ID: 1150288980

View in Genome Browser
Species Human (GRCh38)
Location 17:63971050-63971072
Sequence TTCTACAAAAACACCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 223}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150288977_1150288980 3 Left 1150288977 17:63971024-63971046 CCTGTATGTCCAGGCTTTGCTGT 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288975_1150288980 5 Left 1150288975 17:63971022-63971044 CCCCTGTATGTCCAGGCTTTGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288972_1150288980 22 Left 1150288972 17:63971005-63971027 CCCTCTGGTCACGTGGGCCCCTG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288968_1150288980 30 Left 1150288968 17:63970997-63971019 CCCATCTGCCCTCTGGTCACGTG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288978_1150288980 -6 Left 1150288978 17:63971033-63971055 CCAGGCTTTGCTGTGAGTTCTAC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288976_1150288980 4 Left 1150288976 17:63971023-63971045 CCCTGTATGTCCAGGCTTTGCTG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288969_1150288980 29 Left 1150288969 17:63970998-63971020 CCATCTGCCCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1150288973_1150288980 21 Left 1150288973 17:63971006-63971028 CCTCTGGTCACGTGGGCCCCTGT 0: 1
1: 0
2: 1
3: 6
4: 145
Right 1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150288980 Original CRISPR TTCTACAAAAACACCAGCCT GGG Intronic
900551345 1:3257697-3257719 TTCAACAAATACGCCTGCCTTGG + Intronic
902802531 1:18839314-18839336 TTCTAGAAAAAAACCACCCAAGG - Intergenic
903879357 1:26498451-26498473 TTTTATAAAAACAGCAGGCTGGG - Intergenic
905284965 1:36873299-36873321 TTTTACAAAAACGCCAACCAAGG - Intronic
907774457 1:57499583-57499605 ATCTAGAAAAACACCAGTCCGGG - Intronic
908474465 1:64473898-64473920 TTTTACAAAAACAAAAACCTAGG + Intronic
911237831 1:95430710-95430732 GTGAACAAAGACACCAGCCTGGG - Intergenic
911868552 1:103060726-103060748 TTCAATAAATCCACCAGCCTTGG - Intronic
911942242 1:104061509-104061531 TTATACAAAATTACCAGGCTGGG + Intergenic
912675279 1:111674527-111674549 TTCTACAGAACCTCCAGACTTGG + Intronic
912926123 1:113914803-113914825 TTCAACACCAAGACCAGCCTGGG - Intergenic
914220661 1:145679062-145679084 TGCTACTAAAATGCCAGCCTGGG - Intronic
915079569 1:153342634-153342656 TTCTAAAAAAAAACCACTCTGGG - Intronic
915392752 1:155559236-155559258 TTATACAAAAACACCAGATGAGG + Intronic
916085603 1:161266858-161266880 TGCTCCAAAAACAGCAGTCTAGG + Intronic
916349809 1:163836433-163836455 TTCCATACAAACACCAGGCTTGG - Intergenic
917339840 1:173964678-173964700 TTCTTAAAAAACACTAGCATGGG + Intronic
919519610 1:198571524-198571546 CTCTAAAGAAACACCAGCCTTGG + Intergenic
920438351 1:205962541-205962563 TCCTCCAAAAACACCGGGCTGGG - Intergenic
923644478 1:235803014-235803036 TTCTGAAAAATCACCAGGCTGGG + Exonic
924104514 1:240636926-240636948 TACTACAAGAACATCAGTCTGGG - Intergenic
1062871360 10:907908-907930 TTCCACAAAAACCCTAGGCTGGG + Intronic
1064848652 10:19685312-19685334 TTCTACAAATTCCCCAGCCGTGG + Intronic
1065618786 10:27557352-27557374 TTCTACAAAAACACCCAACACGG + Intergenic
