ID: 1150301786

View in Genome Browser
Species Human (GRCh38)
Location 17:64053269-64053291
Sequence CACCGATGTTGAGGGAGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150301780_1150301786 4 Left 1150301780 17:64053242-64053264 CCGCTGGCCTGGTAAAGTGCAGC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1150301774_1150301786 15 Left 1150301774 17:64053231-64053253 CCCCACCCGGGCCGCTGGCCTGG 0: 1
1: 0
2: 0
3: 32
4: 294
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1150301772_1150301786 26 Left 1150301772 17:64053220-64053242 CCACTGATTCTCCCCACCCGGGC 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1150301777_1150301786 13 Left 1150301777 17:64053233-64053255 CCACCCGGGCCGCTGGCCTGGTA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1150301776_1150301786 14 Left 1150301776 17:64053232-64053254 CCCACCCGGGCCGCTGGCCTGGT 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1150301779_1150301786 9 Left 1150301779 17:64053237-64053259 CCGGGCCGCTGGCCTGGTAAAGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1150301781_1150301786 -3 Left 1150301781 17:64053249-64053271 CCTGGTAAAGTGCAGCCTCTCAC 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1150301778_1150301786 10 Left 1150301778 17:64053236-64053258 CCCGGGCCGCTGGCCTGGTAAAG 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150301786 Original CRISPR CACCGATGTTGAGGGAGTGG AGG Exonic
900231377 1:1560296-1560318 CACAGATGTGGTGGGTGTGGTGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
905067034 1:35192630-35192652 CCCCGAGGTTGGTGGAGTGGCGG + Exonic
905960263 1:42036611-42036633 CGCCGGTGCTGAGGGAGAGGTGG - Intergenic
908405941 1:63814422-63814444 CACCGATGGGGTGGGGGTGGTGG + Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915315403 1:155026035-155026057 CAGGGGTGTTGAGGGGGTGGGGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916085528 1:161266380-161266402 CACTGAGGTTTAGGGAATGGGGG - Intronic
919775793 1:201193175-201193197 CACTGATGGTGTGGGAGGGGTGG + Intronic
920898861 1:210086671-210086693 CACTGCTGTTGAGGTGGTGGTGG + Intronic
921203443 1:212828056-212828078 CATGGATCTTGAGGGAGTGGGGG + Intergenic
921217408 1:212949930-212949952 CACAGCTGTTGAGTGAGAGGAGG - Intergenic
922950390 1:229554165-229554187 CACAGGAGTTGAGGGTGTGGGGG + Intronic
923146553 1:231202569-231202591 CACAGATGTCAAGGGAGGGGAGG + Intronic
923355009 1:233145834-233145856 CACCGAAGGTAAGGAAGTGGTGG - Intronic
1067060200 10:43074488-43074510 CATGGATTTTTAGGGAGTGGGGG + Intergenic
1069835500 10:71305461-71305483 CATCGCTGTTGAGGGAGGGGAGG - Intergenic
1071683992 10:87735862-87735884 CAGAGAGGTTCAGGGAGTGGGGG - Intronic
1075600921 10:123768549-123768571 CATCGGGGTTGAGGGAGGGGAGG + Exonic
1076658473 10:132039640-132039662 CAGCGCTATGGAGGGAGTGGGGG - Intergenic
1079944057 11:26719392-26719414 TACTGATGTTTAGGGAGTTGAGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1090835368 11:130449747-130449769 CAACGATGTTGATGGGGTTGAGG - Exonic
1092358168 12:7814255-7814277 CTCCCTTGTTGAGGGAGAGGTGG + Exonic
1092371620 12:7921352-7921374 CTCCCTTGTTGAGGGAGAGGTGG + Exonic
1094698603 12:32846328-32846350 CACCGGGGTGGGGGGAGTGGGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097137940 12:56875084-56875106 CCCAGAGGTTGAGGGGGTGGGGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098517904 12:71399490-71399512 CACAGCTGTGAAGGGAGTGGGGG - Intronic
1099246958 12:80203479-80203501 CATCTTTGTTGAGGGGGTGGAGG + Intergenic
1101326987 12:103724230-103724252 CACCAGTGTGGAGGTAGTGGAGG + Intronic
