ID: 1150289661

View in Genome Browser
Species Human (GRCh38)
Location 17:63973947-63973969
Sequence CCACAGGAATAGGCTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150289661_1150289673 7 Left 1150289661 17:63973947-63973969 CCCTCCAGAGCCTATTCCTGTGG No data
Right 1150289673 17:63973977-63973999 GGGGGATCACTTATTGCAAATGG No data
1150289661_1150289676 15 Left 1150289661 17:63973947-63973969 CCCTCCAGAGCCTATTCCTGTGG No data
Right 1150289676 17:63973985-63974007 ACTTATTGCAAATGGCCCTGGGG No data
1150289661_1150289677 16 Left 1150289661 17:63973947-63973969 CCCTCCAGAGCCTATTCCTGTGG No data
Right 1150289677 17:63973986-63974008 CTTATTGCAAATGGCCCTGGGGG No data
1150289661_1150289674 13 Left 1150289661 17:63973947-63973969 CCCTCCAGAGCCTATTCCTGTGG No data
Right 1150289674 17:63973983-63974005 TCACTTATTGCAAATGGCCCTGG No data
1150289661_1150289675 14 Left 1150289661 17:63973947-63973969 CCCTCCAGAGCCTATTCCTGTGG No data
Right 1150289675 17:63973984-63974006 CACTTATTGCAAATGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150289661 Original CRISPR CCACAGGAATAGGCTCTGGA GGG (reversed) Intergenic
No off target data available for this crispr