1065684558 10:28270784-28270806 CTCTTCAAAAACAGCAGCCTAGG - Intronic
1068990702 10:63147478-63147500 CTCTACAAAAATACAAGCCGGGG - Intronic
1069473237 10:68711433-68711455 CTCTACAAAAATGCCAGGCTCGG - Intergenic
1069822686 10:71237217-71237239 TTCCACATAAACACGAGTCTTGG - Intronic
1070024991 10:72623844-72623866 CTCAACAAAAGGACCAGCCTCGG + Intronic
1071205581 10:83272418-83272440 TTCTTCAAAAACAAAAGCCTGGG + Intergenic
1071765185 10:88655932-88655954 TTCTAGACAAAGACCAGTCTGGG - Intergenic
1073313498 10:102561528-102561550 TGCTATAAAAACACTAGGCTCGG - Intronic
1073398839 10:103240562-103240584 TTCTACACAAAAATCAGCCCCGG + Intergenic
1073676218 10:105650001-105650023 ATCTGCAAAAACACCAACTTTGG + Intergenic
1075472609 10:122704196-122704218 CTCTACAAAACCACCAGCTCAGG + Intergenic
1075903060 10:126058353-126058375 TTCTGCAAACACAGCAGCCTGGG + Intronic
1076744797 10:132507454-132507476 TTCCCCCAAAACACCTGCCTGGG + Intergenic
1077196717 11:1284648-1284670 TCTTAGAAAACCACCAGCCTGGG - Intronic
1077959243 11:7055877-7055899 TGCTACCAAAACAACATCCTTGG - Intronic
1078431885 11:11294394-11294416 TTATACAAACAAAACAGCCTAGG - Intronic
1079196803 11:18335615-18335637 TTCTACAAAAGCATCAGTATTGG + Intronic
1079498192 11:21070119-21070141 TTCAAAAAAAAAAACAGCCTTGG - Intronic
1079778080 11:24559889-24559911 CCCTAAAAAAACACCAGTCTTGG - Intronic
1080679483 11:34460779-34460801 TTCTACAAAACCAACAGCATGGG - Intronic
1080774015 11:35369056-35369078 TTATAGAAAAACACAAGTCTGGG + Intronic
1083062978 11:59893897-59893919 TTTTAAAAAAACACCATCCAAGG - Intergenic
1086647379 11:89241035-89241057 TTCTACACAAACATCAGATTTGG + Intronic
1086896483 11:92318825-92318847 ATCTACCAAAACACCCTCCTTGG - Intergenic
1087371225 11:97287393-97287415 CTTTGCAAAAACACCTGCCTTGG + Intergenic
1088321328 11:108557249-108557271 TTCTGGAAACACTCCAGCCTGGG - Intronic
1088547061 11:110969702-110969724 TTCTTCAGAAACAGCAGCATTGG - Intergenic
1091612831 12:2025683-2025705 TTCACCTAAAATACCAGCCTTGG + Intronic
1091742335 12:2968630-2968652 AACAAAAAAAACACCAGCCTGGG - Intronic
1093962871 12:25294380-25294402 TTCTTCAAGAACAGCAGCCCTGG - Intergenic
1098350135 12:69550552-69550574 ATCTCCAATAATACCAGCCTGGG + Intronic
1100095236 12:91025900-91025922 TGTTTCACAAACACCAGCCTAGG + Intergenic
1100637038 12:96444448-96444470 ATCGACAAACACTCCAGCCTGGG + Intergenic
1100711305 12:97259805-97259827 TGCCACATAAAAACCAGCCTGGG + Intergenic
1102125490 12:110477019-110477041 TTCTACAAAAGAACAGGCCTGGG - Intronic
1104799638 12:131545309-131545331 TTCAAGAAATACACCAGCCTGGG + Intergenic
1105471040 13:20694921-20694943 TTATACAAAAACTGCAGCCCAGG + Intergenic
1105473158 13:20709822-20709844 TTCAGCACAAACAACAGCCTGGG + Intronic
1106692657 13:32134953-32134975 TTCAACAAAAAGCCCAGCCAAGG - Exonic
1107658547 13:42615989-42616011 TTCTACAAAATCACCAACACAGG + Intergenic
1107991593 13:45823432-45823454 TGCTATAAAAAGACCTGCCTGGG - Intronic
1109198502 13:59405781-59405803 TTATACAGAAATACCAGGCTTGG + Intergenic
1109216610 13:59596821-59596843 TATTACAAGAACACCAGCATGGG + Intergenic