1103164943 12:118762459-118762481 CACTGAGGCTGGGGGAGTGGTGG + Intergenic
1103415340 12:120739060-120739082 CTCCCCTGCTGAGGGAGTGGGGG + Intronic
1104786721 12:131455076-131455098 CACAGATGTTGAGGCAGGGGTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108982617 13:56537816-56537838 AACAGATGTTGAAGGAGTTGTGG - Intergenic
1110596692 13:77327173-77327195 CCCCGAGGCGGAGGGAGTGGTGG - Intergenic
1113542543 13:111120535-111120557 GACGGGGGTTGAGGGAGTGGGGG + Intronic
1117079016 14:52132577-52132599 CACCCATGGTGAGGAAGTGGAGG + Intergenic
1117251659 14:53946101-53946123 CACCTTTGGAGAGGGAGTGGGGG + Intergenic
1118159729 14:63276189-63276211 CACCGAAGCTGAGGCACTGGGGG - Intronic
1118976717 14:70684221-70684243 CTCCGAGGTTGGGGGAGTGAGGG - Intergenic
1119314082 14:73676930-73676952 CACTGATGTTGAGGGTGGAGGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122695107 14:103548621-103548643 CACCCATGTTGGGGGAGTCAGGG - Intergenic
1126070416 15:44861003-44861025 CACCAAAGTTTAGGAAGTGGCGG - Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130861974 15:87899384-87899406 CACAGAAATTGAGGGGGTGGGGG - Intronic
1131583938 15:93673257-93673279 CACTGATGTTGACGTAATGGGGG + Intergenic
1136374299 16:29856271-29856293 CAGGGAGGTTGGGGGAGTGGGGG - Intergenic
1137675368 16:50301300-50301322 CCCCCATGTGGAGGGAGAGGTGG + Intronic
1142978808 17:3659956-3659978 CACCGTTGTTGTAGGACTGGAGG - Exonic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1148241211 17:46000492-46000514 CGCCGATCTTGTGGGAGTCGTGG + Intronic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG + Exonic
1150610050 17:66726596-66726618 GACCGAGGCGGAGGGAGTGGTGG + Intronic
1158612696 18:58956744-58956766 CACCGCTGTGGGGTGAGTGGAGG - Intronic
1160286462 18:77547943-77547965 CACGGCTGTTGAGGGGCTGGAGG - Intergenic
1161412233 19:4123331-4123353 CAGCGAGGTTGAGTGAGGGGAGG - Intronic
1162550416 19:11355410-11355432 CTCCGAGGTGGAGGGAGGGGCGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163437417 19:17303587-17303609 CACCGAGGTTGGGGGAGGGATGG + Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
925860943 2:8174587-8174609 CACTGATGCTGAGGGAGTTGAGG - Intergenic
925897658 2:8485446-8485468 AACCGAGGTTGATGGAGTTGAGG - Intergenic
928284648 2:29979168-29979190 CACAGCTGGTGATGGAGTGGTGG + Intergenic
929166522 2:38887287-38887309 CACACATGTTGTGGAAGTGGGGG - Intronic
929559613 2:42947809-42947831 CACTGATGGGGAAGGAGTGGAGG - Intergenic
930594068 2:53364372-53364394 CCCACATGTTGAGGGAGGGGAGG - Intergenic
931305457 2:61024082-61024104 CAGAGATGGTGAGGGAGTGGTGG - Intronic
931993967 2:67822376-67822398 CCCAGGAGTTGAGGGAGTGGAGG + Intergenic
932454834 2:71842805-71842827 CAAGGATGATGAGGGAATGGTGG + Intergenic
946409633 2:219509596-219509618 CTCTGGTGTGGAGGGAGTGGGGG + Intergenic
946764524 2:223027721-223027743 CTGTGATGTTCAGGGAGTGGTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168789598 20:567436-567458 CATCCATGGTGAGAGAGTGGAGG + Intergenic
1169110730 20:3031718-3031740 GACTGATGTTGAGAAAGTGGAGG - Intronic
1170069933 20:12355499-12355521 CTAGTATGTTGAGGGAGTGGAGG + Intergenic
1172475309 20:35232865-35232887 GAGCCATGTTGAGGAAGTGGAGG + Intronic
1172640963 20:36440226-36440248 AACCGAGGTTCAGGGAGGGGAGG - Intronic
1172650827 20:36500316-36500338 CATCGATGCTGATGGAGTTGGGG - Exonic
1173248145 20:41350134-41350156 CACAGAGGTAGAGGGAGTGCTGG - Exonic
1173503632 20:43570703-43570725 AAATGATGTTGAGGGAGTGCAGG - Exonic
1173843846 20:46175747-46175769 CACGGATCTTGTGGCAGTGGAGG + Intronic
1178187814 21:30243770-30243792 CAGCTACATTGAGGGAGTGGGGG - Intergenic
