ID: 1150302260

View in Genome Browser
Species Human (GRCh38)
Location 17:64056316-64056338
Sequence TAGCATGGCTGAGCCAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150302257_1150302260 -5 Left 1150302257 17:64056298-64056320 CCAAACAGGAAGCACAGGTAGCA 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1150302260 17:64056316-64056338 TAGCATGGCTGAGCCAGTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150302260 Original CRISPR TAGCATGGCTGAGCCAGTGG TGG Intronic
900412041 1:2516955-2516977 TGGCAGGGCTGTGCCACTGGTGG + Intronic
903753516 1:25645072-25645094 GAGCATGCCTCAGCCACTGGGGG + Intronic
904255932 1:29254999-29255021 ATGGATGACTGAGCCAGTGGTGG + Intronic
905768389 1:40622012-40622034 CAGCATGGCTGTGCCTGTGAGGG - Exonic
906589974 1:47015795-47015817 TAGAATGGATGAGCCAGAAGGGG - Intergenic
910150201 1:84133682-84133704 GAGCACAGCTGAGCCAGTGCAGG + Intronic
910965425 1:92803566-92803588 TAACCTAGCTGAGCCAATGGCGG + Intergenic
912718134 1:111996640-111996662 TTGCAGGTCTGAGACAGTGGAGG + Intergenic
920045795 1:203131588-203131610 GAGCCACGCTGAGCCAGTGGGGG - Intronic
921049206 1:211499170-211499192 GAGGAAGACTGAGCCAGTGGTGG + Intergenic
922604180 1:226878981-226879003 TAGTGAGGCTGAGCCAGAGGAGG + Intronic
922801808 1:228367963-228367985 GTGCATGGCTGGGGCAGTGGCGG - Intronic
1070375514 10:75827246-75827268 CAGCATAGGTGAGTCAGTGGAGG + Intronic
1073947492 10:108767753-108767775 TTGCTTGTCTAAGCCAGTGGGGG - Intergenic
1073980444 10:109147809-109147831 AAGCATGGCTGAGCCAGCCTCGG + Intergenic
1074522819 10:114240203-114240225 AAGCAGGGCTGAGCCAGGTGGGG - Intronic
1074625475 10:115179268-115179290 CAGGTAGGCTGAGCCAGTGGTGG + Intronic
1074854236 10:117461715-117461737 CAGCAGGGCTGAGCCTGTGTAGG - Intergenic
1075305619 10:121365154-121365176 AAGCATGGATGAGCCTGGGGAGG + Intergenic
1077158729 11:1103076-1103098 TCCCATGGGTGAGCCAGTGAAGG - Intergenic
1077862784 11:6198335-6198357 TGGCATGCCAGAGCGAGTGGAGG - Intergenic
1078849813 11:15153380-15153402 CAGCTTCCCTGAGCCAGTGGGGG + Intronic
1079559647 11:21806131-21806153 TAGTGTGGCTGAGCCAGGGGAGG - Intergenic
1080453033 11:32394336-32394358 CAGCTTGGGTTAGCCAGTGGAGG - Intronic
1090703149 11:129314477-129314499 AATCATGGCTGAAGCAGTGGGGG - Intergenic
1093809550 12:23474853-23474875 TTGCATGAGTGTGCCAGTGGAGG - Intergenic
1094630414 12:32168592-32168614 CAGCATGGCTGAGACAGTTTGGG - Intronic
1098924397 12:76333640-76333662 CAGCATGGCTGGGGCAGGGGAGG - Intergenic
1101740336 12:107495284-107495306 GAGCGTGGCTGAGCCCGTGCAGG - Intronic
1104108090 12:125682196-125682218 GAGCATGGCTGATGCATTGGAGG + Intergenic
1104852570 12:131884285-131884307 TCCCATGGCTGAGTCGGTGGGGG - Intergenic
1105608472 13:21946970-21946992 TTGCATGGCTGCACCAGTGTGGG - Intergenic
1105944510 13:25177841-25177863 TGCCATGGCAGGGCCAGTGGAGG - Intergenic
1109151124 13:58848300-58848322 TAGCATGGGCAAGCCAGGGGTGG - Intergenic