1109336067 13:60995942-60995964 TTCAACAAAAATAACAGACTTGG - Intergenic
1113388013 13:109869305-109869327 TTCTAAGAAAATCCCAGCCTGGG + Intergenic
1115213653 14:30993054-30993076 TTCTACTTCAAGACCAGCCTGGG + Intronic
1115983621 14:39080952-39080974 TTCTCAAAAAACATCAGCCAAGG + Intronic
1116187221 14:41611765-41611787 TTCTCCCAAAACACCAGCACAGG - Intronic
1116621491 14:47209866-47209888 TCCTCCCAAAACATCAGCCTTGG - Intronic
1117973249 14:61272724-61272746 ATCTACAAAAACACTTGCCTGGG + Intronic
1119105991 14:71924251-71924273 AATTACAAAAATACCAGCCTGGG - Intergenic
1119918382 14:78423937-78423959 GTCTGCAAAAACTCCAGGCTAGG + Intronic
1121618530 14:95330473-95330495 CTTTACAAAAACAACAGCCCGGG + Intergenic
1125966897 15:43882054-43882076 TCCTAAAAAAACACCATCTTCGG + Intronic
1125978290 15:43975736-43975758 TTCTACAAAAAAAGCCTCCTGGG - Intronic
1126833926 15:52639510-52639532 TTCTATAAATACAACAGTCTGGG + Intronic
1128626598 15:69213400-69213422 TTCTACAAAAATACCTGACCAGG - Intronic
1128757038 15:70190156-70190178 TTCCAGAAACACACCTGCCTGGG - Intergenic
1130773547 15:86951019-86951041 TTCTACAAAAACCTCAAACTGGG + Intronic
1131419130 15:92288966-92288988 TTCTACATAAAGATCACCCTGGG - Intergenic
1132117886 15:99150934-99150956 TTCTTCCAACCCACCAGCCTGGG + Intronic
1136032310 16:27512534-27512556 TACTACAAAAAAACCAGCAATGG + Intronic
1138374583 16:56553975-56553997 TAGTGCAAGAACACCAGCCTGGG - Intergenic
1139660719 16:68419039-68419061 TTCTACAAATAGACCATACTGGG - Intronic
1143833678 17:9672702-9672724 TTCAACAAAAACACTACCATGGG + Intronic
1147947818 17:44090230-44090252 CTCGAAAAAAAGACCAGCCTGGG + Intronic
1149924389 17:60688499-60688521 TTTTTAAAAAACACCAGCTTGGG - Intronic
1150288980 17:63971050-63971072 TTCTACAAAAACACCAGCCTGGG + Intronic
1153044377 18:842433-842455 TTGTACAAAGACACCATCCAGGG + Intergenic
1154141688 18:11829691-11829713 TTATACAAGAACACCCACCTAGG - Intronic
1154472808 18:14721465-14721487 GTCTACAAAAAAACCAGTCTTGG + Intergenic
1157696445 18:49727444-49727466 GTTTTCATAAACACCAGCCTTGG + Intergenic
1159523081 18:69550990-69551012 TTAAAAAAAAACTCCAGCCTGGG - Intronic
1159736653 18:72107672-72107694 TTTTACAAAAAGATCAGCGTGGG - Intergenic
1159789495 18:72760403-72760425 TTCTCCACACACATCAGCCTGGG + Intronic
1161710655 19:5845854-5845876 TTTTAAAAAAAGACCAGCCTGGG + Intronic
1163539282 19:17897523-17897545 TTCTACAAAAAAACAAGCTATGG - Intergenic
1165016022 19:32880425-32880447 GTCTAAAAAAGCCCCAGCCTGGG + Intronic
1165983980 19:39751524-39751546 ACATACAAAAACACCAGCTTGGG + Intergenic
1168394802 19:56038729-56038751 TGCTACAACAACACAGGCCTGGG - Intronic
1168592397 19:57648172-57648194 TTCTATAAAACCAGCAGCCTGGG - Intergenic
925029661 2:639845-639867 TTCTACAAAATCAGCACCTTGGG - Intergenic
925178629 2:1802195-1802217 TTCTGCAAACACCCCAGGCTTGG + Intronic
925269359 2:2591340-2591362 TTCTAGAAAAACACCAGCTGGGG + Intergenic
925837323 2:7959074-7959096 TACCACACCAACACCAGCCTGGG + Intergenic
927351660 2:22124045-22124067 GTTCACAAAAACAGCAGCCTTGG - Intergenic
929816971 2:45240230-45240252 TACAAGAAAATCACCAGCCTGGG + Intergenic