1178862100 21:36298056-36298078 CACGGATCTTCAGGGAGTGCCGG + Intergenic
1183036443 22:35144261-35144283 CCCCGCTGTGGAGGGGGTGGGGG + Intergenic
1183457344 22:37930002-37930024 CACAGATGGTGAGGGGCTGGCGG + Intronic
950484571 3:13265397-13265419 CTCAGAGTTTGAGGGAGTGGGGG - Intergenic
952260535 3:31735669-31735691 CCCCGATGTAGAAGGACTGGAGG - Intronic
954117387 3:48474706-48474728 CACAGAGGTTGAAGGAGAGGGGG - Intronic
956629718 3:71304219-71304241 GGCCGATGTGGAGTGAGTGGGGG - Intronic
961650753 3:128415664-128415686 CCCCGAGGTTGAGGGAGAAGCGG - Intergenic
962410109 3:135133464-135133486 GACAGATGGTGAGTGAGTGGAGG + Intronic
963799086 3:149658832-149658854 CACGGATGTTGCGGGGGAGGGGG - Intronic
964113465 3:153111159-153111181 CAACTATGTTGTGGGAGTGTTGG + Intergenic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
969251372 4:5970793-5970815 CAGGGCTGTTGAGGGGGTGGGGG - Intronic
971892926 4:32548299-32548321 CACTTATATTGAGGTAGTGGGGG + Intergenic
972279013 4:37585313-37585335 CAGAGGTGTTGAGGGAGAGGAGG + Intronic
974474771 4:62364345-62364367 CACAGGTGTTGGAGGAGTGGTGG + Intergenic
974743226 4:66034998-66035020 CATCAATGTGGAGAGAGTGGAGG + Intergenic
974962749 4:68724306-68724328 TACCGATGTTGATGAAGTCGTGG + Intergenic
975206157 4:71646019-71646041 TACCAAGGTTGAGGTAGTGGGGG - Intergenic
977336247 4:95703310-95703332 AACAGATGTTGAGGGGTTGGGGG - Intergenic
982395198 4:154908583-154908605 CACTGATGTTGAAGCAGCGGTGG + Intergenic
984601383 4:181730573-181730595 GACAGATGTGGAGGAAGTGGGGG + Intergenic
991009705 5:61870282-61870304 CAAAGATGTGGAGGGAGAGGAGG - Intergenic
991058410 5:62344513-62344535 CAGTGTTGTTGAGGGTGTGGAGG + Intronic
996884867 5:128342699-128342721 CACCGGAGGAGAGGGAGTGGGGG + Intronic
1001758834 5:174191226-174191248 CAAGGAGGTTGAGGGGGTGGTGG + Intronic
1001971973 5:175963787-175963809 CAGGGTTGTTGGGGGAGTGGTGG - Intronic
1002245469 5:177879990-177880012 CAGGGTTGTTGGGGGAGTGGTGG + Intergenic
1002382237 5:178839204-178839226 CACAGATCTGGAGGGGGTGGTGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003514637 6:6807747-6807769 CACAGTTCTTGAGGGAATGGTGG + Intergenic
1005720979 6:28601841-28601863 CACCGATGTTGAGGTGTTTGAGG + Intronic
1005852858 6:29835196-29835218 TACTGATGTTGATGGAGTCGAGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007254898 6:40521788-40521810 CACCGATGAAAAGGGAGGGGTGG + Intronic
1008355815 6:50551971-50551993 CACAGAGGGTGAGGAAGTGGAGG - Intergenic
1019056360 6:169226221-169226243 CACGGATGGTGACGGTGTGGGGG - Exonic
1019552603 7:1610612-1610634 CGCCGATGATGAGGGAGGGAGGG + Intergenic
1021196716 7:17681979-17682001 CAGCAAAGTTGAGAGAGTGGAGG - Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046692752 8:117304218-117304240 CACCGGCGGTGAGGGGGTGGGGG - Intergenic
1049272626 8:141703983-141704005 CTCTGATGGGGAGGGAGTGGGGG - Intergenic
1051755768 9:20398496-20398518 CACAGAAATTGGGGGAGTGGGGG + Intronic
1056047581 9:82734818-82734840 CCCCGATCTTCAGGGATTGGAGG - Intergenic
1058393879 9:104526961-104526983 CACCAGTGTTGAGGGAATGGAGG + Exonic
1058394602 9:104536475-104536497 CACCAATGTTGAGGGAACAGAGG + Exonic
1059094411 9:111397308-111397330 CAGGGATGGTGAGGGAGTGGAGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1062276833 9:135735373-135735395 CACCCATGCTGAGGGAGGGCTGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187406458 X:19008917-19008939 CACCTATTTAGAGGGATTGGGGG - Intronic
1188292278 X:28404246-28404268 CACAGATTTTTATGGAGTGGAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201681107 Y:16644338-16644360 CACAGACACTGAGGGAGTGGAGG + Intergenic