1111437441 13:88228487-88228509 TAGTATGGCTGACACAGGGGAGG + Intergenic
1112646529 13:101339403-101339425 TAGCAGGGATGAGTCAGTTGGGG + Intronic
1113523554 13:110956743-110956765 TGGCAGGGCTGAGGCGGTGGAGG + Intergenic
1113701712 13:112393492-112393514 TGGCAGGGCTGAGGCGGTGGAGG - Intronic
1114166483 14:20223987-20224009 TAGCATGTTTGGGACAGTGGAGG - Exonic
1118169371 14:63371574-63371596 TAGCATGTTTTAGCCAGAGGTGG + Exonic
1119891948 14:78189488-78189510 CAGCATGGCTGAGTCAGAAGAGG - Intergenic
1120656570 14:87197360-87197382 TAGCATGTCTGAGGCAGGGCTGG + Intergenic
1121005413 14:90487520-90487542 CAGAATGGCTGAGCCACAGGAGG + Intergenic
1121546603 14:94767974-94767996 TAGCATTGCTGGGCCAGAGCCGG - Intergenic
1122596874 14:102899750-102899772 TGGCCTGGCTGTGGCAGTGGGGG + Intronic
1123767618 15:23497055-23497077 TAACAAGGCTGAGCCACTTGTGG + Intergenic
1124570648 15:30860252-30860274 TAACAAGGCTGAGCCACTTGAGG - Intergenic
1127620103 15:60725830-60725852 TCGTATGACTGACCCAGTGGAGG - Intronic
1129244832 15:74272762-74272784 TAGCCTGGCTGACCCTGGGGAGG - Exonic
1133027968 16:2996900-2996922 TGGTAAGGCTGAGCCACTGGGGG - Intergenic
1139303967 16:65967706-65967728 AAGCAGGGTCGAGCCAGTGGAGG - Intergenic
1140228602 16:73098733-73098755 TAGCTTGGCAGAGCCAGCGTGGG + Intergenic
1142302475 16:89266639-89266661 CTGCCAGGCTGAGCCAGTGGCGG - Intergenic
1142995768 17:3759410-3759432 TTGCATGGCTGAGGCAGTCTTGG + Exonic
1147565617 17:41534846-41534868 TAGCCTGGCGGACCCAGGGGTGG - Intergenic
1147566469 17:41539311-41539333 TGGCAGGACTGAGCCAGGGGAGG - Intergenic
1148153621 17:45410649-45410671 AATCACGGCTGAGCCTGTGGGGG + Intronic
1150302260 17:64056316-64056338 TAGCATGGCTGAGCCAGTGGTGG + Intronic
1157400357 18:47382154-47382176 AAGGATGGCTTAGCCAGTCGAGG + Intergenic
1158895299 18:61907282-61907304 TAGCATAGCTTTGCCCGTGGCGG - Intergenic
1160914432 19:1490022-1490044 GAGCTTGGCTGAGGCAGGGGTGG + Intronic
1161345475 19:3766970-3766992 CAGGAAGGCTGAGCAAGTGGGGG + Intronic
1161479191 19:4502235-4502257 TAGCATTGCTGGTGCAGTGGGGG + Exonic
1162803184 19:13122345-13122367 TCTCATGGCTGAGACAGGGGTGG - Intronic
1164389545 19:27805930-27805952 TAGCGTGGCCGAGGCCGTGGTGG - Intergenic
1164498314 19:28790898-28790920 AAGTATTGCTGAGTCAGTGGTGG - Intergenic
1166562785 19:43744450-43744472 TTGCAGGGCTGAGCCTGAGGTGG + Intronic
1167686980 19:50962602-50962624 TAGGAAGGGAGAGCCAGTGGGGG - Intronic
926797067 2:16627866-16627888 CAGCATGGCTGGGCCAGGGAGGG + Intronic
928820409 2:35355208-35355230 TACCAAGGGTGAGCCAGGGGTGG + Intergenic
931432046 2:62216039-62216061 TAGCTTGCCTGAGCCCATGGCGG + Intronic
934156105 2:89202695-89202717 GAGCATGGCTGAGCCAGAAAGGG + Intergenic
934211211 2:89980068-89980090 GAGCATGGCTGAGCCAGAAAGGG - Intergenic
935755111 2:106270684-106270706 GAGCATAGCTGTGGCAGTGGAGG - Intergenic
937445259 2:121952180-121952202 AAGCATGAATGAGACAGTGGTGG + Intergenic