930043876 2:47151561-47151583 TTCTCCTAAAACACCATTCTTGG + Intronic
930438248 2:51374450-51374472 CTCTACCAAAAAAGCAGCCTGGG + Intergenic
930802024 2:55452763-55452785 TTCTAAAAAAACACCAAACTAGG - Intergenic
932467769 2:71934572-71934594 TTCTCAAAAAGCCCCAGCCTGGG + Intergenic
933238074 2:79887115-79887137 ATCTTCAAAAACACAAGTCTGGG - Intronic
934603592 2:95677889-95677911 TGCTACAAAGAAACCAGCATGGG + Intergenic
935505801 2:103900679-103900701 TTTTACAAAAACCCTAGCTTTGG + Intergenic
936600764 2:113891788-113891810 TCCTAGGAAAACACTAGCCTTGG + Intronic
937245359 2:120488936-120488958 TTCTTCAAAAATCCCAGCCAAGG - Intergenic
939337866 2:140854142-140854164 TTGTTCAAAAACACTAGCATAGG + Intronic
942031283 2:171962687-171962709 TTTTAAAAAGACACCAGGCTGGG - Intronic
942084884 2:172434443-172434465 TTCTACAAACATGCCAACCTCGG - Intronic
943571477 2:189580561-189580583 CTCTAAAAACACAACAGCCTTGG + Exonic
943638187 2:190329160-190329182 TTTTCCAAGAACACAAGCCTTGG + Intronic
945575595 2:211525187-211525209 ACCTACTAAAACACCAGCCAGGG + Intronic
947705969 2:232275897-232275919 TTCTACAGTAACACCAGCTGTGG + Intronic
947991749 2:234493905-234493927 TTCTACAAAAAGACCAGCATTGG + Exonic
948480806 2:238249146-238249168 TCCTACAGAAACTCCAGCCCAGG - Exonic
1168867163 20:1096908-1096930 TTCTACAAAAGCCCCAAACTGGG - Intergenic
1169560601 20:6796320-6796342 ATCTACAAAAATACCATACTAGG + Intergenic
1172194222 20:33081181-33081203 TCCAACAAAAACACCAAACTGGG - Intronic
1172294006 20:33795218-33795240 TTCTACAAATTCTCCTGCCTTGG - Intergenic
1174027517 20:47590592-47590614 TTAAAAAATAACACCAGCCTGGG + Intronic
1174647593 20:52099202-52099224 TTTTACAGAAATATCAGCCTGGG - Intronic
1174696263 20:52561941-52561963 TGCTAGAAAAACCCCAGCTTTGG + Intergenic
1174791246 20:53480367-53480389 CTCTACAAAAACACCTGGGTTGG - Intronic
1175762308 20:61569829-61569851 TTCTAGAAAACAACTAGCCTGGG - Intronic
1176045828 20:63092152-63092174 TTCTCCAGAAACCCCAGACTGGG - Intergenic
1176424232 21:6538150-6538172 TGGAGCAAAAACACCAGCCTTGG + Intergenic
1176801678 21:13436390-13436412 GTCTACAAAAAAACCAGTCTTGG - Intergenic
1177349352 21:19914696-19914718 TTTTAGAAAAACAGCATCCTTGG + Intergenic
1179606022 21:42515612-42515634 TTCTTCAAAAAACCCACCCTAGG - Intronic
1179670938 21:42947245-42947267 TTCTGTAAAAACAGCAGTCTTGG + Intergenic
1179699725 21:43146465-43146487 TGGAGCAAAAACACCAGCCTTGG + Intergenic
1183935952 22:41262425-41262447 TTCAACCTCAACACCAGCCTGGG + Intronic
1184953964 22:47869205-47869227 TTCTACACAAAAACCTGACTTGG - Intergenic
955343997 3:58147700-58147722 TGCCACTAAAACTCCAGCCTGGG - Intronic
959249833 3:103927443-103927465 TTCTAAAAAAACCCCACCTTTGG - Intergenic
960487222 3:118269312-118269334 GTCTACCAACACCCCAGCCTGGG + Intergenic
960565442 3:119126855-119126877 ATCTACAAAAACCCCATCCAAGG + Intronic
962040797 3:131705644-131705666 ACCTACAAAAGCACCATCCTAGG + Intronic
962359679 3:134727353-134727375 GTTAGCAAAAACACCAGCCTGGG + Intronic
962705579 3:138040092-138040114 TTCTATAAAAACCCCTCCCTGGG + Intergenic
963480386 3:145865926-145865948 TTTTACACAGACATCAGCCTGGG - Intergenic
966292435 3:178375567-178375589 TTCTGTAAAAACAACAGACTAGG + Intergenic
968360487 3:198143622-198143644 TCCTATAAAAACACCAGCAGAGG + Intergenic
968896860 4:3409500-3409522 TTCCACAAATACACCAGTGTGGG + Intronic
970336071 4:15044184-15044206 GTTTACAAAAACAGAAGCCTTGG - Intronic
971355203 4:25888992-25889014 TTCTACAAAACCACAAGGCCAGG - Intronic
972409538 4:38779009-38779031 TTCAAGAAAAAAACCAGACTTGG - Intronic
972836437 4:42876174-42876196 CTCTCCAATAAAACCAGCCTTGG - Intergenic
976231181 4:82844958-82844980 AACTACAAAAACACCAACCAAGG - Intronic
976481722 4:85554702-85554724 CACTACAAACACTCCAGCCTGGG - Intronic
977175143 4:93810547-93810569 TTATAGTAAAACACCAGCCAGGG + Intergenic
978162890 4:105570625-105570647 CTGTCCAAAAACAGCAGCCTAGG + Intronic
980420153 4:132548223-132548245 TTCTTAAGAAACACCAGCATTGG - Intergenic
982092330 4:151891473-151891495 TTGTCTAAAAACACCAGCCCTGG + Intergenic
985751947 5:1685538-1685560 TTGGACAAAATCACCATCCTCGG - Intergenic
986690512 5:10309576-10309598 TATAACAAAAACACCAGGCTGGG - Intergenic
987121634 5:14773378-14773400 TGCTAAAAACACACCAGCCTGGG + Intronic
988979338 5:36550655-36550677 TTCTATAAAAATACCTGCTTGGG - Intergenic
991700901 5:69315393-69315415 CTCTACTAAAAATCCAGCCTAGG + Intronic
993376340 5:87153329-87153351 TTCTACAAAAACAATGGCCCAGG + Intergenic
994720126 5:103371065-103371087 TTATTCAAGGACACCAGCCTAGG + Intergenic
995087940 5:108137302-108137324 TCCTACAAAAAATACAGCCTTGG - Intronic
995663578 5:114514122-114514144 TTATACAAAAATATCAGTCTAGG - Intergenic
998453657 5:142253757-142253779 TTTTTCAAAAAAACCAGCCTGGG - Intergenic
1001022676 5:168196755-168196777 TTCTTCAAGAACACTGGCCTGGG - Intronic
1001393474 5:171399567-171399589 TTCTACAGAGAAACCAGCTTGGG + Intronic
1001527658 5:172440290-172440312 TCCTACACAATCACCCGCCTGGG + Intronic
1001867666 5:175119194-175119216 TTTTAAAATAAAACCAGCCTGGG + Intergenic
1002164065 5:177333764-177333786 TTCTACAAAACCCGAAGCCTGGG - Intronic
1003993125 6:11507829-11507851 TTCTACTAAATCACCAGCCAAGG + Intergenic
1004593067 6:17072323-17072345 TTCTACAAATCCATCAGCATGGG + Intergenic
1007857115 6:44869303-44869325 TTCTACAAAAACAACTCCTTGGG + Intronic
1008125187 6:47660094-47660116 TTGTACAAGAACAAAAGCCTGGG + Intronic
1009576632 6:65471182-65471204 GTTTACAAAAGCACCAGCCTGGG + Intronic
1010604397 6:77870193-77870215 TTCTAAAACAGCACTAGCCTGGG - Intronic
1013108892 6:107049349-107049371 TTCTACTAAAACATAAGCCAGGG - Intronic
1013279313 6:108620833-108620855 TTCAATAAAAACACCAGTATAGG - Intronic
1013354036 6:109331913-109331935 TTCTTCAAGAGAACCAGCCTGGG - Intergenic
1014242632 6:119034637-119034659 TTCTAGAAAATATCCAGCCTAGG - Intronic
1014267513 6:119297881-119297903 TTCAAGAAATCCACCAGCCTGGG + Intronic
1015052550 6:128859672-128859694 TTCTCCAAAAAGAAAAGCCTGGG - Intergenic
1016326904 6:142913213-142913235 ATCTTCAAAAACTCAAGCCTTGG + Intronic
1016504281 6:144761046-144761068 TTCTACAAACACATGAGCCATGG - Intronic
1017826886 6:158088276-158088298 TATTTCAAAAACCCCAGCCTGGG - Intronic
1019048636 6:169167045-169167067 TTCTAGAAAGACACACGCCTGGG + Intergenic
