ID: 1150292121

View in Genome Browser
Species Human (GRCh38)
Location 17:63988108-63988130
Sequence GATTTTAGGGGGCTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150292121_1150292132 6 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292132 17:63988137-63988159 CAATTCCTTGAGAGATGCCAGGG No data
1150292121_1150292136 16 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292136 17:63988147-63988169 AGAGATGCCAGGGATGGAGAGGG No data
1150292121_1150292139 21 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292139 17:63988152-63988174 TGCCAGGGATGGAGAGGGGGAGG No data
1150292121_1150292138 18 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292138 17:63988149-63988171 AGATGCCAGGGATGGAGAGGGGG No data
1150292121_1150292137 17 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292137 17:63988148-63988170 GAGATGCCAGGGATGGAGAGGGG No data
1150292121_1150292131 5 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292131 17:63988136-63988158 ACAATTCCTTGAGAGATGCCAGG No data
1150292121_1150292140 22 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292140 17:63988153-63988175 GCCAGGGATGGAGAGGGGGAGGG No data
1150292121_1150292135 15 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292135 17:63988146-63988168 GAGAGATGCCAGGGATGGAGAGG No data
1150292121_1150292133 10 Left 1150292121 17:63988108-63988130 CCTTCCCCAAGCCCCCTAAAATC No data
Right 1150292133 17:63988141-63988163 TCCTTGAGAGATGCCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150292121 Original CRISPR GATTTTAGGGGGCTTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr