ID: 1150292916

View in Genome Browser
Species Human (GRCh38)
Location 17:63992077-63992099
Sequence TGGTGACCAGCAGTCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150292916_1150292917 -7 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292917 17:63992093-63992115 GTCACCACCCCGATAATCACTGG No data
1150292916_1150292927 21 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292927 17:63992121-63992143 TGCTCCCTGTCTGTGGGCATGGG No data
1150292916_1150292923 14 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292923 17:63992114-63992136 GGGCCGCTGCTCCCTGTCTGTGG No data
1150292916_1150292924 15 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292924 17:63992115-63992137 GGCCGCTGCTCCCTGTCTGTGGG No data
1150292916_1150292931 30 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292931 17:63992130-63992152 TCTGTGGGCATGGGAGAAGAGGG No data
1150292916_1150292930 29 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292930 17:63992129-63992151 GTCTGTGGGCATGGGAGAAGAGG No data
1150292916_1150292926 20 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292926 17:63992120-63992142 CTGCTCCCTGTCTGTGGGCATGG No data
1150292916_1150292918 -6 Left 1150292916 17:63992077-63992099 CCATCTGGGACTGCTGGTCACCA No data
Right 1150292918 17:63992094-63992116 TCACCACCCCGATAATCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150292916 Original CRISPR TGGTGACCAGCAGTCCCAGA TGG (reversed) Intergenic
No off target data available for this crispr