939462137 2:142510934-142510956 AAGCATGAAAGAGCCAGTGGGGG + Intergenic
940836992 2:158533249-158533271 TTCCATGCCTGGGCCAGTGGAGG - Exonic
945163764 2:206920580-206920602 TAACATGGCTGAGCTAAGGGTGG + Intergenic
947135385 2:226972424-226972446 TAGCAGGGCTGAGAAAGAGGAGG - Intronic
947525217 2:230873387-230873409 TAGCAATGCTGGGTCAGTGGGGG - Intronic
1169002671 20:2179261-2179283 TAGATTGGCAGGGCCAGTGGAGG - Intergenic
1169083899 20:2815381-2815403 CAGCAGGGCTGGGCCAGTGGTGG - Exonic
1169535261 20:6532211-6532233 AAGCCTGGCTGAGGCTGTGGTGG + Intergenic
1171237067 20:23535644-23535666 TAGGATGGCTGAAACAATGGGGG + Intergenic
1172332603 20:34085844-34085866 TAACAAGGGTTAGCCAGTGGGGG - Intronic
1173398232 20:42700940-42700962 TAGCCAGGCAGAGCCAGTGGGGG + Intronic
1174135656 20:48377235-48377257 GAGCATTGCTTAGCTAGTGGCGG - Intergenic
1174402599 20:50283938-50283960 TGGCAGGGCTGAGCCTGGGGTGG + Intergenic
1176119102 20:63446093-63446115 GACCCTGTCTGAGCCAGTGGGGG + Intronic
1176591973 21:8656206-8656228 TAGCATGGCTGGGTCAGTACTGG - Intergenic
1178314324 21:31556660-31556682 TAGCAGTGCAGAGCTAGTGGAGG + Intronic
1179842360 21:44085474-44085496 CAGCATGGGTAAGCCAGTCGGGG + Intronic
1181355403 22:22293585-22293607 TAGCATGGCTGGGTCAGTACTGG + Intergenic
1182295185 22:29308102-29308124 GGGCATGGCAGACCCAGTGGCGG + Exonic
1182737029 22:32538059-32538081 CAGCATGGCAGAGCCTGTGTTGG + Exonic
1182747308 22:32615816-32615838 CAGCACGGCTGGGCCAGAGGAGG + Intronic
1184286463 22:43474487-43474509 CAGCATGGCTGAGAGAGGGGCGG - Intronic
1184911740 22:47539985-47540007 CACCATGGCTTAGCCAGTAGGGG - Intergenic
1185031799 22:48447695-48447717 GAGAATGGCAGAGCCAGTGCTGG + Intergenic
953263411 3:41362563-41362585 GAGGATGGCTGAGTAAGTGGTGG - Intronic
953392827 3:42543750-42543772 TGGCATGGCTGAGCCTGGAGCGG - Intergenic
962325289 3:134427404-134427426 GGGCAGGGCTGAGACAGTGGTGG + Intergenic
964682995 3:159362897-159362919 TGGCATTGCTGATCCAGGGGTGG - Intronic
966520615 3:180869915-180869937 TAGCAGGTCTGAACCAGGGGAGG - Intronic
969565961 4:7978281-7978303 TGGCTTGGCTGAGCCTGAGGAGG + Intronic
970152745 4:13107034-13107056 TAGCAGGGCTGTGGGAGTGGGGG - Intergenic
970341835 4:15115566-15115588 TAGCATGCCTGAGGCCTTGGGGG - Intergenic
970503598 4:16704019-16704041 TAGCATGGGTCACCCAGTTGGGG - Intronic
974175249 4:58314389-58314411 TAGCATGATGGAGCCTGTGGTGG - Intergenic
979649480 4:123114133-123114155 GAGCAGAGCAGAGCCAGTGGAGG - Intronic
985390506 4:189487685-189487707 GAAGATGGCTGAGCCAGGGGAGG - Intergenic
985577148 5:678716-678738 GTGCAGGGCTGAGGCAGTGGTGG + Intronic
985911425 5:2886961-2886983 TGGAAGGGCTGAGCCAGTCGGGG - Intergenic
986307733 5:6528249-6528271 CAGGATGGCTGAGCCAGCTGTGG + Intergenic
986849671 5:11796200-11796222 TAGCATGGCAGATGCAGTTGAGG - Intronic
991660981 5:68950379-68950401 TGGCAGGGCAGAGCGAGTGGAGG - Intergenic
