 GTTCTAGGAAAACACATGCCTGG - Intronic
987121633 5:14773377-14773399 TTGCTAAAAACACACCAGCCTGG + Intronic
990132588 5:52605697-52605719 GTTTTAAAAAAAAACCAGCAGGG + Intergenic
992329990 5:75706716-75706738 GCTCTACAAAAAAATTAGCCGGG - Intronic
995246036 5:109936863-109936885 GTTTAACAAAGACATCAGCCTGG - Intergenic
995716474 5:115086019-115086041 TTTCTACAAAAAAATTAGCCAGG + Intergenic
997073349 5:130642908-130642930 GACCTACAGAGACACCAGCCGGG - Intergenic
998453658 5:142253758-142253780 GTTTTTCAAAAAAACCAGCCTGG - Intergenic
998538431 5:142955953-142955975 GTTCTAAAGAAATACCAGGCTGG - Intronic
999332166 5:150682322-150682344 ATTCTACGAAAACACCTGACTGG + Intergenic
1000620942 5:163486159-163486181 TTTCTACAAAGAAACCAGCTGGG + Intronic
1001022677 5:168196756-168196778 GTTCTTCAAGAACACTGGCCTGG - Intronic
1002962988 6:1934402-1934424 TTTCTGCAAAAACACCAACAGGG + Intronic
1004177235 6:13350445-13350467 GTTCTCCAAATAGAACAGCCAGG + Intergenic
1006344345 6:33467845-33467867 TTTCTACAAAAACCCTGGCCAGG + Intergenic
1007602378 6:43090556-43090578 GTTGTACAAAGACCCTAGCCAGG + Intronic
1008773636 6:55009082-55009104 GATCTCCAATAACTCCAGCCAGG - Intergenic
1009576631 6:65471181-65471203 TGTTTACAAAAGCACCAGCCTGG + Intronic
1009591682 6:65680788-65680810 ATTCTGCAGAAACACCAGCTGGG + Intronic
1011106062 6:83783102-83783124 GTTTAACAAAAACAACAGTCTGG + Intergenic
1012240160 6:96862061-96862083 GTTTTACATAAACAGAAGCCTGG - Intergenic
1013108893 6:107049350-107049372 CTTCTACTAAAACATAAGCCAGG - Intronic
1014267512 6:119297880-119297902 GTTCAAGAAATCCACCAGCCTGG + Intronic
1015052551 6:128859673-128859695 GTTCTCCAAAAAGAAAAGCCTGG - Intergenic
1016141171 6:140612685-140612707 TTTCTACTAAAACCCCAGGCTGG - Intergenic
1017158110 6:151340804-151340826 GTTCTGCAAAACAACTAGCCTGG - Intronic
1017797953 6:157864732-157864754 GTTTTTAAAAAACACCAGCCGGG + Intronic
1019018348 6:168896762-168896784 GTTCTGCAAAAACTTCAGCCAGG - Intergenic
1019056491 6:169227278-169227300 GTTCTACAGAAGCACTCGCCTGG + Intronic
1022231253 7:28415149-28415171 GTTCTAGTCAAACGCCAGCCTGG - Intronic
1026062889 7:67042285-67042307 GTCCTACCAAAACACCACCTTGG + Intronic
1026715462 7:72785206-72785228 GTCCTACCAAAACACCACCTTGG - Intronic
1027952094 7:84829658-84829680 ATTCTACAAAAATATCAGTCTGG + Intergenic
1028629255 7:92915948-92915970 GTTCTTCAAAAAAATTAGCCAGG - Intergenic
1034954040 7:155322317-155322339 GTGCTACTACAACTCCAGCCTGG + Intergenic
1034997871 7:155589804-155589826 GTTCTACACAGACAGGAGCCTGG + Intergenic
1035615202 8:994494-994516 GTTATTAAAAAACACCAGGCTGG - Intergenic
1037485491 8:19342942-19342964 GCTCTGCAAAAACACCACCGAGG - Intronic
1040091805 8:43406676-43406698 GGTCTACAAAATAACCAGGCAGG - Intergenic
1040878315 8:52175890-52175912 GTGTTTCCAAAACACCAGCCAGG - Intronic
1042238230 8:66637045-66637067 GTTATTAAAAAACTCCAGCCAGG + Intronic
1042255554 8:66799780-66799802 AAACTACAAAAACACTAGCCAGG - Intronic
1042971925 8:74418151-74418173 TATCTACAAAAACATCTGCCGGG - Intronic
1043223831 8:77699395-77699417 GAACTCCAAAAACTCCAGCCAGG - Intergenic
1043752702 8:83960264-83960286 GTTCTACATAAAAATTAGCCAGG + Intergenic
1044723739 8:95175365-95175387 GACCTACAAAAACACCAGGCAGG - Intergenic
1045486005 8:102632420-102632442 GTCTTACAAAATCACCAACCTGG + Intergenic
1046388421 8:113535108-113535130 TCTCTACAAAAAAATCAGCCAGG - Intergenic
1047494374 8:125399099-125399121 GTTCTACAAAACCCCAAGCCAGG + Intergenic
1048323103 8:133417330-133417352 GTTTCACAAAAACACCAGCCGGG + Intergenic
1052347174 9:27421536-27421558 GTTCTTTTAAAACACCAGGCCGG + Intronic
1055440809 9:76334430-76334452 GCTCTTGAAAAACACCAGCCAGG + Intronic
1056156350 9:83842303-83842325 TTTCTATAAGAAAACCAGCCGGG - Exonic
1056354179 9:85781278-85781300 TTTCTATAAGAAAACCAGCCGGG + Intergenic
1057520771 9:95758431-95758453 ATTCTATAAAAACAGTAGCCTGG - Intergenic
1058987379 9:110220799-110220821 TTTCTGCAAACAGACCAGCCAGG - Intergenic
1059230219 9:112713821-112713843 TTTCTACAAAAAAATTAGCCAGG + Intronic
1061627509 9:131849723-131849745 ATTGTACAACAACATCAGCCTGG + Intergenic
1187757979 X:22547110-22547132 GTTTCCCAAAAACACCAGCATGG - Intergenic
1188377123 X:29444856-29444878 GTACTACAAAACCACCATCAGGG - Intronic
1188493874 X:30763587-30763609 GTTTTAAAAAAAAAACAGCCAGG + Intergenic
1188698567 X:33229801-33229823 TTTCTACTAAAATACCAGCAAGG - Intronic
1190374421 X:49775141-49775163 GACCTAGAGAAACACCAGCCAGG - Intergenic
1195246712 X:103001751-103001773 GTTCTATAAACACACAAACCAGG - Intergenic
1196214572 X:113035561-113035583 GACCTACTAAAACACCAGCTAGG - Intergenic
1199440893 X:147866789-147866811 GACCTACCAAGACACCAGCCAGG + Intergenic