1019259512 7:73011-73033 TCCTATAAAAACACCAGCAGAGG - Intergenic
1020177795 7:5897028-5897050 TTCTACAAAAAAAACTGCCATGG + Intergenic
1020305122 7:6827946-6827968 TTCTACAAAAAAAACTGCCATGG - Intergenic
1020783257 7:12541898-12541920 TTCTTAAAGAACACCAGGCTTGG + Intergenic
1021605589 7:22406209-22406231 TTCTTAAAAAACACCAGTCATGG - Intergenic
1024428601 7:49260058-49260080 TTCCACAACAATACCATCCTAGG + Intergenic
1024568472 7:50704440-50704462 TTCTAGAAACACACCTGCATGGG + Intronic
1024831166 7:53459816-53459838 TTAAAGGAAAACACCAGCCTGGG + Intergenic
1027399357 7:77791328-77791350 TTGTACAAAAATACCTTCCTAGG - Intergenic
1028345596 7:89778278-89778300 TTCCATAAAAATAACAGCCTGGG - Intergenic
1029248348 7:99218683-99218705 TTCAACAGAGACAACAGCCTAGG + Intergenic
1031797758 7:126198212-126198234 TTCTATGAATACACTAGCCTTGG + Intergenic
1032750414 7:134834474-134834496 TTCTACAAAAAGAACAGATTTGG + Intronic
1034584316 7:152075636-152075658 GTCTACAAAAATACAAGCCGTGG + Intronic
1034954041 7:155322318-155322340 TGCTACTACAACTCCAGCCTGGG + Intergenic
1035615201 8:994493-994515 TTATTAAAAAACACCAGGCTGGG - Intergenic
1038515021 8:28180738-28180760 TTCTAGATAAACCACAGCCTTGG - Intronic
1040391025 8:46950638-46950660 TTCTAAAAAAGCAGCAGGCTGGG + Intergenic
1041448065 8:57975417-57975439 TTCTCCAAAACCACCATCCATGG - Intergenic
1041473945 8:58241751-58241773 TTCTACAAAAATACCTGATTGGG + Intergenic
1043984311 8:86675620-86675642 TCCTACTTAAAGACCAGCCTGGG - Intronic
1044948385 8:97412835-97412857 TTCAATAAAACCACCAGCTTTGG - Intergenic
1046122746 8:109865912-109865934 GTTTACAAAAACAGCAGCATTGG + Intergenic
1047494375 8:125399100-125399122 TTCTACAAAACCCCAAGCCAGGG + Intergenic
1055302851 9:74900234-74900256 ATATATAAATACACCAGCCTTGG - Intergenic
1055463233 9:76538930-76538952 TTCTGCAAAATAACCCGCCTAGG - Intergenic
1055898797 9:81211057-81211079 TTCTATAACAGCAGCAGCCTTGG - Intergenic
1056747809 9:89319464-89319486 TTCTACAAAAAAAAAAGCATTGG + Intronic
1057520770 9:95758430-95758452 TTCTATAAAAACAGTAGCCTGGG - Intergenic
1060505633 9:124196470-124196492 CTACACAAAAACAACAGCCTAGG + Intergenic
1060808286 9:126592571-126592593 TTCGACGAAGACATCAGCCTGGG - Intergenic
1061198769 9:129123976-129123998 TTATATAAAAACACCAGGCCAGG - Intronic
1062745188 9:138207452-138207474 TCCTATAAAAACACCAGCAGAGG + Intergenic
1188118621 X:26277477-26277499 ATCTACTAAGACACTAGCCTAGG - Intergenic
1190835214 X:54094553-54094575 CTCTACAAAAAGACTAGCCCAGG - Intronic
1191791463 X:64976409-64976431 ATGTACAAATACACCAGCCAAGG + Exonic
1193934968 X:87607540-87607562 TTCTAGAAAAACAAAAACCTTGG + Intronic
1194141932 X:90218973-90218995 TTCCTGAACAACACCAGCCTGGG + Intergenic
1194460333 X:94158918-94158940 TTCTACACTAACAGCAGTCTAGG - Intergenic
1194852076 X:98881784-98881806 TTCCACAAAAACCCCACCCAAGG + Intergenic
1196537385 X:116863241-116863263 ACCTACTAAGACACCAGCCTGGG - Intergenic
1199295667 X:146155504-146155526 TTCTATCAGAACACCACCCTGGG - Intergenic
1199317392 X:146396250-146396272 ATCTACAGAGACACCAGCTTGGG - Intergenic
1200487693 Y:3788086-3788108 TTCCTGAACAACACCAGCCTGGG + Intergenic