992496854 5:77302296-77302318 GAGCTTTGCTGTGCCAGTGGAGG - Intronic
994105776 5:95946665-95946687 TAACATAGCTGAGCCATTGTTGG - Intronic
994213402 5:97110186-97110208 GAGCCTGGCTTAGCCAGTGGAGG - Intronic
994608737 5:102008192-102008214 GTGAATGGCTGAGACAGTGGTGG + Intergenic
997658593 5:135573471-135573493 TAGCATGGCTGGGCCAGGTGAGG + Intronic
1001748105 5:174107549-174107571 GAGCTTGGCTTAGCCAATGGGGG - Exonic
1002425855 5:179175229-179175251 AAGCATGGCTGAGACAGCTGCGG - Intronic
1003419406 6:5942342-5942364 TAGCATGGCTGAGACAGAGCTGG - Intergenic
1003493179 6:6641698-6641720 GACCATGGATGAGCTAGTGGTGG - Intronic
1007777323 6:44230984-44231006 TAGCAGCCCTGAGCCAGAGGAGG + Intronic
1011350822 6:86421807-86421829 TAGCTTAGCAGAGCCAATGGAGG + Intergenic
1013490877 6:110645564-110645586 TAGGATGGGTGGGCAAGTGGAGG + Intronic
1015023950 6:128510247-128510269 GACCATGGCTGTGCCAGTTGAGG - Intronic
1016730511 6:147422940-147422962 CAGCATGGCTGAGCCAGCCCTGG + Intergenic
1019701588 7:2476981-2477003 TGGGGTGGCTGAGCCAGTGGGGG - Intergenic
1021937689 7:25647244-25647266 CAGCATGTCAGAGCCAGGGGAGG + Intergenic
1024809132 7:53187162-53187184 TGGCTTCGCTGAGGCAGTGGTGG + Intergenic
1025120780 7:56299941-56299963 TAGCATGTTTTAGCCAGAGGTGG + Intergenic
1027352242 7:77324125-77324147 TAGAATGACTGAGCCAATGGGGG + Intronic
1028262791 7:88685677-88685699 TAGCATGGCTGGGCAAATGTTGG + Intergenic
1028403850 7:90455222-90455244 TAGTTTGGCTGAGCGAGTAGGGG - Intronic
1028807095 7:95040358-95040380 TAGCATGGCTGAGTCAGTAACGG + Intronic
1029038618 7:97549528-97549550 TAGCAAGGCAGAGACAGAGGCGG + Intergenic
1029152522 7:98491034-98491056 GTGCATAGCTGAGCCGGTGGAGG + Intergenic
1030215598 7:107041911-107041933 GAGGCTGCCTGAGCCAGTGGTGG - Intergenic
1031557295 7:123193335-123193357 TAGCATGTCTGAGTCACTTGGGG + Intronic
1031581130 7:123476421-123476443 AAGCATGGCTGAAGCAGTGTGGG + Intronic
1032982873 7:137304996-137305018 AAGCATGGCTGAGCAATTCGAGG + Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1038206933 8:25475855-25475877 TGGCAAGGCTGGGCCACTGGGGG - Intronic
1048504013 8:135004424-135004446 AAGCATGGCTGAGCCAATTGGGG + Intergenic
1049574011 8:143382249-143382271 CAGCATGGCTGACCCAGGGTTGG + Intronic
1051626318 9:19102855-19102877 TGGCTTCGCTGAGGCAGTGGTGG - Exonic
1056934455 9:90905097-90905119 TACAGTGGCTGAGCCTGTGGTGG - Intergenic
1060084070 9:120680816-120680838 TGGCCTGGCAGAACCAGTGGTGG - Intronic
1185860616 X:3575667-3575689 TATCATGGCTGATCCAATAGAGG - Intergenic
1186127852 X:6433580-6433602 AAGGATGGTTGAGCCTGTGGTGG + Intergenic
1191716696 X:64198632-64198654 TAGCAGGGCTGGGACAGAGGTGG - Intronic
1192010128 X:67260390-67260412 TAGGATGTCTGAGTCAGTGTGGG - Intergenic
1196861722 X:120034910-120034932 TAGCATGGCAGGGCCAGGTGTGG - Intergenic
1202199289 Y:22330127-22330149 TAGCATGACTCAGATAGTGGGGG + Intronic
1202583599 Y:26404404-26404426 TAGCATGGCTGGGTCAGTACTGG + Intergenic